Clinical prospects of the pan-cancer marker C1QC and its application in tumor detection

Abstract

The present invention relates to the field of biomedical detection technology, and specifically to C1QC as a potential pan-cancer detection marker, as well as a nucleic acid aptamer, an SPR sensor chip, a detection reagent, and a preparation method and use thereof. The present invention uses a nucleic acid aptamer platform to develop innovative detection technology, and realizes sensitive and specific determination of C1QC in clinical samples, which is of great significance for disease monitoring, clinical diagnosis, efficacy evaluation and prognosis judgment.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technologies, and specifically relates to the clinical prospect of the pan-cancer biomarker C1QC and its application in tumor detection, a potential pan-cancer detection biomarker C1QC, as well as a nucleic acid aptamer, an SPR sensor chip, a detection reagent, and preparation methods and uses thereof. Background Art

[0002] Cancer has become a global public health problem, imposing a heavy medical burden on individuals and society. In recent years, treatment technologies such as surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy have improved the overall survival of advanced cancer patients. However, traditional screening methods for early diagnosis and prognostic monitoring all face problems to varying degrees, such as limited sensitivity and specificity of biomarkers and detection methods, low compliance, and insufficient accessibility, which affect the survival of patients. Therefore, deepening the understanding of the tumor pathogenesis, searching for potential early biomarkers, and developing highly sensitive and specific biomedical detection methods will further improve the early diagnosis, prognostic monitoring, and survival rate of cancer patients.

[0003] Recent studies have found that complement system C1q has an immunomodulatory effect related to tumorigenesis, development, and prognosis in the tumor microenvironment (TME) (H. Huang, M. Tan, L. Zheng, G. Yan, K. Li, D. Lu, X. Cui, S. He, D. Lei, B. Zhu, J. Zhao, Prognostic Implications of the Complement Protein C1Q and Its Correlation with Immune Infiltrates in Osteosarcoma, OncoTargets and Therapy. Volume 14 (2021) 1737-1751). Complement C1q is composed of three parts: C1QA, C1QB, and C1QC. Among them, the C chain (C1QC) is a polypeptide involved in C1 production, and C1 is the first component of the serum complement system. Functionally, C1QC can regulate a variety of basic pathological and physiological processes, including cancer occurrence and development, removal of immune complexes, body inflammation, and cell apoptosis (M. Son, B. Diamond, F. Santiago-Schwarz, Fundamental role of C1q in autoimmunity and inflammation, Immunologic Research. 63 (2015) 101-106; B. Ghebrehiwet, E. I. Peerschke, Role of C1q and C1q receptors in the pathogenesis of systemic lupus erythematosus, Current directions in autoimmunity. 7 (2004) 87-97). C1QC is overexpressed in different TMEs, and some of its potential studies have reported a cancer-promoting effect.Zhang's research reported that the level of C1QC was elevated in soft tissue sarcoma and was associated with a poor prognosis (J. Zhang, M. Chen, Y. Zhao, H. Xiong, T. Sneh, Y. Fan, J. Wang, X. Zhou, C. Gong, Complement and coagulation cascades pathway correlates with chemosensitivity and overall survival in patients with soft tissue sarcoma, European Journal of Pharmacology. 879 (2020) 173121-173129); Yang et al. confirmed that the high expression of C1QC in tumor-associated macrophages was associated with poor prognosis in non-small cell lung cancer (Q. Yang, H. Zhang, T. Wei, A. Lin, Y. Sun, P. Luo, J. Zhang, Single-Cell RNA Sequencing Reveals the Heterogeneity of Tumor-Associated Macrophage in Non-Small Cell Lung Cancer and Differences Between Sexes, Frontiers in Immunology. 12 (2021) 722-756); Hui's team found that inhibiting the expression of C1QC in tumor-associated macrophages could inhibit the differentiation of M1 macrophages into M2 and inhibit the growth of digestive system cancer cells (B. Hui, C. Lu, H. Li, X. Hao, H. Liu, D. Zhuo, Q. Wang, Z. Li, L. Liu, X. Wang, Y. Gu, W. Tang, Inhibition of APOE potentiates immune checkpoint therapy for cancer, International Journal of Biological Sciences. 18 (2022) 5230-5240). At the same time, in this study, our team used data from The Cancer Genome Atlas (TCGA) and the Gene Expression Profiling Interactive Analysis (GEPIA) to find the expression levels of the mRNA and tissue samples of the C1QC gene and verify whether C1QC is a potential predictive biomarker for chemosensitivity.Notably, existing database statistics also confirm that highly expressed C1QC has been identified in stromal mRNA and tissue sections of several human malignancies, including non-small cell lung cancer (NSCLC), liver hepatocellular carcinoma (LIHC), lymphoma (DLBC), glioblastoma multiforme (GBM), kidney renal clear cell carcinoma (KIRC), ovarian cancer (OV), pancreatic adenocarcinoma (PAAD), sarcoma (SARC), melanoma (SKCM), gastric cancer (STAD), testicular germ cell tumor (TGCT), and thymic carcinoma (THYM), etc. The statistics of these databases and the above research reports indicate that locally synthesized C1QC is a tumor-promoting factor and a highly sensitive pan-cancer biomarker. C1QC enhances many processes beneficial to tumor progression, including cell adhesion, migration, proliferation, angiogenesis, and metastasis. It is a key regulatory factor in tumorigenesis and development and is closely related to the survival of patients.

[0004] However, there is currently a lack of effective pan-cancer detection markers. In addition, as a novel pan-cancer biomarker with great potential, there is currently no mature biomedical detection method applied clinically for C1QC. Summary of the Invention

[0005] To solve the above technical problems, the inventors found through research that C1QC can be used as a novel pan-cancer biomarker with great potential. Based on this, relevant biomedical detection methods have been developed and applied clinically, which can be used for the detection of tumors such as non-small cell lung cancer (NSCLC), liver hepatocellular carcinoma (LIHC), lymphoma (DLBC), glioblastoma multiforme (GBM), kidney renal clear cell carcinoma (KIRC), ovarian cancer (OV), pancreatic adenocarcinoma (PAAD), sarcoma (SARC), melanoma (SKCM), gastric cancer (STAD), testicular germ cell tumor (TGCT), or thymic carcinoma (THYM).

[0006] Specifically, a nucleic acid aptamer (ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGG, SEQ ID NO:1, QC_Apt) that specifically recognizes the pan-cancer biomarker C1QC is provided, and an innovative detection technology is developed using the nucleic acid aptamer platform. Sensitive and specific determination of C1QC in clinical samples is of great significance for disease monitoring, clinical diagnosis, efficacy evaluation, and prognosis judgment.

[0007] In a first aspect, the present invention provides a pan-cancer detection marker C1QC for the detection of non-small cell lung cancer (NSCLC), liver hepatocellular carcinoma (LIHC), diffuse large B-cell lymphoma (DLBC), glioblastoma multiforme (GBM), kidney renal clear cell carcinoma (KIRC), ovarian cancer (OV), pancreatic adenocarcinoma (PAAD), sarcoma (SARC), melanoma (SKCM), gastric cancer (STAD), testicular germ cell tumor (TGCT) or thymic carcinoma (THYM).

[0008] In a second aspect, the present invention provides a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO:1 or a nucleotide sequence having more than 95% identity with SEQ ID NO:1.

[0009] The nucleotide sequence having more than 95% identity includes nucleotide sequences having 95%, 96%, 97%, 98%, 99% identity.

[0010] In a third aspect, the present invention provides an aptamer-coated SPR sensor chip having a nucleic acid aptamer with a nucleotide sequence as shown in SEQ ID NO:1.

[0011] In a fourth aspect, the present invention provides a method for preparing an aptamer-coated SPR sensor chip, comprising the steps of:

[0012] 1) Preparing a streptavidin chip;

[0013] 2) Preparation of an aptamer-coated sensor chip: Loading a biotinylated aptamer onto the SPR sensor chip and introducing the streptavidin chip of step 1); wherein, the biotinylated aptamer has a nucleotide sequence as shown in SEQ ID NO:1 or a nucleotide sequence having more than 95% identity with SEQ ID NO:1.

[0014] In some embodiments, the preparation method includes:

[0015] 1) Preparing a streptavidin chip: Diluting streptavidin protein with a NaAC-HAC buffer solution at pH 4.5 to 50 μg / mL and injecting it into an activated dextran matrix chip for covalent coupling; then rinsing with a HEPES buffer solution; injecting an ethanolamine blocking agent to block the NHS ester groups on the activated dextran matrix chip that did not participate in the coupling reaction to obtain a streptavidin chip;

[0016] Optionally, the HEPES buffer solution is an aqueous solution containing 20 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and 150 mM NaCl at pH 7.4

[0017] 2) Preparation of aptamer-coated sensor chip: Load the biotinylated aptamer onto the SPR sensor chip and introduce the streptavidin chip in step 1); wherein, the biotinylated aptamer has the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence having more than 95% identity with SEQ ID NO:1.

[0018] In some embodiments, in step 2), load the biotinylated aptamer onto the SPR sensor chip and introduce the streptavidin chip in step 1); set the Capture test program, biotinylated Bio-QC_Apt is captured on detection channel 2, and reference channel 1 is used as a reference pool, and it is monitored in real time through the SPR sensing diagram. When the Bio-QC_Apt captured on detection channel 2 reaches saturation, the remaining unbound sites on the SA-Chip and reference channel 1 that are not bound by Bio-QC_Apt are blocked with a 1 mg / mL biotin blocking solution, and the ligand-coated sensor chip is washed with DPBS running buffer at a flow rate of 10 μL / min for 10 min to obtain the SPR sensor chip (SA-Chip@Apt).

[0019] In a fifth aspect, the present invention provides a detection reagent for biomarker C1QC, and the diagnostic reagent includes the nucleic acid aptamer of the present invention.

[0020] In a sixth aspect, the present invention provides the use of the nucleic acid aptamer of the present invention, the aptamer-coated SPR sensor chip, the aptamer-coated SPR sensor chip prepared by the preparation method, or the detection reagent for biomarker C1QC in detecting biomarker C1QC.

[0021] In a seventh aspect, the present invention provides the use of the nucleic acid aptamer of the present invention, the aptamer-coated SPR sensor chip, the aptamer-coated SPR sensor chip prepared by the preparation method, or the detection reagent for biomarker C1QC in detecting tumors.

[0022] In some embodiments, the tumor includes non-small cell lung cancer (NSCLC), liver cancer (LIHC), lymphoma (DLBC), glioblastoma (GBM), clear cell renal cell carcinoma (KIRC), ovarian cancer (OV), pancreatic cancer (PAAD), sarcoma (SARC), melanoma (SKCM), gastric cancer (STAD), testicular cancer (TGCT), or thymic carcinoma (THYM); preferably, the use in detecting non-small cell lung cancer (NSCLC) and liver cancer (LIHC).

[0023] In an eighth aspect, the present invention provides the use of the nucleic acid aptamer, the aptamer-coated SPR sensor chip, the aptamer-coated SPR sensor chip prepared by the preparation method, or the detection reagent of the biomarker C1QC in the preparation of a detection reagent for detecting the biomarker C1QC or non-small cell lung cancer or liver cancer.

[0024] Based on the discovery of the pan-cancer early screening marker C1QC and the innovative liquid biopsy technology developed by the team: the ultra-sensitive detection method of the aptamer-coated SPR sensor has greatly improved the possibility of early cancer detection. Compared with traditional cancer screening methods such as tumor markers and imaging, the innovative liquid biopsy technology represented by the C1QC pan-cancer marker has greatly improved the overall detection performance. It also has the advantages of accessibility such as non-invasiveness and simple sampling. It can greatly improve the compliance of the population with pan-cancer screening. Through the initial screening of the C1QC index, multiple cancers can be screened at one time, providing a new means for early cancer screening, and striving for a larger clinical intervention window for early patients and improving the survival rate.

[0025] In biological analysis, SPR can not only detect targets reliably and sensitively, but also explore dynamic research. This study used a direct method to construct a C1QC aptamer-coated SPR biosensor, which has the advantages of simple operation, rapidity, efficient response, high sensitivity and strong specificity.

[0026] The aptamer was loaded onto the sensor chip and used as an affinity ligand. As the sample was injected, the SPR signal increased due to the association of the target with the aptamer-coated chip. We achieved sensitive detection of C1QC by measuring the SPR response induced by affinity binding, with a minimum detection limit of 1.51 nM and a detection time of only 8 min.

[0027] Further dissociation and regeneration make the aptamer-coated SPR biosensor chip available for the next sample analysis. The aptamer sensor chip is stable and reusable with low material consumption.

[0028] It has the potential to analyze complex matrices in human serum. The assay has the advantages of being simple, rapid, and real-time, as well as easy to implement high-throughput and automated detection, and has broad application prospects in the analysis of clinical tumor serum samples.

[0029] Terminology

[0030] Certain embodiments of the present invention will now be described in detail. The present invention is intended to cover all alternatives, modifications, and equivalent technical solutions, which are all included within the scope of the present invention as defined by the claims. Those skilled in the art should recognize that many methods and materials similar or equivalent to those described herein can be used to practice the present invention. The present invention is in no way limited to the methods and materials described herein. In the case where one or more of the incorporated documents, patents, and similar materials are different from or contradictory to the present application (including but not limited to the defined terms, term applications, described technologies, etc.), the present application shall prevail.

[0031] It should be further recognized that certain features of the present invention, for the sake of clarity, are described in multiple independent embodiments, but can also be provided in combination in a single embodiment. Conversely, various features of the present invention, for the sake of brevity, are described in a single embodiment, but can also be provided separately or in any suitable sub-combination.

[0032] Unless otherwise stated, all scientific and technical terms used in the present invention have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. All patents and published publications related to the present invention are incorporated herein by reference in their entirety.

[0033] In the description of this specification, the description referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples", etc. means that the specific features, structures, materials, or characteristics described in connection with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0034] In the following content, all the numbers disclosed herein are approximate values, whether or not words such as "about" or "approximately" are used. There may be differences of 1%, 2%, 5%, 7%, 8%, 10%, 15%, or 20% in the numerical value of each number. Whenever a number with a value of N is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15%, or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a graph showing the optimization results of the pH of the SA coupling buffer.

[0036] Figure 2 Sensing diagram of SA covalently coupled on the CM5 chip.

[0037] Figure 3 Sensing diagram of the maximum immobilization amount of Bio-QC_Apt captured on the SA-Chip surface.

[0038] Figure 4 Test result diagram of specific capture of C1QC by SA-Chip@Apt in NSCLC 04.

[0039] Figure 5 Evaluation diagram of using SA-Chip@Apt to evaluate non-small cell lung cancer clinical serum samples.

[0040] Figure 6 Evaluation diagram of using SA-Chip@Apt to evaluate liver cancer clinical serum samples.

[0041] Figure 7 SPR response diagram of the Bio-QC_Apt coated chip to C1QC at different concentrations.

[0042] Figure 8 Linear relationship diagram between C1QC concentration and relative response unit detected by the SA-Chip@Apt sensor. Detailed implementation manners

[0043] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the descriptions of well-known structures and technologies are omitted to avoid unnecessarily confusing the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0044] All the reagents used in the present invention can be purchased from the market or can be prepared by the methods described in the present invention.

[0045] I. Screening of nucleic acid aptamers

[0046] The screening method of nucleic acid aptamers is to screen nucleic acid aptamers that specifically recognize C1QC based on the Magnetic beads-SELEX technology. The screening steps are as follows:

[0047] (1) Construction of the initial ssDNA library: Design a library consisting of 10 14 ~10 15A random sequence forms an initial ssDNA library of 80 nt. The sequences at both ends of the initial library are fixed as primer binding sites, each with 20 bases, and the middle random region contains 40 random sequences;

[0048] (2)Coupling of protein and magnetic microspheres: The selected magnetic microspheres (MBs) have a particle size of 2.8 μm and are coated with a layer of carboxyl groups (-COOH). Proteins rich in amino groups (-NH 2 )are fixed on the surface of carboxyl MBs through dehydration condensation to obtain protein magnetic beads (MBs @Protein);

[0049] (3)Denaturation and renaturation of the ssDNA library: The library is diluted with DPBS buffer, heated at 95 °C in a metal bath for 10 min, and then equilibrated at room temperature for 30 min;

[0050] (4)Incubation: The denatured and renatured ssDNA library is incubated with the functionalized protein magnetic beads in step (2). The ssDNA library specific to the protein target folds into secondary or tertiary structures by itself, and then binds to the protein immobilized on the magnetic beads under optimal conditions to form an aptamer-target complex;

[0051] (5)Separation: The ssDNA bound to the target and the unbound ssDNA are separated by magnetic separation using a magnetic rack;

[0052] (6)Elution: The protein immobilized on the magnetic beads binds to form an aptamer-target complex, which is resuspended in 100 μL of DPBS and heated at 95 °C in a metal bath for 10 minutes. This process is repeated once, and the eluted samples are collected;

[0053] (7)Monitoring: The enrichment degree of specific aptamers and the richness of the library are analyzed by the amplification curve and melting curve of real-time fluorescence quantitative PCR (q-PCR);

[0054] (8)Amplification: The sequences bound to C1QC are amplified by PCR with unequal-length primers;

[0055] (9)Preparation of the secondary ssDNA library: The dsDNA amplified by PCR with unequal-length primers is separated into ssDNA by 8 M urea polyacrylamide gel electrophoresis (Urea-PAGE) and used as the library for the next round of screening;

[0056] (10)Cyclic screening: The secondary ssDNA library prepared in step (8) is bound to the target, and steps (2)-(9) are repeated to obtain the secondary library for the 2nd round of SELEX screening; The cycle is repeated N times (1≤N≤20) to obtain the secondary library for N rounds of SELEX screening; Specific aptamers can be obtained after several rounds of cyclic screening;

[0057] (11)Primary verification of library affinity: Flow cytometry was used to preliminarily explore the binding affinity of the candidate nucleic acid aptamer library for C1QC;

[0058] (12)Library sequencing: The enriched nucleic acid aptamer library was identified by next-generation high-throughput sequencing method;

[0059] (13)Analysis and characterization of candidate aptamer sequences: The ssDNA nucleic acid aptamer QC_Apt with affinity and specific recognition of C1QC was screened by sequence structure simulation analysis (UNPACK) and surface plasmon resonance (SPR). QC_Apt sequence: SEDID NO. 1:

[0060] ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGTGGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGG.

[0061] II. Construction of aptamer-coated SPR sensor (SA-Chip@Apt)

[0062] 2.1 Optimization of coupling buffer

[0063] Streptavidin (SA) protein was added to sodium acetate buffers with different pH values (10 mM sodium acetate (NaAC-HAC)) to make the final concentration of SA 50 μg / mL, and the pH values were set to 5.5, 5.0, 4.5, and 4.0 respectively to optimize the pH environment of the best SA coupling buffer. According to the operation guide of the manufacturer's SOP manual, the pH scouting program was set to pre-enrich on the detection channel of the dextran matrix chip (CM5 chip, Cytiva), and finally regenerated with 50 mM NaOH until the baseline was stable. The results are as Figure 1 shown.

[0064] 2.2 Activation

[0065] Take the prepared N-hydroxysuccinimide NHS (10 mg / mL) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride EDC (10 mg / mL), thaw slowly at 4 °C, mix 100 μL of each of NHS and EDC with equal volume, apply it to the CM5 chip, and act for 7 min to activate the surface of the CM5 chip to obtain the activated CM5 chip.

[0066] 2.3 Coupling

[0067] Set the Immobilization program according to the operation guide in the manufacturer's SOP manual. Dilute the SA protein to 50 μg / mL with NaAC-HAC buffer at pH 4.5 and inject it into the activation channel. Through the aminocarboxylic reaction, the amino group (-NH 2 ) on SA undergoes dehydration condensation with -COOH on the dextran matrix and is covalently coupled to the surface of the activated CM5 chip. Then, rinse with HEPES buffer (the HEPES buffer is an aqueous solution containing 20 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and 150 mM NaCl at pH 7.4) until the baseline is stable, and the response signal (Ru) value caused by SA coupling can be observed. The results are as Figure 2 shown.

[0068] 2.4 Blocking

[0069] Inject 200 μL of an aqueous ethanolamine solution blocking agent with a final concentration of 1000 mmol / L into the activation channel to block the NHS ester groups on the activation channel that did not participate in the coupling reaction, obtaining the prepared streptavidin chip SA-Chip material for the subsequent construction of an aptamer-coated sensing chip.

[0070] 2.5 Preparation of Aptamer-Coated Sensor Chip (SA-Chip@Apt)

[0071] The biotinylated aptamer (Bio-QC_Apt, the aptamer sequence is SED ID NO. 1: ATTGGCACTCCACGCATAGGTCGGGTGGGATGGGATCGGT GGTGGTGTGTGGGTATATTTCACGGTAGCACGCATAGG) synthesized by Yinke Zhongkang (Xiamen) Technology Co., Ltd. was loaded onto the SPR sensor chip and used as an affinity ligand. By introducing the above streptavidin chip (SA-Chip), a capture aptamer SPR biosensing chip in a direct assay form coated with Bio-QC_Apt was developed to evaluate the difference in C1QC content between tumor and normal sera. Set the Capture test program according to the operation guide in the manufacturer's SOP manual. The biotinylated Bio-QC_Apt was captured on detection channel 2, and reference channel 1 was used as a reference cell. It was monitored in real time through the SPR sensing map. After the Bio-QC_Apt captured on detection channel 2 reached saturation, the unoccupied binding sites on SA-Chip that were not bound by Bio-QC_Apt and reference channel 1 were blocked with a 1 mg / mL Biotin blocking solution. The immobilization effect is as Figure 3As shown. After completion, the ligand-coated sensor chip was washed with Dulbecco's phosphate buffered saline (DPBS) running buffer at a flow rate of 10 μL / min for 10 min, and the SPR sensor chip SA-Chip@Apt was thus prepared.

[0072] 2.6 Feasibility test of aptamer-coated SPR sensor

[0073] The feasibility of detecting the pan-cancer biomarker C1QC in non-small cell lung cancer serum samples using a ligand-coated SPR sensor was investigated. In this study, the non-small cell lung cancer serum samples (NSCLC 04) collected previously were diluted 100-fold, and the capture of C1QC in NSCLC 04 by QC_Apt was detected using the Method from run binding test simple program of BIAcore 8k. The data were analyzed using the BIAcore insight evaluation program 5.0, and the results are as Figure 4 shown.

[0074] 2.7 Result analysis

[0075] The pH conditions for SA coupling on the CM5 chip were optimized. The relationship between SA and SPR signals in different pH environments was controlled by the Biacore 8k control software with the same final injection concentration. Subsequently, physical adsorption of SA on the CM5 chip was removed during the sodium hydroxide washing process. The results are as Figure 1 shown. Since pH 4.5 caused sharper and higher SPR signals during the pre-enrichment process and would lead to better pre-enrichment of SA on the CM5 surface and more efficient subsequent chemical coupling, pH 4.5 was selected as the optimal buffer environment for the chemical coupling of SA.

[0076] The covalent chemical coupling of SA on the surface of the CM5 chip was performed using the Application Wizard Model Immobilization program. The results are as Figure 2 shown. The carboxyl groups of CM5 were activated using EDC / NHS activation reagents, SA was immobilized by pulse injection, and the sites on the blank area that did not participate in the SA coupling were blocked using ethanolamine. Finally, the coupling was completed at a signal target very close to 2800 RU, which is the maximum saturation amount of SA on the surface of the CM5 chip.

[0077] To immobilize the biotinylated aptamer, Bio-QC_Apt was injected into detection channel 2 of the SA-Chip at a rate of 10 μL / min for 420 s. As Figure 3As shown, the signal reached its maximum value after 270 s and remained stable. Even when Bio-QC_Apt was injected a second time, also for 420 s, no obvious binding signal was collected, indicating that the immobilization amount of Bio-QC_Apt on the SA-Chip had reached saturation. The high stability of the binding signal is due to the high affinity between SA and Biotin in the range of 10−15M. The high stability of the binding between SA and Biotin on the chip during the Dissociation stage does not dissociate with washing by strong acids, strong bases, and high-concentration salt ions, ensuring the reusable of the aptamer-coated SPR sensor chip after each real sample analysis.

[0078] As Figure 4 It shows that Bio-QC_Apt specifically captures C1QC in clinical samples of non-small cell lung cancer (NSCLC 04, 1:100 dilution), and the response signal value is 2879 RU. The aptamer-coated SRP sensor chip SA-Chip@Apt provides sufficient detection sensitivity for the capture of C1QC. Subsequently, further dissociation and regeneration using Glycine-HCl bring SA-Chip@Apt back to the baseline level (Regeneration level), which can be used for the next sample analysis, providing feasibility for testing more clinical samples based on SA-Chip@Apt in the future.

[0079] III. Application of the aptamer SPR sensor for the pan-cancer biomarker C1QC in the clinics of non-small cell lung cancer and liver cancer

[0080] 3.1 Evaluation based on the aptamer SPR sensor

[0081] Use the aptamer SPR sensor to evaluate whether there is a potential correlation between the high or low expression of C1QC in serum in non-small cell lung cancer (NSCLC) and liver hepatocellular carcinoma (LIHC). Use 1× DPBS, pH 7.4, 5 mM MgCl 2and 0.1% Tween-20 were used as running buffers for the detection of non-small cell lung cancer, liver cancer, and normal serum samples. All solutions were filtered through a 0.22 μm filter membrane before use. Clinical (tumor and normal) serum samples, 12 non-small cell lung cancer (NSCLC 01 - 12) and 5 normal human serum samples (Normal 16 / 24 / 25 / 28 / 29) collected previously were diluted 500-fold respectively. To further demonstrate the application prospect of the pan-cancer biomarker C1QC in LIHC, some sample enrichment methods were needed to meet the requirements for the detection of C1QC in serum samples. Therefore, 7 liver cancer (LIHC 01 - 07) and 5 normal human serum samples (Normal 16 / 24 / 25 / 28 / 29) were diluted 350-fold according to the requirements of the hospital's liver cancer serum dilution method. Subsequently, the Multi-cycle kinetics program was set according to the operation guide of the manufacturer's SOP manual to monitor the specific capture of C1QC in serum samples by Bio-QC_Apt on the sensor chip in real-time. After the injection was completed, the running buffer DPBS continued to flow as a target dissociation test. Then, the RU signal was returned to the baseline level by injecting the Glycine-HCl regeneration solution. The report point was read 4 s after the end of each injection cycle. The data was processed by the BIAcore insight evaluation program 5.0 evaluation software to draw a scatter plot, and the results were as Figure 5 and Figure 6 shown. Based on the specific fishing of C1QC in clinical serum samples by the aptamer-coated SPR sensor (SA-Chip@Apt), the specific binding information and specific binding response values were analyzed by the BIAcore insight evaluation program 5.0, and the results are shown in Table 1 and Table 2.

[0082] Table 1. Detection of C1QC in non-small cell lung cancer serum samples based on SA-Chip@Apt

[0083]

[0084] Table 2. Detection of C1QC in liver cancer serum samples by SA-Chip@Apt

[0085]

[0086] The clinical serum samples of non-small cell lung cancer were evaluated using SA-Chip@Apt, and the results were as Figure 5As shown, there were significant differences in the C1QC response values between 5 normal human serum samples and 12 non-small cell lung cancer clinical samples monitored by BIAcore 8k. The specific binding response values and specific binding information are shown in Table 1. The RU values of the 5 normal human serum samples were all lower than those of the non-small cell lung cancer clinical samples. At the same time, SA-Chip@Apt was used to evaluate the clinical serum samples of liver cancer. The results are as Figure 6 shown. Among the 5 normal human serum samples and 7 liver cancer clinical samples, there were also significant differences in the C1QC response values monitored by BIAcore 8k. The specific binding response values and specific binding information are shown in Table 2. The RU values of the 5 normal human serum samples were also all lower than those of the liver cancer clinical samples. The results indicate that the pan-cancer biomarker C1QC has the potential for biomarker analysis in the applications of non-small cell lung cancer and liver cancer. This assay shows the application prospects of the aptamer SPR sensor for the pan-cancer biomarker C1QC in the clinics of non-small cell lung cancer and liver cancer.

[0087] 3.2 Detection sensitivity test of aptamer SPR sensor

[0088] To test the detection sensitivity of the aptamer-coated SPR sensor, the Multi-cycle affinity program was set according to the operation guide of the manufacturer's SOP manual. C1QC with various concentration gradients of 0, 15.7, 31.2, 62.5, 125, 250, 500, 1000 nM were diluted respectively. The SPR response value RU of the aptamer-coated sensor chip was evaluated and a binding saturation curve was plotted with the C1QC concentration gradient. The results are as Figure 7 shown, presenting a good non-linear fitting R 2 = 0.9958. As Figure 8 shown, the relative response unit and the C1QC concentration showed a good linear relationship in the range of 0 nM to 125 nM, y = 1.990x + 15.68, R 2 = 0.9903, where y is the SPR relative response unit and x is the gradient-diluted C1QC. The limit of detection LOD of this aptamer SPR sensor for C1QC is 1.51 nM. Therefore, the aptamer SPR sensor developed by us has both specificity and good response sensitivity in the direct detection of C1QC in real serum samples.

[0089] C1QC is considered a reliable pan-cancer biomarker, and achieving sensitive determination is of great significance for disease monitoring, clinical diagnosis, efficacy evaluation, and prognosis judgment. However, traditional detection methods have the disadvantages of poor stability, insufficient specificity, cumbersome operation, and long time consumption. The present invention discloses an aptamer-based surface plasmon resonance (SPR) assay directly used for the detection of C1QC in clinical serum samples. The aptamer is loaded onto the sensor chip and used as an affinity ligand to construct an aptamer-coated SPR sensing chip (SA-Chip@Apt). As the sample is injected, the SPR signal increases due to the association of the target with the aptamer-coated chip, and further dissociation and regeneration enable the aptamer sensor chip to be used for the next sample analysis. Sensitive detection of C1QC is achieved by measuring the SPR response induced by affinity binding, and the detection time is shortened to 8 min. The limit of detection (LOD) of this method for C1QC is 1.51 nM. In evaluating the application prospects of the pan-cancer biomarker C1QC in the clinic of non-small cell lung cancer (NSCLC) and liver hepatocellular carcinoma (LIHC), significant differences in the C1QC response values were presented in the monitoring of clinical samples including normal human serum samples, NSCLC clinical serum samples, and LIHC clinical serum samples on the BIAcore 8k, indicating that the pan-cancer biomarker C1QC has the potential for biomarker analysis in the applications of NSCLC and LIHC. At the same time, this assay shows the application prospects of the aptamer SPR sensor for C1QC in the clinic of NSCLC and LIHC. Based on the stable and reusable aptamer-coated SPR sensor chip developed by us, it has the potential to analyze the complex matrix of human serum, and at the same time has the advantages of simplicity, rapidity, low material consumption, and easy implementation of high-throughput detection, and has broad application prospects in evaluating the analysis of C1QC in other clinical tumor serum samples.

[0090] The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously make changes or appropriate modifications and combinations to the methods and applications described herein within the content, spirit, and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention.

Claims

1. A nucleic acid aptamer, characterized in that: A nucleotide sequence having a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having 95% or more identity with SEQ ID NO:

1.

2. An aptamer-coated SPR sensor chip, characterized in that: A nucleic acid aptamer according to claim 1.

3. A method for preparing an aptamer-coated SPR sensor chip, characterized in that: Includes steps: 1) Prepare streptavidin chip; 2) Preparation of aptamer-coated sensor chip: loading the biotin-modified aptamer onto the SPR sensor chip and introducing the streptavidin chip of step 1); wherein the biotin-modified aptamer has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having more than 95% identity with SEQ ID NO:

1.

4. The preparation method according to claim 3, characterized in that: include: 1) Preparation of streptavidin chip: dilute the streptavidin protein to 50 μg / mL with NaAC-HAC buffer at pH 4.5 and inject it into the activated dextran matrix chip for covalent coupling; then rinse with HEPES buffer; inject ethanolamine blocking agent to block the NHS ester groups on the activated dextran matrix chip that are not involved in the coupling reaction, and obtain a streptavidin chip; 2) Preparation of aptamer-coated sensor chip: loading the biotin-modified aptamer onto the SPR sensor chip and introducing the streptavidin chip of step 1); wherein the biotin-modified aptamer has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having more than 95% identity with SEQ ID NO:

1.

5. The preparation method according to claim 4, characterized in that: The HEPES buffer is an aqueous solution containing 20 mM HEPES and 150 mM NaCl at pH=7.

4.

6. A detection reagent for biomarker C1QC, characterized in that: The detection reagent comprises the nucleic acid aptamer according to claim 1.

7. Use of the nucleic acid aptamer according to claim 1, the aptamer-coated SPR sensor chip according to claim 2, or the aptamer-coated SPR sensor chip prepared by the preparation method according to any one of claims 3 to 4 in preparing a detection reagent for detecting biomarkers C1QC or non-small cell lung cancer or liver cancer.

Images