A method for preparing tea lozenges from mixed bacteria-fermented summer and autumn tea and a compound fermenting agent used therefor

Abstract

A method for preparing tea lozenges by mixed - strain fermentation of summer and autumn tea and a compound fermenting agent used therein, including Aspergillus cristatus FT128 and Monascus purpureus HQ128. Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus purpureus HQ128 has been deposited at the China Center for Type Culture Collection, and the deposit date is January 29, 2024, and the strain deposit number is CCTCC NO: M2024269. In the present invention, Aspergillus cristatus FT128 and Monascus purpureus HQ128 are respectively beneficial dominant fungal microorganisms in Fuzhuan tea and dominant fungal microorganisms in red yeast rice. By inoculating them into the extract of summer and autumn tea for mixed - strain liquid fermentation and concentration to prepare the fermented summer and autumn tea extract, and then preparing summer and autumn tea lozenges, the contents of soluble sugar, theobromine, total volatile compounds, monacolin k, and γ - aminobutyric acid are all significantly higher than those of ordinary green tea lozenges; the results show that the mixed - strain fermented summer and autumn tea lozenges have a richer flavor, a more mellow taste, and a higher overall quality.

Description

Technical Field

[0001] The present invention relates to a method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea and a compound fermenting agent used therefor, belonging to the technical field of microbial fermentation. Background Art

[0002] Summer and autumn tea accounts for about 60% of the annual tea picking volume. Due to the long growth time span of summer and autumn tea, compared with spring tea, the temperature is higher and the sunshine is sufficient in summer and autumn, and the growth of tea trees is slow, resulting in an increase in the content of tea polyphenols in the tea leaves, causing the tea to have a bitter taste and a weak flavor, and then leading to a large amount of summer and autumn tea being discarded, seriously hindering the tea sales. Currently, a large number of studies have shown that the relatively high content of tea polyphenols, alkaloids, bitter amino acids, flavonoid compounds, etc. in tea are the main reasons for the strong bitter taste of summer and autumn tea. However, at the same time, tea polyphenols, flavonoid compounds, etc. are also important natural active substances in tea, which are closely related to the healthy nutritional properties of tea. Therefore, the abandonment of summer and autumn tea also causes serious waste of the beneficial resources in summer and autumn tea.

[0003] Aspergillus cristatus belongs to the genus Eurotium, is the anamorph of Eurotium cristatum, and is also a natural beneficial bacterium growing on rotten wood and tea leaves, also known as "golden flower bacterium". Existing research has found that Aspergillus cristatus is closely related to the quality of Fuzhuan tea, and the metabolism of the bacteria gives Fuzhuan tea a unique floral fragrance and mellow taste. However, there are few studies on applying Aspergillus cristatus to summer and autumn tea at present. However, previous studies have proved that Aspergillus cristatus can effectively reduce the bitter taste of summer and autumn tea and maintain the tea polyphenols in a suitable range, which mainly depends on the multiple enzyme activities such as polyphenol oxidase (PPO), peroxidase (POD), cellulase (CL), etc. produced during the metabolism of Aspergillus cristatus. Therefore, artificially inoculating Aspergillus cristatus into summer and autumn tea can effectively reduce the bitter taste of summer and autumn tea and improve the quality of summer and autumn tea at the same time. By controlling the optimal inoculation amount of this beneficial fungus and the fermentation process, the quality of summer and autumn tea can be improved to the greatest extent and its resource value can be developed.

[0004] Monascus sp belongs to the genus Eurotium, Ascomycota, Aspergillaceae, and exists in trees, soil, accumulations, etc. It grows well on malt extract agar medium. The colony is initially white and turns light pink, purple or grayish black when mature. Monascus sp can synthesize various metabolites, such as alcohols, esters and other aromatic substances and various hydrolases such as proteolytic enzymes. Its secondary metabolites include Monascus pigments, Monacolin K, γ-aminobutyric acid, vitamins, and other active ingredients. These substances have activities of antioxidation, anti-high cholesterol, anti-diabetes and anti-atherosclerosis, and are of great significance to health.

[0005] The tea lozenge is a tea-containing product with certain health functions prepared from concentrated extracts of various natural plants such as tea leaves, mung beans, Siraitia grosvenorii, and mint, using xylitol as the crystallization carrier. By adding a tea extract prepared by mixed fermentation of Aspergillus cristatus and Monascus purpureus, it is expected to significantly improve the taste of the tea lozenge and endow the tea lozenge with special tea fragrance and nutritional characteristics. By combining summer and autumn tea with the tea lozenge, a new generation of deep-processed tea products is created, thereby enhancing the resource utilization of summer and autumn tea, reducing waste, driving the economic growth of tea farmers, and thus solving the problem of waste of summer and autumn tea resources in Anhui and Zhejiang regions. Therefore, the tea lozenge prepared from fermented and improved summer and autumn tea shows its application advantages and good development prospects. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for preparing tea lozenges from mixed-strain fermented summer and autumn tea and a compound fermenting agent used therefor.

[0007] To achieve the above and other related purposes, the technical solution provided by the present invention is: a compound fermenting agent, including Aspergillus cristatus FT128 and Monascus purpureus HQ128. The Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; the Monascus purpureus HQ128 has been deposited at the China Center for Type Culture Collection, and the deposit date is January 29, 2024, and the strain deposit number is CCTCC NO: M2024269.

[0008] The preferred technical solution is: the compound fermenting agent is a spore suspension, and the ratio of the effective viable count between Aspergillus cristatus FT128 and Monascus purpureus HQ128 is 1.5 - 2.5:1.

[0009] To achieve the above and other related purposes, the technical solution provided by the present invention is: a method for preparing tea lozenges from mixed-strain fermented summer and autumn tea, including the following steps:

[0010] Step 1: Raw material selection and preparation:

[0011] Wash, dry, and crush the summer and autumn tea, and use a boiling water bath combined with ultrasonic extraction. After filtration, a summer and autumn tea extract is obtained;

[0012] Step 2: Preparation of the spore suspension:

[0013] Sterilized normal saline is added to the slant media of Aspergillus cristatus FT128 and Monascus purpureus HQ128 respectively. The spores of Aspergillus cristatus FT128 and Monascus purpureus HQ128 are scraped into sterile normal saline with an inoculation loop. After filtration with sterile gauze, a spore suspension containing Aspergillus cristatus FT128 and Monascus purpureus HQ128 is obtained, and this spore suspension is the compound fermenting agent;

[0014] The Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; the Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269;

[0015] Step 3: Mixed bacteria fermentation of summer and autumn tea extract:

[0016] Inoculate the compound fermenting agent into the summer and autumn tea extract obtained in Step 1, and conduct liquid fermentation to obtain summer and autumn tea fermentation broth;

[0017] Step 4: Preparation of summer and autumn tea extract:

[0018] Filter the summer and autumn tea fermentation broth, sterilize it, and then concentrate it to obtain summer and autumn tea extract;

[0019] Step 5: Preparation of summer and autumn tea lozenges:

[0020] Add the summer and autumn tea extract to the melted xylitol, and add mint, citric acid and auxiliary materials, and then carry out casting, crystallization, and demolding to obtain tea lozenges.

[0021] The preferred technical solution is: in Step 1, the process parameters of boiling water bath combined with ultrasonic extraction are: extraction time 25 - 45 min, ultrasonic time 10 - 30 min, ultrasonic power 180 - 300 w, solid-liquid ratio 1:10 - 1:30 g / mL.

[0022] The preferred technical solution is: in Step 3, put the summer and autumn tea extract obtained in Step 1 into a container, sterilize it at 121 °C for 20 - 50 min, and then inoculate a compound fermenting agent with 3 - 12% spores of its mass; place it in a constant temperature shaker at 25 - 32 °C for fermentation for 6 - 15 d, rotation speed 120 - 150 rpm; there is no light during the fermentation process, the fermentation place is clean and odorless, and the relative humidity is kept at 60 - 70%.

[0023] The preferred technical solution is: in Step 4, the concentration is carried out by vacuum concentration, and the process parameters of vacuum concentration are: vacuum degree < 0.07 MPa, temperature 50 - 70 °C, rotation speed 40 - 60 rpm.

[0024] The preferred technical solution is: in Step 5, the preparation of summer and autumn tea lozenges includes: first heat the xylitol to 120 - 140 °C; then cool it to 89 - 99 °C by running water, and add 9 - 20% of its mass of the extract, 0.3 - 0.5% citric acid, 0.1 - 0.5% calcium lactate, 0.02 - 0.05% of 2-(4-methoxyphenoxy)-sodium propionate during this temperature period; pour when the temperature drops to 82 - 85 °C.

[0025] Due to the application of the above technical solution, the advantages of the present invention compared with the prior art are as follows:

[0026] After the summer and autumn tea extract of the present invention is fermented by Aspergillus cristatus FT128 and Monascus sp HQ128, the content of tea polyphenols decreases significantly by 51.18%, the content of flavonoid compounds decreases significantly by 28.09%, and the content of total free amino acids increases significantly by 35.29%; the content of soluble sugar and caffeine in the tea tablets prepared by fermentation increases significantly, the content of monacolin k increases significantly by 24.54%, and the content of γ-aminobutyric acid increases significantly by 41.25%; the analysis of volatile compounds in the tea tablets shows that the contents of alcohols, esters and terpenoids increase by 39.92%, 199.29% and 213.01% respectively. Among them, the contents of geraniol and linalool related to the green smell of tea leaves decrease, and the contents of linalool oxide I, 1-octen-3-ol, α-terpineol and methyl salicylate, which have mint and woody aromas, increase significantly. At the same time, four new and unreported flavor substances, 4-terpineol, methyl cinnamate, sweet orange aldehyde and myrcene, are produced by mixed bacteria fermentation, giving the tea special mint, citrus and balsam flavors. The production process of summer and autumn tea tablets: Xylitol is heated to 120-140 °C to dissolve; it is cooled to 89-99 °C by running water. During this temperature period, 9-20% of the fermented summer and autumn tea extract (made by filtering and concentrating the summer and autumn tea fermentation broth), 0.3-0.5% citric acid, 0.1-0.5% calcium lactate, and 0.02-0.05% of 2-(4-methoxyphenoxy)-sodium propionate are added; casting is carried out when the temperature drops to 82-85 °C. The summer and autumn tea tablets prepared under these conditions have good stability, rich tea fragrance, suitable sweetness compared with ordinary green tea tablets, and have good antioxidant properties. Brief Description of the Drawings

[0027] Figure 1 Photographs of the colony morphology of Aspergillus cristatus FT128 and Monascus sp HQ128 on the plate.

[0028] Figure 2 Optical microscopy and scanning electron microscopy photographs of Aspergillus cristatus FT128.

[0029] Figure 3 Optical microscopy and scanning electron microscopy photographs of Monascus sp HQ128.

[0030] Figure 4 Phylogenetic trees of Aspergillus cristatus FT128 and Monascus sp HQ128.

[0031] Figure 5 It is about the relationship between the water extract of summer and autumn tea and the extraction method.

[0032] Figure 6 It is about the changes in the physical and chemical properties of the fermentation broth of summer and autumn tea during the fermentation process.

[0033] Figure 7 It is a heat map of volatile compounds in the summer and autumn tea extract before and after fermentation.

[0034] Figure 8 It is a schematic diagram of the liquid mixed - bacteria fermentation of summer and autumn tea for 1, 5, and 9 days.

[0035] Figure 9 It is a basic physical and chemical comparison chart of the mixed - bacteria and single - bacteria fermented summer and autumn tea lozenges and ordinary green tea lozenges.

[0036] Figure 10 It is a chart of the content of monacolin k and γ - aminobutyric acid in the mixed - bacteria and single - bacteria fermented summer and autumn tea lozenges.

[0037] Figure 11 Heat map of the volatile flavors of ordinary green tea lozenges and fermented summer and autumn tea lozenges.

[0038] Figure 12 It is a chart of the total antioxidant capacity of the mixed - bacteria and single - bacteria fermented summer and autumn tea.

[0039] Figure 13 It is a sensory flavor radar chart of the mixed - bacteria and single - bacteria fermented summer and autumn tea lozenges and ordinary green tea lozenges.

[0040] Figure 14 It is a schematic diagram of the mixed - bacteria fermented summer and autumn tea lozenge. Specific implementation manners

[0041] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.

[0042] Please refer to Figure 1-14It should be noted that the structures, ratios, sizes, etc. shown in the drawings of this specification are only used to match the content disclosed in the specification for those familiar with this technology to understand and read, and are not used to limit the conditions for the implementation of the present invention. Therefore, they do not have substantial technical significance. Any modification of the structure, change in the proportional relationship, or adjustment of the size, without affecting the effects that the present invention can produce and the purposes that can be achieved, should still fall within the scope that can be covered by the technical content disclosed in the present invention. At the same time, the terms such as "upper", "lower", "left", "right", "middle", and "one" cited in this specification are only for the convenience of clear narration and are not used to limit the scope of implementation of the present invention. The change or adjustment of their relative relationships, without substantial change in the technical content, should also be regarded as the scope in which the present invention can be implemented.

[0043] Deposit of biological materials:

[0044] Aspergillus cristatus FT128 has been deposited with the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus sp. HQ128 has been deposited with the China Center for Type Culture Collection, and the deposit date is January 29, 2024, and the strain deposit number is CCTCC NO: M2024269. The deposit address is: China Center for Type Culture Collection (Wuhan, China, Wuhan University).

[0045] Unless otherwise specified, the reagents or materials described in the following examples are all commercially available.

[0046] Example 1: A method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea and a compound fermenting agent used therefor

[0047] I. Isolation, screening, and purification of Aspergillus cristatus FT128 and Monascus sp. HQ128

[0048] 1. Raw material preparation

[0049] (1) Tea sample preparation

[0050] The tea samples are from Shaanxi Jiyudao Fucha Co., Ltd. The tea samples are in brick shape, made of spring and summer tea leaves, with a fermentation period of 30 - 45 days. The tea brick size: length: 25 cm, width: 15 cm, height: 5 cm; the inner packaging of the tea brick is wrapped with kraft paper, and the outer packaging is sealed with a carton. Tea samples are taken from the upper, middle, and lower layers of the tea brick respectively, and randomly sampled according to the 5-point sampling method. The taken tea samples are stored in a sterile bag in a 4°C refrigerator for later use.

[0051] (2) Red yeast preparation

[0052] Wuyi Red Yeast comes from Wenzhou, Zhejiang. Red Yeast is generally used for wine fermentation, and the fermentation cycle is 1-2 months. Red Yeast sampling adopts five-point sampling method to randomly sample. The red yeast samples are stored in sterile bags at 4℃ refrigerator for later use.

[0053] (3) Culture medium formulation

[0054] Potato agar separation medium: 20 g potato flour, 2 g sucrose, 100 mL distilled water, 2 g agar, natural pH (about 6.0), autoclave at 121°C for 15 min, and set aside.

[0055] 2. Isolation and purification of bacterial strains

[0056] In the clean bench, 15 g of tea sample and 5 g of red yeast rice were weighed into a sterile conical flask, 200 mL of sterile water and a small amount of sterilized glass beads were added, and the mixture was shaken at 28 °C and 150 rpm for 40 min. The initial bacterial solution was then taken out and filtered with sterile gauze to obtain the initial bacterial solution.

[0057] The above-mentioned Fucha fungus liquid and red yeast liquid were diluted in a gradient manner, and the dilution gradient was selected to be 10 -4 , 10 -5 , 10 -6 and 10 -7 , and 20 μL was applied to the PDA plate medium for coating. Three parallels were set for each gradient and placed in a constant temperature incubator at 28°C for culture. Single colonies with good growth were picked and streaked on the PDA medium for further separation and purification, repeated 5-6 times, and morphological records were made. The purified strains were stored in a 4°C refrigerator. The screened bacteria were sequenced and compared, and the identified Aspergillus cristatus was finally named Aspergillus cristatus FT128, and Monascus was named Monascus sp HQ128.

[0058] 2. Identification of bacterial strains

[0059] 1. Morphological identification

[0060] The above-mentioned strains Aspergillus cristatus FT128 and Monascus spHQ128 were activated in PDA medium. The results are as follows Figure 1As shown in the figure. By observing its colony morphological characteristics, it can be seen that the Aspergillus cristatus FT128 strain initially appears as a white woolly mass on the medium, and then the colony continues to grow and turns golden yellow, round, convex on the surface, with neat white hyphae growing at the edge. The surface of the colony is rough, with golden yellow cleistothecium ascomata, the conidiophores are grayish green, and the texture of the colony is woolly, compact, yellow to orange-yellow; the Monascus sp HQ128 strain has a white colony on the medium at first, and turns light pink, purple or grayish black when it matures. The mycelial morphology was observed under a microscope after picking the strains and staining them with lactophenol cotton blue staining solution. The results are as Figure 2 shown.

[0061] The above strains were photographed by scanning electron microscopy. The results are as Figure 2 and Figure 3 shown. The results of scanning electron microscopy (SEM) show that there are cleistothecium ascomata with spores at the ends of the hyphae of Aspergillus cristatus FT128, and conidia are attached to the ends of the hyphae of Monascus sp HQ128, with many irregular branches.

[0062] 2. Molecular biological identification

[0063] The above purified strains (Aspergillus cristatus FT128, Monascus sp HQ128) were identified by 16S rDNA amplification and sequence analysis. The specific method is as follows: The Ezup column bacterial genomic DNA extraction kit was used to extract the genomic DNA of the purified strains, and the following universal primers were used to amplify the 16S rDNA of the strains: ITS1 (upstream primer, sequence: 5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (downstream primer, sequence 5'-TCCTCCGCTTATTGATATGC-3'). The amplification system and conditions are shown in Tables 2 and 3 below. The amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0064] Table 1 PCR amplification reaction system

[0065]

[0066] Table 2 16S rDNA amplification conditions

[0067]

[0068] The PCR products obtained by amplification through the above method were subjected to BLAST alignment on the NCBI website with their sequencing results, and the MEGA11 software was used to construct a phylogenetic tree by the neighbor-joining method, asFigure 4 As shown in the figure, the results showed that the sequence similarity between strain FT128 and Aspergillus cristatus ON645259.1 was 99.82%. And the similarity with multiple strains of Aspergillus cristatus reached over 99%. Combining the cultural characteristics, morphological characteristics, physiological and biochemical characteristics of strain FT128, it can be determined that this strain is Aspergillus cristatus; the sequence similarity between strain HQ128 and Monascus sp KC756833.1 was 98.53%. Combining the cultural characteristics and morphology of strain HQ128, it can be determined that this strain is Monascus sp.

[0069] And a phylogenetic tree of strain FT128 was drawn based on the new sequence data in NCBI, and the results are as Figure 4 shown.

[0070] The 16S rDNA sequence of Aspergillus cristatus FT128, with a length of 579 bp, is as follows:

[0071] ACTCGGTAATGATCCTTCCGTAGGGGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAACCGGAGGAAACCCCCCC

[0072] The 16S rDNA sequence of Monascus sp HQ128, with a length of 554 bp, is as follows:

[0073] TCGGGATGCTACTGATCCGAGGTCACCTAAGGAAAAAAAGGTTGGAGAGGGCAAAGGCCCCGGCCCGACCTACTGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGCGCCGCCACTGCCTTTCGGGCCCGTCCCCGTTGCCCGGAGGCGCAGGGGACGGCGGCCCAACACACAAGCCGCGCTTGAGGGGCAGTAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACCGATTTGGTATGTTTACTCAGACAGCAATCCTTTTCAAAGACAGCGTTCGAGAAGATGTCTCCGGCGGGCCCCAGGGGGCCGCGCCGAAGCAACAGGAGGTACAATAATCACGGGTGGGAGGTTGGGTCCCACGAAGGGGACCCGCACTCGGTAATGATCCTTCCGCAGTCCCCCCCTTACGGAAAACAT

[0074] Study on the Optimal Extraction Process of Summer-Autumn Tea Extract

[0075] I. Pretreatment of Summer-Autumn Tea Samples and Preparation of Extract

[0076] The summer and autumn tea was provided by Guoyao Health Technology (Huangshan) Co., Ltd. The physical and chemical index requirements are as follows: moisture ≤ 5.0 (g / 100g), ash ≤ 7.0 (g / 100g), lead (calculated as Pb) ≤ 0.45 (mg / kg), and the total amount of hexachlorocyclohexane and dichlorodiphenyltrichloroethane ≤ 0.2 (mg / kg); the quality requirements for the raw materials of summer and autumn tea are that the proportion of impurities (non-tea plant components) ≤ 5%. The summer and autumn tea was pulverized and passed through a 40-mesh sieve. Subsequently, the summer and autumn tea powder was mixed with ultrapure water at a certain solid-liquid ratio (1:10, 1:15, 1:20, 1:25, 1:30) in a clean beaker and subjected to a boiling water bath at 100°C for extraction (25 min, 30 min, 35 min, 40 min, 45 min). Subsequently, ultrasonic extraction was carried out at a certain ultrasonic power (180 w, 210 w, 240 w, 270 w, 300 w) for (10 min, 15 min, 20 min, 25 min, 30 min); after filtering the tea residue, the tea extract was obtained, sterilized at 121°C for 20 min, and then cooled to room temperature for standby.

[0077] II. Determination of water extract of summer and autumn tea

[0078] The method in GB / T 8305-2013 was used to determine the content of water extract in tea leaves. The results are as Figure 4 shown. As the water bath time increased, the content of water extract in tea leaves first increased and then decreased, reaching the highest at about 45% at 30 min. The optimal extraction levels were selected as: 30 min, 35 min, 40 min; as the ultrasonic time increased, the water extract first increased, then decreased and then increased again, and reached the highest at about 59% at 15 min. The optimal extraction levels were selected as: 15 min, 20 min, 25 min; as the solid-liquid ratio increased, the content of water extract in tea showed a trend of first increasing and then decreasing, reaching the highest at about 59% at 1:25. The optimal extraction levels were selected as: 1:20, 1:25, 1:30; as the ultrasonic power increased, the content of water extract in tea showed a trend of first increasing and then decreasing and reached the highest at 240 w at 52%. The optimal extraction levels were selected as: 200 w, 240 w, 270 w. The results of the orthogonal experiment are shown in Table 3. Taking the content of water extract as the index, the optimal extraction process for summer and autumn tea obtained through the orthogonal experiment results is: water bath time: 30°C, ultrasonic time: 15 min, solid-liquid ratio: 1:25, ultrasonic power: 270 w.

[0079] Table 3 Results of orthogonal experiment on extraction process of summer and autumn tea

[0080]

[0081] Liquid fermentation of summer and autumn tea by strains FT128 and HQ128

[0082] I. Preparation of spore suspension of FT128 and HQ128

[0083] Activate FT128 and HQ128 on the PDA plate 1-2 times first, and then inoculate them onto the PDA slant. After 4-5 days when the fungus covers the slant, add 10 mL of sterile normal saline (0.9% NaCl) and a small amount of sterilized glass beads. Scrape the spores into the sterile normal saline with an inoculation loop, and then shake at 28 °C for 40 min in a constant temperature shaker. After filtering with sterile gauze, spore suspensions of FT128 and HQ128 are obtained respectively. Adjust the spore concentration to between 1.0×10 5 -10 6 CFU / mL for standby.

[0084] II. Inoculating and fermenting the extract of summer and autumn tea

[0085] Add the prepared spore suspension to the sterilized extract of summer and autumn tea according to the addition amount of 3-12% of the inoculation amount. The inoculation ratio is 2:1 (C. cristatum: Monascus purpureus). After sealing, place it in a constant temperature shaker at 25-32 °C and ferment for 6-15 days. The shaker speed is controlled at 120-150 rpm, and the fermentation humidity is controlled at 60-70%.

[0086] III. Pretreatment and concentration of the fermentation broth to prepare tea extract

[0087] Filter the fermentation broth of summer and autumn tea 1-3 times with nylon cloth (gauze or special filter membrane) to obtain the filtrate, and perform pasteurization (68-70 °C, 40 min). Subsequently, place the above filtrate in a round-bottom flask and concentrate it by vacuum rotary evaporation. The rotary evaporation temperature is 70 °C, the rotation speed is 60 rpm, and the rotary evaporation is concentrated to 5-10% of the original solution volume.

[0088] IV. Physicochemical determination of the extract of summer and autumn tea

[0089] 1. Determination of the content of tea polyphenols

[0090] The method for determining the total phenols in tea refers to the operating method of the second method in the national standard GB / T 8313-2008 "Methods for the determination of tea polyphenols and catechins in tea" to process the samples, and make modifications: accurately measure 0.5 mL of the test sample solution and place it in a clean test tube. According to the method in the item of "Drawing the standard curve", use Folin reagents with different concentrations to measure the absorbance and make a standard curve, and calculate the content of tea polyphenols in the test sample through the standard curve. The standard curve is: Y = 0.0038X - 0.0277, R 2 = 0.9979.

[0091] Related reports show that the content of tea polyphenols is positively correlated with the bitter and astringent taste of tea. Keeping the content of tea polyphenols at a relatively low level (90-120 mg / g) is beneficial to the mellow taste of tea. The change of the content of tea polyphenols with the fermentation days is as Figure 6As shown in the figure, with the progress of fermentation, the content of tea polyphenols shows a trend of first increasing and then decreasing. The decrease of tea polyphenols is particularly obvious during 3-5 days of fermentation, and reaches a more appropriate level of 100-150 mg / g at 7-9 days. The experimental results show that inoculating Aspergillus cristatus FT128 and Monascus ruber HQ128 can significantly reduce the content of tea polyphenols in summer and autumn tea.

[0092] 2. Determination of flavonoids

[0093] For the determination of total flavonoids, referring to GB / T20574-2006, take 0.5 mL of the fermentation broth into a 50 mL centrifuge tube, add 0.5 mL of 5% sodium nitrite, shake well, and let it stand for 6 min. Then add 0.5 mL of 10% aluminum nitrate, shake well, and let it stand for 6 min. Finally, add 4 mL of 4% sodium hydroxide, shake well, and let it stand for 15 min. Then measure the absorbance at a wavelength of 510 nm, using 70% methanol as the blank control. The standard curve is: Y = 0.1629X - 0.0022, R 2 = 0.9996.

[0094] As Figure 6 , the change trend of total flavonoids is similar to that of tea polyphenols, decreasing from the initial 149.23 mg / g to the lowest 105.32 mg / g. The decrease is particularly obvious during 5-7 days. Flavonoid glycosides in flavonoids have a lower bitterness threshold and are the main source of bitterness in tea. Therefore, an appropriate reduction of flavonoids is beneficial to reducing the bitterness of summer and autumn tea.

[0095] 3. Determination of total sugar

[0096] For the determination of total sugar, referring to GB / T 15038-2006, the anthrone-sulfuric acid method is used. Take 0.5 mL of the fermentation broth into a clean test tube, accurately add 8 mL of anthrone reagent, and add 1 mL as the blank control; after shaking well, place it in a boiling water bath and boil accurately for 3 min, then immediately cool it with cold water and perform colorimetric determination at 620 nm. The standard curve is: Y = 1.7531X + 0.0053, R 2 = 0.9938.

[0097] With the progress of fermentation, the content of total sugar in tea continuously decreases, which will cause the continuous growth of bacteria and thus produce more flavor compounds.

[0098] 4. Determination of total free amino acids

[0099] The determination of free amino acids was slightly modified with reference to GB / T 8314-2013 "Determination of Total Free Amino Acids in Tea": Accurately pipette 0.5 mL of the concentrated extract into a 25-mL colorimetric tube, then add 0.5 mL of pH 8.0 phosphate buffer and 0.5 mL of 2% ninhydrin solution, heat in a boiling water bath for 15 min, cool, and make up the volume to 25 mL with water, and let it stand for 10 min. After 10 min, measure the absorbance at 570 nm using a 5-mm colorimetric cell, with the reagent blank solution as the reference. Prepare a standard curve using L-theanine, measure the absorbance at 570 nm, with the reagent blank solution as the reference. The standard curve is: Y = 0.6855X - 0.0153, R 2 = 9987.

[0100] The content of free amino acids in tea determines the quality of the tea taste. The higher the amino acid content, the fresher, smoother, and more mellow the tea taste. From Figure 6 it can be seen that as the fermentation time increases, the content of amino acids in the fermentation broth shows a slow increasing trend, continuously increasing from 3.45% in the unfermented state to a maximum of 4.61% on the 7th day of fermentation. Therefore, from the experimental results, it can be known that the total free amino acid content of summer and autumn tea fermented by Aspergillus cristatus FT128 and Monascus ruber HQ128 has been significantly improved.

[0101] 5. Determination of Volatile Flavor Compounds

[0102] Weigh 1 g of the ground tea sample and put it into a headspace vial, add 30 mL of boiling water and 20 μL of ethyl caprate (ethyl caprate is diluted with methanol to a concentration of 0.865×10 -3 g / L), and equilibrate in a water bath at 60 °C for 10 min. Then insert the 50 / 30 μm DVB / CAR / PDMS fiber probe of the fiber into the headspace vial, extract at 60 °C for 50 min, then take it out and insert it into the injection port of the gas chromatograph, and desorb at 250 °C for 5 min.

[0103] GC conditions: Chromatographic column: TG-5MS (30 m × 0.25 mm × 0.25 μm); injection port temperature is 250 °C; carrier gas is He (purity 99.999%), flow rate 0.9 mL / min; temperature programming: initially hold at 50 °C for 5 min, increase to 180 °C at a rate of 3 °C / min and hold for 2 min, and finally increase to 250 °C at a rate of 10 °C / min and hold for 3 min.

[0104] MS conditions: Electron impact ion source; electron energy 70 eV; transfer line temperature 280 °C; ion source temperature 230 °C; activation voltage 1.5 V; mass scanning range 40 - 500 m / z.

[0105] The heat map of volatile compounds in the fermentation broth and the content map of flavor substances are as Figure 7As shown in the figure, the 9th day and the 0th day were respectively selected for flavor comparison. A total of 62 volatile compounds were detected in the fermented summer and autumn tea, including 18 alcohols, 13 esters, 5 acids, 6 ketones, 6 aldehydes, 8 hydrocarbons and 6 other compounds. The total content of flavor compounds before and after fermentation increased from 5.24 μg / g to 20.79 μg / g, an increase of 296.76%. From the change of the content of flavor substances, it can be seen that the flavor composition of tea changed significantly before and after fermentation. The flavor substances before fermentation were mainly composed of alcohols, acids and esters, and the volatile compounds after fermentation were mainly composed of esters and alcohols (the content of alcohol flavor compounds increased from 2.60 μg / g to 9.64 μg / g, and esters increased from 0.17 μg / g to 5.55 μg / g). During the mixed fermentation of summer and autumn tea, the contents of linalool, linalool oxides, α-terpineol, terpenol, geraniol, menthol and methyl salicylate increased with the increase of fermentation time, which was closely related to the formation of unique flavor during the tea fermentation process. Linalool plays a key role in the flavor formation of tea, which can bring fruity, floral and woody aromas to the tea; α-terpineol can bring green and floral aromas to the tea; menthol plays an important role in the flavor formation of dark tea and can provide a minty taste to the tea; geraniol can bring rose floral and green-sweet odors; the content of lipid compounds increased significantly after fermentation, which was mainly manifested by the increase in the contents of methyl salicylate and phenethyl acetate after fermentation, and these two lactones were mostly detected in tea. Methyl salicylate has a strong wintergreen oil aroma, and it accounts for a large proportion in the content of flavor substances in the fermented summer and autumn tea and is the main aroma-forming substance; combined with OPLS-DA analysis, key differential flavor compounds with VIP>1 were screened out (Table 4), among which the contents of flavor compounds with special floral and fungal aromas such as linalool oxides I, methyl salicylate, and α-terpineol increased significantly. At the same time, the contents of flavor compounds related to the green odor of tea such as tea pyrrole, geraniol, and linalool decreased significantly. The above analysis shows that the mixed fermentation of summer and autumn tea with Aspergillus cristatus and Monascus ruber can effectively increase the content of volatile compounds in summer and autumn tea and significantly increase the content of key aroma-forming substances such as methyl salicylate, α-terpineol and linalool oxides.

[0106] Table 4 Key differential flavor compounds before and after fermentation

[0107]

[0108] Preparation and nutritional evaluation of fermented summer and autumn tea lozenges

[0109] I. Preparation of fermented summer and autumn tea lozenges

[0110] The prepared fermented summer and autumn tea extract is added to the melted xylitol to prepare tea lozenges: First, heat the xylitol to 120 - 140 °C until it melts to a clear and transparent state, then stir and cool it, and cool it with running water to 90 - 99 °C. Add excipients (citric acid, Luo Han Guo powder, tea extract, flower tea flavor enhancer, mint powder, and edible essence), and continuously stir during this process until the temperature drops to 82 - 85 °C and then start pouring. After pouring, demold. The prepared tea lozenges are as shown in Figure 14 . The sensory evaluation of the fermented summer and autumn tea lozenges is shown in Table 5. Compared with ordinary tea lozenges, the summer and autumn tea lozenges prepared by mixed - strain fermentation have an obvious Fucha aroma, high stability of the lozenges, and appropriate sweetness.

[0111] Table 5 Sensory comparison between summer and autumn tea lozenges and ordinary green tea lozenges

[0112]

[0113] II. Nutritional characteristics and antioxidant characteristics of summer and autumn tea lozenges

[0114] Refer to methods such as GB / T 8313 - 2008, SZDB / Z 349 - 2019, GB / T 36056 - 2018, GB / T 8312 - 2013, DB35 / T1326 - 2013, etc. to detect the physical and chemical indexes and nutritional characteristics (polyphenols, caffeine, flavonoid compounds, soluble sugars, monacolin k, and γ - aminobutyric acid) of fermented tea lozenges and ordinary green tea lozenges. The results are as shown in Figure 9 and Figure 10 . To explore the differences in the nutritional characteristics between mixed - strain fermented tea lozenges and single - strain fermented ones, the polyphenols, flavonoid compounds, caffeine, and soluble sugars of ordinary green tea lozenges (CT), mixed - strain fermented tea lozenges (MFT), Aspergillus cristatus fermented tea lozenges (EFT), and Monascus fermented tea lozenges (HFT) are determined. The results show that the contents of polyphenols, flavonoid compounds, caffeine, and soluble sugars in fermented tea lozenges are significantly higher than those in ordinary green tea lozenges. Especially, the contents of soluble sugars and caffeine in mixed - strain fermented tea lozenges are much higher than those in other groups. Research shows that Monascus fermentation can produce specific bioactive substances, such as monacolin k and γ - aminobutyric acid. The determination results of the contents of monacolin k and γ - aminobutyric acid are as shown in Figure 10 , and the results show that the contents of monacolin k and γ - aminobutyric acid in HFT and MFT are significantly higher than those in ordinary green tea lozenges and EFT. Refer to GB / T 39100 - 2020 to determine the scavenging rates of DPPH and ABTS by summer and autumn tea lozenges prepared by different fermentation modes, with vitamin C as the positive control. The results are as shown in Figure 12As shown in the figure, with the increase of concentration, the antioxidant property of MFT shows an increasing trend, and its total antioxidant capacity is stronger than that of the single-strain fermentation samples. Therefore, the summer and autumn tea lozenges prepared by mixed-strain fermentation have good antioxidant properties, and their nutritional characteristics and physical and chemical indexes are also significantly better than those of other samples.

[0115] III. Determination of Volatile Compounds in Summer and Autumn Tea Lozenges

[0116] Similar to the above determination of the flavor of fermented summer and autumn tea, the headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to determine the volatile compounds in ordinary green tea lozenges, mixed-strain fermented summer and autumn tea lozenges (MFT), Aspergillus cristatus fermented tea lozenges (EFT), and Monascus fermented tea lozenges (HFT). The heat map drawn based on the determination results is as Figure 11 shown. The tea lozenges prepared from the summer and autumn tea fermented by mixed strains have significantly more volatile compounds than ordinary green tea lozenges. Among the three fermented tea lozenges, the mixed-strain fermented tea lozenges have the largest number of volatile compounds. Volatile compounds such as methyl geranate, methyl salicylate, linalool oxide II, and linalool oxide I, which can provide special woody and minty herbal aromas for the product, are extremely abundant in the mixed-strain fermented tea lozenges, indicating that the tea lozenges prepared from the summer and autumn tea fermented by the mixture of FT128 and HQ128 have richer volatile compounds, and their aroma attributes are more abundant than those of ordinary green tea lozenges and single-strain fermented summer and autumn tea lozenges.

[0117] IV. Sensory Evaluation of Tea Lozenges

[0118] The sensory evaluation panel consists of 6 trained professionals. First, they smell the tea lozenges prepared from ordinary green tea (GTHP), Aspergillus cristatus fermented summer and autumn tea lozenges (EFTHP), Monascus fermented summer and autumn tea lozenges (HFTHP), and mixed-strain fermented summer and autumn tea lozenges (MFTHP) dissolved in water at 60 °C. Then, among 18 sensory descriptive words such as grassy, caramel, musty, stale, earthy, licorice, minty, floral, fruity, seaweed, smoky, ricey, sweet, herbal, woody, fishy, fermented, and alcoholic, they select the six most appropriate flavors. After discussion by the panel members, the six sensory descriptive words are finally determined. Then, they smell again and score according to the odor intensity from 0 to 5, and draw a flavor radar chart based on the final scores.

[0119] From Figure 13As can be seen from the flavor radar chart, compared with ordinary green tea lozenges and single-strain and mixed-strain fermented tea lozenges, the mixed-strain fermented summer and autumn tea lozenges can significantly reduce the grassy taste of the product and enhance the floral, herbal, and woody flavors of the tea, and the flavor performance of the mixed-strain fermented summer and autumn tea is more abundant. Therefore, according to the results of sensory evaluation, after mixed-strain fermentation with Aspergillus cristatus FT128 and HQ128, the flavor of summer and autumn tea lozenges can be significantly improved, reducing the grassy taste of summer and autumn tea lozenges while endowing the lozenges with more floral, herbal, and woody flavors.

[0120] In summary, the strains Aspergillus cristatus FT128 and Monascus purpureus HQ128 of the present invention are easy to culture and have strong viability. In the process of fermenting summer and autumn tea to prepare tea lozenges, they have the characteristics of increasing the content of soluble sugar and caffeine, degrading tea polyphenols to reduce the bitterness of tea, and improving the aroma of summer and autumn tea lozenges. At the same time, they have the function of increasing the content of γ-aminobutyric acid and monacolin K in tea. The prepared fermented summer and autumn tea lozenges have sufficient aroma, mellow taste, rich nutrition, and certain antioxidant function. Aspergillus cristatus FT128 and Monascus purpureus HQ128 are excellent strains for application in fermenting summer and autumn tea and deep processing of summer and autumn tea.

[0121] Example 2: A method for preparing tea lozenges by mixed-strain fermentation of summer and autumn tea and a compound fermenting agent used therein

[0122] A compound fermenting agent includes Aspergillus cristatus FT128 and Monascus purpureus HQ128. Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus purpureus HQ128 has been deposited at the China Center for Type Culture Collection, and the deposit date is January 29, 2024, and the strain deposit number is CCTCC NO: M2024269.

[0123] The compound fermenting agent is a spore suspension, and the ratio of the effective viable count between Aspergillus cristatus FT128 and Monascus purpureus HQ128 is 1.5:1.

[0124] A method for preparing tea lozenges by mixed-strain fermentation of summer and autumn tea includes the following steps:

[0125] Step 1: Raw material selection and preparation:

[0126] Wash, dry, and crush the summer and autumn tea, and use boiling water bath combined with ultrasonic extraction, and obtain the summer and autumn tea extract after filtration;

[0127] Step 2: Preparation of spore suspension:

[0128] Sterilized normal saline was added to the slant media of Aspergillus cristatus FT128 and Monascus purpureus HQ128 respectively. The spores of Aspergillus cristatus FT128 and Monascus purpureus HQ128 were scraped into sterile normal saline with an inoculation loop. After filtering with sterile gauze, a spore suspension containing Aspergillus cristatus FT128 and Monascus purpureus HQ128 was obtained, and this spore suspension was the compound fermentation agent.

[0129] Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269.

[0130] Step 3: Mixed bacteria fermentation of summer and autumn tea extract:

[0131] The compound fermentation agent was inoculated into the summer and autumn tea extract obtained in Step 1 for liquid fermentation to obtain a summer and autumn tea fermentation broth.

[0132] Step 4: Preparation of summer and autumn tea extract:

[0133] The summer and autumn tea fermentation broth was filtered, sterilized and then concentrated to obtain a summer and autumn tea extract.

[0134] Step 5: Preparation of summer and autumn tea lozenges:

[0135] The summer and autumn tea extract was added to melted xylitol, and mint, citric acid and auxiliary materials were added. Subsequently, it was poured, crystallized and demolded to obtain tea lozenges.

[0136] The preferred implementation method is: in Step 1, the process parameters of boiling water bath combined with ultrasonic extraction are: extraction time 25 min, ultrasonic time 10 min, ultrasonic power 180 w, and solid-liquid ratio 1:10 g / mL.

[0137] The preferred implementation method is: in Step 3, the summer and autumn tea extract obtained in Step 1 was placed in a container, sterilized at 121 °C for 20 min, and then inoculated with a compound fermentation agent with 3-12% spores of its mass; it was placed in a constant temperature shaker at 25 °C for fermentation for 6 d at a rotation speed of 120 rpm; there was no light during the fermentation process, the fermentation site was clean and odorless, and the relative humidity was maintained at 60%.

[0138] The preferred implementation method is: in Step 4, vacuum concentration was used for concentration, and the process parameters of vacuum concentration were: vacuum degree <0.07 MPa, temperature 50 °C, rotation speed 40 rpm.

[0139] The preferred embodiment is as follows: In step 5, the preparation of the summer and autumn tea lozenges includes: first heating xylitol to 120°C; then cooling it to 89°C with flowing water, and adding 9% of its mass of extract, 0.3% citric acid, 0.1% calcium lactate, and 0.02% of 2-(4-methoxyphenoxy)-sodium propionate during this temperature period; pouring is carried out when the temperature drops to 82°C.

[0140] Example 3: A method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea and a compound fermenting agent used therefor

[0141] A compound fermenting agent includes Aspergillus cristatus FT128 and Monascus purpureus HQ128. The Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; the Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269.

[0142] The preferred embodiment is: The compound fermenting agent is a spore suspension, and the ratio of the effective viable count between Aspergillus cristatus FT128 and Monascus purpureus HQ128 is 2.5:1.

[0143] A method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea includes the following steps:

[0144] Step 1: Raw material selection and preparation:

[0145] Wash, dry, and crush the summer and autumn tea, and perform ultrasonic extraction combined with boiling water bath, and obtain the summer and autumn tea extract after filtration;

[0146] Step 2: Preparation of spore suspension:

[0147] Add sterilized physiological saline to the slant media of Aspergillus cristatus FT128 and Monascus purpureus HQ128 respectively, scrape the spores of Aspergillus cristatus FT128 and Monascus purpureus HQ128 into the sterile physiological saline with an inoculation loop, and obtain a spore suspension containing Aspergillus cristatus FT128 and Monascus purpureus HQ128 after filtration through sterile gauze. This spore suspension is the compound fermenting agent;

[0148] The Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; the Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269;

[0149] Step 3: Mixed bacteria fermentation of summer and autumn tea extract:

[0150] Inoculate the compound fermenting agent into the summer and autumn tea extract obtained in Step 1, and conduct liquid fermentation to obtain the summer and autumn tea fermentation broth;

[0151] Step 4: Preparation of summer and autumn tea extract:

[0152] Filter the summer and autumn tea fermentation broth, and after sterilization, concentrate it to obtain the summer and autumn tea extract;

[0153] Step 5: Preparation of summer and autumn tea lozenges:

[0154] Add the summer and autumn tea extract to the melted xylitol, and add mint, citric acid and auxiliary materials, and then carry out casting, crystallization, and demolding to obtain the tea lozenges.

[0155] The preferred implementation method is: in Step 1, the process parameters of boiling water bath combined with ultrasonic extraction are: extraction time 45 min, ultrasonic time 30 min, ultrasonic power 300 w, solid-liquid ratio 1:30 g / mL.

[0156] The preferred implementation method is: in Step 3, put the summer and autumn tea extract obtained in Step 1 into a container, sterilize it at 121 °C for 50 min, and then inoculate the compound fermenting agent with 3-12% spores of its mass; place it in a constant temperature shaker at 3 °C for fermentation for 15 d, rotation speed 150 rpm; there is no light during the fermentation process, the fermentation site is clean and odorless, and the relative humidity is kept at 70%.

[0157] The preferred implementation method is: in Step 4, vacuum concentration method is used for concentration, and the process parameters of vacuum concentration are: vacuum degree <0.07 MPa, temperature 70 °C, rotation speed 60 rpm.

[0158] The preferred implementation method is: in Step 5, the preparation of summer and autumn tea lozenges includes: first heat the xylitol to 140 °C; then cool it to 99 °C by running water, and add 20% of its mass of extract, 0.5% citric acid, 0.5% calcium lactate, 0.05% of 2-(4-methoxyphenoxy)-sodium propionate during this temperature period; carry out casting when the temperature drops to 85 °C.

[0159] The above are only preferred embodiments for explaining the present invention, and are not intended to limit the present invention in any form. Therefore, any modification or change to the present invention made under the same inventive spirit should still be included in the scope intended to be protected by the present invention.

Claims

1. A compound fermenting agent, characterized in that: It includes Aspergillus cristatus FT128 and Monascus purpureus HQ128. Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269.

2. A method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea, characterized in that: It includes the following steps: Step 1: Raw material selection and preparation: Wash, dry, and crush summer and autumn tea. Use a boiling water bath combined with ultrasonic extraction, and filter to obtain an extract of summer and autumn tea. Step 2: Preparation of spore suspension: Add sterilized physiological saline to the slant media of Aspergillus cristatus FT128 and Monascus purpureus HQ128 respectively. Use an inoculation loop to scrape the spores of Aspergillus cristatus FT128 and Monascus purpureus HQ128 into sterile physiological saline. After filtering with sterile gauze, a spore suspension containing Aspergillus cristatus FT128 and Monascus purpureus HQ128 is obtained, and this spore suspension is the compound fermentation agent. Aspergillus cristatus FT128 was deposited at the China Center for Type Culture Collection on November 9, 2023, with the deposit number CCTCC NO: M20232176; Monascus purpureus HQ128 was deposited at the China Center for Type Culture Collection on January 29, 2024, with the strain deposit number CCTCC NO: M2024269; Step 3: Mixed bacteria fermentation of the extract of summer and autumn tea: Inoculate the compound fermentation agent into the extract of summer and autumn tea obtained in Step 1, and perform liquid fermentation to obtain a fermentation broth of summer and autumn tea. Step 4: Preparation of extract of summer and autumn tea: Filter the fermentation broth of summer and autumn tea, sterilize it, and then concentrate it to obtain an extract of summer and autumn tea. Step 5: Preparation of summer and autumn tea lozenges: Add the extract of summer and autumn tea to melted xylitol, and add mint, citric acid, and excipients. Then, perform pouring, crystallization, and demolding to obtain tea lozenges.

3. The method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea according to claim 2, wherein: In Step 1, the process parameters of the boiling water bath combined with ultrasonic extraction are: extraction time 25 - 45 min, ultrasonic time 10 - 30 min, ultrasonic power 180 - 300 w, and solid-liquid ratio 1:10 - 1:30 g / mL.

4. The method for preparing tea lozenges by mixed bacteria fermentation of summer and autumn tea according to claim 2, characterized in that: In Step 3, put the extract of summer and autumn tea obtained in Step 1 into a container, sterilize it at 121 °C for 20 - 50 min, and then inoculate 3 - 12% of its mass of the compound fermentation agent. Place it in a constant temperature shaker at 25 - 32 °C for fermentation for 6 - 15 d at a rotation speed of 120 - 150 rpm; there is no light during the fermentation process, the fermentation site is clean and odorless, and the relative humidity is maintained at 60 - 70%.

5. The method for preparing tea buccal tablets by mixed bacteria fermentation of summer and autumn tea according to claim 2, characterized in that: In Step 4, vacuum concentration is used for concentration. The process parameters of vacuum concentration are: vacuum degree < 0.07 MPa, temperature 50 - 70 °C, and rotation speed 40 - 60 rpm.

6. The method for preparing tea buccal tablets by mixed bacteria fermentation of summer and autumn tea according to claim 2, characterized in that: In step 5, the preparation of the summer and autumn tea lozenges includes: first heating xylitol to 120-140 °C; then cooling it to 89-99 °C through running water, and adding 9-20% of its mass of extract, 0.3-0.5% citric acid, 0.1-0.5% calcium lactate, and 0.02-0.05% of sodium 2-(4-methoxyphenoxy)-propionate during this temperature period; and pouring when the temperature drops to 82-85 °C.

Images