A promoter, gene editing vector and application for improving gene editing efficiency of CRISPR / Cas9 system

Abstract

The present invention provides a promoter, a gene editing vector and an application for improving the gene editing efficiency of the CRISPR / Cas9 system, belonging to the field of genetic engineering technology, wherein the promoter is a Salvia miltiorrhiza SmRPS5A, SmEF1α or SmUBi promoter, the nucleotide sequence of the Salvia miltiorrhiza SmRPS5A promoter is shown in SEQ ID No. 1, the nucleotide sequence of the Salvia miltiorrhiza SmEF1α promoter is shown in SEQ ID No. 2, and the nucleotide sequence of the Salvia miltiorrhiza SmUBi promoter is shown in SEQ ID No. 3. Studies have shown that the gene editing efficiency of the Salvia miltiorrhiza SmRPS5A promoter for three sgRNA targets has reached more than 91%, and the gene editing efficiency of SmEF1α and SmUBi for sgRNA3 targets has also reached more than 87.50%, which can provide an important basis for the later screening of gene-edited positive plants.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and in particular relates to a promoter, a gene editing vector and an application thereof for improving the gene editing efficiency of a CRISPR / Cas9 system. Background Art

[0002] Salvia miltiorrhiza is a high-value traditional Chinese medicine with the functions of promoting blood circulation and removing blood stasis, relieving pain, clearing the heart and eliminating vexation, cooling blood and eliminating carbuncle. Due to its small genome, clear biosynthetic pathway of active ingredients and mature genetic transformation technology, it has the potential to become a medicinal model plant. In the process of Salvia miltiorrhiza breeding, traditional breeding technology still occupies an important position, but the breeding cycle is long and the efficiency is low; although artificial mutagenesis increases the frequency of mutation, the breeding accuracy is low and the screening is difficult; although hybrid breeding can make up for the shortcomings of the two, it also faces the problem of incompatibility of distant hybridization.

[0003] The establishment of the CRISPR-Cas9 gene editing system helps to create germplasm resources with specific traits but without exogenous genes, eliminating biosafety concerns about transgenic plants. The creation of germplasm by gene editing has been widely recognized. Therefore, the application of gene editing technology to medicinal plants, especially medicinal model plants, is of great significance for revealing the molecular mechanism of the formation of authentic medicinal materials and the directional cultivation of high-yield new varieties. CRISPR-Cas9 gene editing technology uses artificially designed sgRNA (guide RNA) to identify the target gene and guide the Cas9 protease to cut the target gene, forming a double-strand break, and repairing the gene after damage to achieve gene knockout or insertion. However, in the gene editing process of Salvia miltiorrhiza, it was found that the promoters that start Cas9 transcription are different, and the editing efficiency is different. The editing efficiency of the 35S strong promoter commonly used in plants is low, and the workload of screening gene editing positive plants in the later stage is very large. Therefore, the search for promoters with higher transcriptional activity has received continuous attention from technicians in this field. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a promoter, a gene editing vector and an application for improving the gene editing efficiency of the CRISPR / Cas9 system. The gene editing efficiency of the Salvia miltiorrhiza SmRPS5A promoter for three sgRNA targets reached more than 91%, and the gene editing efficiency of SmEF1α and SmUBi for sgRNA3 target also reached more than 87.50%, which provided a basis for the later screening of gene-edited positive plants.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an application of Salvia miltiorrhiza SmRPS5A, SmEF1α or SmUBi promoter in improving the efficiency of CRISPR / Cas9 gene editing, the nucleotide sequence of the Salvia miltiorrhiza SmRPS5A promoter is shown in SEQ ID No.1, the nucleotide sequence of the Salvia miltiorrhiza SmEF1α promoter is shown in SEQ ID No.2, and the nucleotide sequence of the Salvia miltiorrhiza SmUBi promoter is shown in SEQ ID No.3.

[0007] The present invention also provides a primer set for amplifying the SmRPS5A, SmEF1α or SmUBi promoter of Salvia miltiorrhiza. The primer set for amplifying the SmRPS5A promoter of Salvia miltiorrhiza is shown as SEQ ID No.4 and SEQ ID No.5, the primer set for amplifying the SmEF1α promoter is shown as SEQ ID No.6 and SEQ ID No.7, and the primer set for amplifying the SmUBi promoter is shown as SEQ ID No.8 and SEQ IDNo.9.

[0008] The present invention also provides a gene editing vector for improving the efficiency of CRISPR / Cas9 gene editing, comprising one of the Salvia miltiorrhiza SmRPS5A, SmEF1α and SmUBi promoters.

[0009] Preferably, it also includes an initial vector, on which a sgRNA sequence for targeting a target gene and a nucleotide sequence capable of encoding a cas9 protein are cloned.

[0010] Preferably, the nucleotide sequence of the cas9 protein is shown in SEQ ID No.10.

[0011] The present invention also provides a method for constructing the gene editing vector, comprising the following steps:

[0012] (1) Connecting the SmRPS5A, SmEF1α or SmUBi promoter of Salvia miltiorrhiza to the pLB vector, performing PCR amplification, and obtaining a proSmRPS5A fragment, a proSmEF1α fragment or a proSmUBi fragment containing the vector sequence;

[0013] (2) The proSmU6 and SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target sequences were connected to the pLB vector respectively, and PCR amplified to obtain the proSmU6 fragment containing the vector sequence and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment;

[0014] (3) Double digest the gene editing empty vector with restriction endonucleases PmeI and KpnI to obtain the Cas9-Kan linearized editing vector;

[0015] (4) homologously recombining the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3), and the proSmRPS5A fragment containing the vector sequence obtained in step (1) to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmRPS5A-Cas9-Kan;

[0016] Or the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmEF1α fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmEF1α-Cas9-Kan;

[0017] Alternatively, the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmUBi fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmUBi-Cas9-Kan.

[0018] Preferably, the primers for PCR amplification of the vector containing SmRPS5A in step (1) are shown as SEQ ID No.11 and SEQ ID No.12, the primers for PCR amplification of the vector containing SmEF1α are shown as SEQ ID No.13 and SEQ ID No.14, and the primers for PCR amplification of the vector containing SmUBi are shown as SEQ ID No.15 and SEQ ID No.16.

[0019] Preferably, the primers for PCR amplification of the vector containing proSmU6 in step (2) are shown as SEQ ID No. 17 and SEQ ID No. 18, and the primers for PCR amplification of the vector containing SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem targets are shown as SEQ ID No. 19 and SEQ ID No. 20.

[0020] The present invention also provides the use of the gene editing vector in improving the gene editing efficiency of the CRISPR / Cas9 system.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The three Salvia miltiorrhiza SmRPS5A, SmEF1α, and SmUBi promoters provided by the present invention can improve the editing efficiency of the CRISPR / Cas9 gene editing system and drive the efficient expression of Cas9. The results of the gene editing efficiency test experiment showed that the editing efficiency of the 35S promoter for the three sgRNA targets was as low as 53.13%, while the gene editing positive rate of the promoter SmRPS5A provided by the present invention for the three sgRNA targets reached more than 91%, which was significantly better than the editing efficiency of the 35S promoter; and the promoters SmUbi and SmEF1α also had higher editing efficiency than the 35S promoter for some sgRNA targets.

[0023] In addition, the three promoters of Salvia miltiorrhiza provided by the present invention are not only applicable to the knockout system, but also to the promoter of the cas9 gene in the gene knock-in, single base replacement, guide editing and other systems. It is of great significance to build a mutant strain library of Salvia miltiorrhiza and realize precision breeding. At the same time, the three promoters provided by the present invention are also applicable to Salvia plants closely related to Salvia miltiorrhiza. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the plasmid map of the empty vector for gene editing;

[0025] Figure 2 It is a gene editing vector that drives the Cas9 gene with the 35S promoter;

[0026] Figure 3 It is a gene editing vector that drives the Cas9 gene with the SmRPS5A promoter;

[0027] Figure 4 It is a gene editing vector that drives the Cas9 gene with the SmEF1α promoter;

[0028] Figure 5 It is a gene editing vector that drives the Cas9 gene with the SmUBi promoter;

[0029] Figure 6 This is a simplified schematic diagram of the multi-target knockout vector of Salvia miltiorrhiza;

[0030] Figure 7 This is the multi-target gene editing model process of Salvia miltiorrhiza. DETAILED DESCRIPTION

[0031] The present invention provides an application of Salvia miltiorrhiza SmRPS5A, SmEF1α or SmUBi promoter in improving the efficiency of CRISPR / Cas9 gene editing, the nucleotide sequence of the Salvia miltiorrhiza SmRPS5A promoter is shown in SEQ ID No.1, the nucleotide sequence of the Salvia miltiorrhiza SmEF1α promoter is shown in SEQ ID No.2, and the nucleotide sequence of the Salvia miltiorrhiza SmUBi promoter is shown in SEQ ID No.3.

[0032] In the present invention, the nucleotide sequence of the Salvia miltiorrhiza SmRPS5A, SmEF1α or SmUBi promoter is shown in Table 1.

[0033] Table 1 Nucleotide sequences of SmRPS5A, SmEF1α or SmUBi promoters of Salvia miltiorrhiza

[0034]

[0035]

[0036]

[0037]

[0038]

[0039] The present invention also provides a primer set for amplifying the SmRPS5A, SmEF1α or SmUBi promoter of Salvia miltiorrhiza. The primer set for amplifying the SmRPS5A promoter of Salvia miltiorrhiza is shown as SEQ ID No.4 and SEQ ID No.5, the primer set for amplifying the SmEF1α promoter is shown as SEQ ID No.6 and SEQ ID No.7, and the primer set for amplifying the SmUBi promoter is shown as SEQ ID No.8 and SEQ IDNo.9.

[0040] In the present invention, the primer set sequence for amplifying the promoter of SmRPS5A, SmEF1α or SmUBi of Salvia miltiorrhiza is shown in Table 2.

[0041] Table 2 Primer set sequences for amplifying the promoter of SmRPS5A, SmEF1α or SmUBi of Salvia miltiorrhiza

[0042] Promoter sequence SmRPS5A-F TAAGCTTAATAATACTCATTTCGTTC(SEQ ID No.4) SmRPS5A-R ATCTTCTCCGCGATTCACCTGAAATTG(SEQ ID No.5) SmEF1α-F GAAATAAATTAGTGTGAATAGCAAAG (SEQ ID No. 6) SmEF1α-R ATTTCAACTGTTAAGAGATAAATA(SEQ ID No.7) SmUBi-F TTTTACTTCTTTCCCGTCAAACTCA(SEQ ID No.8) SmUBi-R ATTTTGTATTTTAGCCCAACGTG(SEQ ID No.9)

[0043] The present invention also provides a gene editing vector for improving the efficiency of CRISPR / Cas9 gene editing, comprising one of the Salvia miltiorrhiza SmRPS5A, SmEF1α and SmUBi promoters.

[0044] In the present invention, the gene editing vector also includes an initial vector, on which are cloned an sgRNA sequence for targeting a target gene and a nucleotide sequence capable of encoding a cas9 protein; the nucleotide sequence of the cas9 protein is shown in SEQ ID No.10.

[0045]

[0046] The present invention also provides a method for constructing the gene editing vector, comprising the following steps:

[0047] (1) Connecting the SmRPS5A, SmEF1α or SmUBi promoter of Salvia miltiorrhiza to the pLB vector, performing PCR amplification, and obtaining a proSmRPS5A fragment, a proSmEF1α fragment or a proSmUBi fragment containing the vector sequence;

[0048] (2) The proSmU6 and SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target sequences were connected to the pLB vector respectively, and PCR amplified to obtain the proSmU6 fragment containing the vector sequence and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment;

[0049] (3) Double digest the gene editing empty vector with restriction endonucleases PmeI and KpnI to obtain the Cas9-Kan linearized editing vector;

[0050] (4) homologously recombining the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3), and the proSmRPS5A fragment containing the vector sequence obtained in step (1) to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmRPS5A-Cas9-Kan;

[0051] Or the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmEF1α fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmEF1α-Cas9-Kan;

[0052] Alternatively, the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmUBi fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmUBi-Cas9-Kan.

[0053] In the present invention, the primers for PCR amplification of a vector containing SmRPS5A are shown as SEQ ID No.11 and SEQ ID No.12, the primers for PCR amplification of a vector containing SmEF1α are shown as SEQ ID No.13 and SEQ ID No.14, and the primers for PCR amplification of a vector containing SmUBi are shown as SEQ ID No.15 and SEQ ID No.16; the primers for PCR amplification of a vector containing proSmU6 are shown as SEQ ID No.17 and SEQ ID No.18, and the primers for PCR amplification of a vector containing SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem targets are shown as SEQ ID No.19 and SEQ ID No.20; the nucleotide sequences of the primers are shown in Table 3.

[0054] Table 3 Nucleotide sequences of primers

[0055]

[0056]

[0057] The present invention also provides the use of the gene editing vector in improving the gene editing efficiency of the CRISPR / Cas9 system.

[0058] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0059] The experimental methods for which specific conditions are not specified in the following examples are generally performed under conventional conditions, such as those described in Molecular Cloning Laboratory Manual, edited by MR Green, Science Press, 2017 edition, or according to the conditions recommended by the manufacturer; Sambrook et al. Molecular Cloning Laboratory Manual, New York: Cold Spring Harbor Laboratory Press, 1989 edition.

[0060] Example 1 Extraction of Salvia miltiorrhiza DNA

[0061] The plant genomic DNA extraction kit (CW0553, purchased from Beijing Kangwei Century Biotechnology Co., Ltd.) was used to extract the genomic DNA of Salvia miltiorrhiza. Specifically:

[0062] (1) Take 100 mg of fresh leaves of Salvia miltiorrhiza and grind them thoroughly in liquid nitrogen;

[0063] (2) Collect the powder into a centrifuge tube, add 400 μL Buffer LP1 and 6 μL RNase A (10 mg / ml), vortex for 1 min, and leave at room temperature for 10 min to fully lyse the tissue;

[0064] (3) Add 130 μL of Buffer LP2, vortex for 1 min, and centrifuge at 13,400 × g for 5 min;

[0065] (4) Transfer the supernatant to a new centrifuge tube, add 1.5 times the volume of Buffer LP3 (containing anhydrous ethanol), and mix thoroughly;

[0066] (5) Add all the suspension to the adsorption column (Spin Columns DM) in the collection tube, centrifuge at 13,400 × g for 1 min, discard the filtrate, and put the adsorption column back into the collection tube;

[0067] (6) Add 500 μL of Buffer GW2 (containing anhydrous ethanol) to the adsorption column, centrifuge at 13,400 × g for 1 min, and discard the filtrate;

[0068] (7) Place the adsorption column back into the collection tube, repeat centrifugation at 13,400 × g for 2 min, and discard the filtrate;

[0069] (8) Leave the adsorption column at room temperature for several minutes to dry;

[0070] (9) Place the adsorption column in a new centrifuge tube, add 100 μL of sterile water to the middle of the adsorption membrane, and leave it at room temperature for 2 min.

[0071] (10) Centrifuge at 13,400 × g for 1 min, collect the DNA solution, and detect the concentration to obtain Salvia miltiorrhiza genomic DNA.

[0072] Example 2 Obtaining the promoter sequences of SmRPS5A, SmEF1α and SmUBi of Salvia miltiorrhiza

[0073] The protein sequences of Arabidopsis thaliana AtRPS5A (ID: AT3G11940), tomato SlEF1α (ID: Solyc06g005060), and maize ZmUBi (ID: LOC103647693) were aligned to the corresponding homologous genes SmRPS5A, SmEF1α, and SmUBi of Salvia miltiorrhiza, and the promoter sequences of SmRPS5A, SmEF1α, and SmUBi of Salvia miltiorrhiza were found in the genomic DNA of Salvia miltiorrhiza. Sm is the Latin abbreviation of Salvia miltiorrhiza.

[0074] Example 3 PCR amplification

[0075] PCR amplification primers were designed according to the promoter sequences of SmRPS5A, SmEF1α, and SmUBi of Salvia miltiorrhiza, as shown in Table 2.

[0076] Using genomic DNA of Salvia miltiorrhiza as template, PCR method was used to amplify the promoters of SmRPS5A, SmEF1α and SmUBi of Salvia miltiorrhiza to obtain the corresponding amplification products.

[0077] The conditions of the PCR reaction were as follows: pre-denaturation at 94°C for 10 min; 94°C for 40 s, 55°C for 40 s, 68°C for 1 min / kb, 34 cycles; and extension at 68°C for 10 min.

[0078] The PCR reaction system is shown in Table 4:

[0079] Table 4 PCR reaction system

[0080]

[0081] The PCR amplification products were detected by electrophoresis in 1% agarose gel, and the specific bands were recovered and connected to the pLB vector for sequencing verification, thereby obtaining the pLB vectors containing the SmRPS5A, SmEF1α, and SmUBi promoters, respectively.

[0082] Example 4 Construction of CRISPR / Cas9 multi-target gene editing vector of Salvia miltiorrhiza

[0083] (1) PCR amplification of the pLB vector containing the SmRPS5A, SmEF1α or SmUBi promoter to obtain the proSmRPS5A fragment, proSmEF1α fragment or proSmUBi fragment containing the vector sequence;

[0084] (2) The proSmU6, SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target sequences, and pro35s sequences were connected to the pLB vector, respectively, and PCR amplified to obtain the proSmU6 fragment containing the vector sequence, the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, and the pro35S fragment;

[0085] (3) Use restriction endonucleases PmeI and KpnI to treat the gene editing empty vector (such as Figure 1 Double enzyme digestion was performed to obtain the Cas9-Kan linearized editing vector;

[0086] (4) homologously recombining the proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3), and the proSmRPS5A fragment containing the vector sequence obtained in step (1) to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmRPS5A-Cas9-Kan (such as Figure 2 shown);

[0087] The proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmEF1α fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmEF1α-Cas9-Kan (such as Figure 3 shown);

[0088] The proSmU6 fragment containing the vector sequence obtained in step (2) and the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment, the Cas9-Kan linearized editing vector obtained in step (3) and the proSmUBi fragment containing the vector sequence obtained in step (1) are homologously recombined to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-proSmUBi-Cas9-Kan (such as Figure 4 shown);

[0089] The proSmU6 fragment containing the vector sequence obtained in step (2), the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target fragment and the pro35S fragment are homologously recombined with the Cas9-Kan linearized editing vector obtained in step (3) to prepare a gene editing vector containing proSmU6-SmOPR3-sgRNA1-sgRNA2-sgRNA3-pro35S-Cas9-Kan (such as Figure 5 shown).

[0090] The above gene editing vectors were transformed into Escherichia coli (purchased from Beijing Quanshijin Biotechnology Co., Ltd., Trans1-T1 Phage Resistant Chemically Competent Cell) and sequenced for identification.

[0091] Among them, the nucleotide sequences of the primers for PCR amplification of a vector containing SmRPS5A, the primers for PCR amplification of a vector containing SmEF1α, the primers for PCR amplification of a vector containing SmUBi, the primers for PCR amplification of a vector containing proSmU6, and the primers for PCR amplification of a vector containing SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem targets are shown in Table 3;

[0092] The nucleotide sequences of proSmU6, SmOPR3, sgRNA1, sgRNA2, sgRNA3, pro35s, the PCR amplification primers of SmU6, and the nucleotide sequences of the primers for amplifying the pLB vector containing pro35s are shown in Figure 5.

[0093] The method for obtaining proSmU6 is: to obtain it by PCR amplification of Danshen DNA. The specific method steps are the same as those in Example 3.

[0094] Table 5 Amplification primers of different sequences

[0095]

[0096]

[0097]

[0098]

[0099] The method for obtaining the SmOPR3-sgRNA1-sgRNA2-sgRNA3 tandem target sequence fragment is: directly performing base synthesis at Sangon Biotech (Shanghai) Co., Ltd.

[0100] Example 5 Extraction of endotoxin-free gene editing plasmid

[0101] The gene editing vectors prepared in Example 4 were extracted using an endotoxin-free plasmid extraction kit (purchased from OMEGA), specifically:

[0102] Add 200 mL of LB medium containing screening antibiotics to a 500 mL culture flask, add bacteria containing the target plasmid (Escherichia coli containing the gene editing vector obtained in Example 4), shake culture at 37°C for 12 h, centrifuge at 3,500 x g for 10 min at room temperature to collect bacterial precipitates, add 10 ml of Solution I / RNase A, vortex or use a pipette to blow up and down to resuspend the bacteria, add 10 ml of Solution II, invert 10 times to gently mix, to obtain a clear lysate, add 5 mL of Buffer N3, gently invert and mix several times until a white flocculent precipitate appears. Place at room temperature for 2 min, prepare the binding column: add 5 mL of Buffer GPS to the binding column, place at room temperature for 3 min, centrifuge at 3,000 x g for 5 min, discard the filtrate, transfer all the lysate and precipitate to a syringe filter, prepare a clean 50 ml centrifuge tube to collect the filtrate, add an equal volume of ETR Binding Buffer to the binding column, and invert up and down 7 times. Carefully transfer the lysate to the HiBind binding column, centrifuge at 3,000xg for 3 minutes, filter the liquid through the column, and discard the filtrate (repeat this step until all the lysate is filtered and the filtrate is discarded). Add 10mL ETR Wash Buffer to the binding column, centrifuge at 5,000xg for 3 minutes, filter all the liquid through the column, discard the filtrate, add 10mL Buffer EHB to the binding column, centrifuge at 5,000xg for 3 minutes, filter all the liquid through the column, and discard the filtrate. Add 15mL DNA Wash Buffer to the binding column, centrifuge at 3,000xg for 5 minutes, filter all the liquid through the column, and discard the filtrate (repeat this step). Put the empty column back into the centrifuge tube and centrifuge at the maximum speed for 10 minutes to fully dry the column. Put the binding column into a new 50mL centrifuge tube, add 1mL Endotoxin-Free Elution Buffer (or deionized water) to the membrane of the binding column, let it stand at room temperature for 2 minutes, and centrifuge at the highest speed for 5 minutes to elute the plasmid DNA to obtain 4 types of plasmid DNA.

[0103] Example 6: Plasmid transformation of Salvia miltiorrhiza by Agrobacterium rhizogenes

[0104] Preparation of competent cells: streak the Agrobacterium rhizogenes C58C1 bacterial solution (purchased from CAMBIA) stored at -80°C on an LB plate containing 25 mg / L rifampicin to activate; pick a single colony to 500 μL of 25 mg / L rifampicin liquid LB, incubate at 28°C, 200 rpm until golden yellow; transfer to 25 mL of 25 mg / L rifampicin liquid LB, incubate at 28°C, 200 rpm until golden yellow; dispense the bacterial solution into 1.5 mL tubes, centrifuge at 4°C, 4000×g for 10 min; add 1 / 2 volume of 0.1M CaCl2 of the bacterial solution to resuspend the bacteria, ice bath for 30 min, and centrifuge at 4000×g for 10 min; add 1 / 30 volume of 0.1M CaCl2 of the bacterial solution to resuspend the bacteria to obtain Agrobacterium competent cells.

[0105] Competent transformation: Add 3 μL of the plasmid DNA prepared in Example 5 to the obtained Agrobacterium competent cells, and gently shake the centrifuge tube to mix; let it stand on ice for 30 minutes, take it out, and place it in liquid nitrogen for 6 minutes; 37°C water bath until it melts; add 600 μL YEB liquid culture medium, shake at 28°C and 200 rpm for 6 hours; take 100 μL and apply it to YEB solid culture medium containing three antibodies Kan (purchased from Sigma, CAS No. 25389-94-0), Spe (purchased from Sigma, CAS No. 1695-77-8) and Rif (purchased from Sigma, CAS No. 13292-46-1); two days later, pick the positive clones for PCR identification.

[0106] The formula of the YEB liquid culture medium is: yeast extract 1g / L, Peptone 5g / L, Sucrose 5g / L, MgSO4 2mmol / L, and the pH is adjusted to 5.8.

[0107] The formula of the YEB solid culture medium is: yeast extract 1g / L, Peptone 5g / L, Sucrose 5g / L, MgSO4 2mmol / L, agar added to 1.5%, and pH adjusted to 7.0.

[0108] Example 7 Infection of Salvia miltiorrhiza with Agrobacterium rhizogenes

[0109] Select the best growing Salvia miltiorrhiza seedlings (the variety is Yudanshen from Fangcheng County, Henan Province) grown in tissue culture bottles for 3 weeks, cut the top leaves in the clean bench, place them in a 10 mL liquid MS plate (purchased from PhytoTech Labs, No. M519), first cut off the leaf edges, and then trim them into 1 cm 2 Place the cut leaves into the OD 600The C58C1 bacterial solution (cultured in YEB liquid medium containing Rif) with a value of 0.4 was sealed and placed in a shaking table at 28°C and 160rpm for 15 minutes; the leaves were taken out from the clean bench, placed on absorbent paper, and the bacterial solution was dried; the leaves were clamped to solid MS culture medium (purchased from PhytoTechnology, M519 Murashige & Skoog Basal Medium with Vitamins) plates, with the back of the leaves facing up, and the plates were sealed; the plates were placed in a constant temperature culture room for dark culture for 36 hours (too long a time will make it difficult to inhibit Agrobacterium); the leaves after dark culture were transferred to a 100mL conical flask, rinsed with sterile water 6 times until the liquid was clear; the leaves were then transferred to sterile absorbent paper (four layers below and three layers above) to dry the water; finally, they were transferred to a plate containing 25μg / mL Rif and 400μg / mL Cef (Cef maintains a balance with Agrobacterium so that Agrobacterium cannot reproduce in large quantities, purchased from Sangon Biotech (Shanghai) Co., Ltd., Catalog No.: A601276-0025) was cultured on 1 / 2MS differentiation medium (same as MS medium, MS was used in half). After about 15 days, hairy roots grew from the edge of the leaf wound; hairy roots larger than 1 cm were transferred to 1 / 2MS differentiation medium containing 50 μg / mL Kan and 400 μg / mL Cef for screening and culture; the concentration of Cef was gradually reduced, and when the hairy roots grew to 10 cm, the next step of editing efficiency detection could be carried out.

[0110] Example 8 Detection of editing efficiency in Salvia miltiorrhiza hairy roots

[0111] 60 strains were selected from the four different hairy roots of Salvia miltiorrhiza obtained in Example 7 as samples, and the DNA of the hairy root strains of Salvia miltiorrhiza was extracted using a plant genomic DNA extraction kit (CW0553, purchased from Beijing Kangwei Century Biotechnology Co., Ltd.). The DNA fragments containing the target sites were amplified by the first round of PCR using the site-specific primers (SSP) method. The primers used were: SmOPR3-165bp-F: ACAGCCTAGGACTAGCTGTG (SEQ ID No. 34) and SmOPR3-165bp-R: AAGTTCTCAACAGCTGTGCC (SEQ ID No. 35); and a set of universal barcoding primers was used for the second round of amplification. The primers are shown in Table 6.

[0112] Table 6 Nucleotide sequences of second round amplification primers

[0113]

[0114]

[0115] Note: F1, F2, F3, F4, F5, F6, F7, and F8 are forward primers, and R is a reverse primer. The eight forward primers are used in combination with the reverse primer respectively.

[0116] Then, the second round amplification products from different strains containing the same promoter were mixed in equal amounts, tested, and sent to Sangon Biotech (Shanghai) Co., Ltd. for double-end next-generation sequencing. The mutation sequence was decoded and analyzed through the website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type of each strain at each target site and analyze the editing efficiency. The results are shown in Table 7.

[0117] Table 7 Mutation types and gene editing efficiency of Salvia miltiorrhiza seedlings containing different promoters

[0118]

[0119]

[0120] As shown in Table 7, the editing efficiency of the three targets of the same gene in the strain with SmRPS5A as the cas9 promoter was more than 90%; the editing efficiency of the sgRNA3 target in the strain with SmEF1α as the Cas9 promoter was as high as more than 90%, and the editing efficiency of the other targets was between 50% and 65%; the editing efficiency of the sgRNA3 target in the strain with SmUBi as the cas9 promoter was as high as 87.5%, and the editing efficiency of the other targets was as low as about 20%, which was lower than the control strain with 35S as the cas9 promoter.

[0121] In summary, the editing efficiency of cas9 promoter with SmRPS5A is the highest, and is stable at more than 90% in the three targets. The editing efficiency of cas9 promoter with SmEF1α and SmUBi is also better than that of 35S promoter in some targets, and also has certain application value.

[0122] In addition, from the above, it can be seen that gene editing vectors can be used to efficiently edit the genes of Salvia miltiorrhiza or other Salvia plants through mature plant vector delivery systems such as Agrobacterium-mediated genetic transformation, plant viruses, protoplast transient expression, and gene gun bombardment.

[0123] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Salvia miltiorrhiza SmRPS5A The use of a promoter in improving the efficiency of CRISPR / Cas9 gene editing is characterized in that: Salvia miltiorrhiza SmRPS5A The nucleotide sequence of the promoter is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: Salvia miltiorrhiza SmRPS5A The primer set of the promoter is shown as SEQ ID No.4 and SEQ ID No.

5.

3. A gene editing vector for improving the efficiency of CRISPR / Cas9 gene editing, characterized in that: The salvia miltiorrhiza compound comprising the salvia miltiorrhiza compound as claimed in claim 1 SmRPS5A Promoter.

4. The gene editing vector according to claim 3, characterized in that It also includes an sgRNA sequence for targeting a target gene and a nucleotide sequence encoding a cas9 protein.

5. The gene editing vector according to claim 4, characterized in that The nucleotide sequence encoding the cas9 protein is shown in SEQ ID No.

10.

6. Use of the gene editing vector according to any one of claims 3 to 5 in improving the gene editing efficiency of the CRISPR / Cas9 system.

Images