InDel molecular markers co-segregated with melon pulp thickness and their application

Abstract

The present invention provides an InDel molecular marker co-segregated with melon pulp thickness and its application. The InDel molecular marker is obtained by amplification of the upstream primer CmFpt-F shown in SEQ ID NO:1 and the downstream primer CmFpt-R shown in SEQ ID NO:2. The molecular marker primer is not only co-segregated with the pulp thickness trait in natural populations, but its amplified band type is also consistent with the pulp thickness phenotype in different breeding materials. The primer pair designed based on the InDel molecular marker and the kit thereof can be used to screen the melon pulp thickness trait at the budding stage or the seedling stage. Therefore, the molecular marker, primer pair, kit, etc. provided by the present invention can be directly used in melon molecular marker-assisted breeding, reduce the production cost of planting large populations, accelerate the breeding process, and improve the breeding efficiency, and have important application value; at the same time, it can improve the accuracy of selection and accelerate the process of variety breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular breeding, and in particular to an InDel molecular marker co-separated with melon pulp thickness and an application thereof. Background Art

[0002] Muskmelon (Cucumis melo L.) is an important cucurbit crop with high nutritional and economic value. China has a long history of melon cultivation, dating back to the reign of Emperor Wu of the Han Dynasty. China's total melon cultivation area and output rank first in the world, accelerating the rapid development of the entire fruit and vegetable industry, but the yield per mu is relatively low.

[0003] Molecular assisted selection breeding technology is a method of using molecular markers to quickly screen target traits. In recent years, it has been well applied in melon breeding. It can quickly screen the required breeding materials and parents at the molecular level, greatly shortening the breeding period. Compared with traditional breeding, molecular breeding is more accurate and more efficient, and can achieve the transformation from "empirical breeding" to "precision breeding". Molecular marker breeding can speed up plant breeding, but there is currently a lack of reliable markers for effective yield trait assisted screening, such as flesh thickness-related markers, which has a huge impact on the next development of the melon industry.

[0004] The thickness of melon flesh is an important texture quality of melon. Whether it is used for processing or fresh consumption, the thicker the flesh, the higher its utilization rate. It is closely related to dry matter accumulation and texture. The identification of melon flesh thickness genes through whole genome association analysis, the use of modern molecular biotechnology to improve germplasm, and the breeding of thick-fleshed varieties are of great significance to improving the texture quality of melons and enhancing consumer benefits. At the same time, the thickness of melon flesh is an important agronomic trait of melons, which directly determines the fruit shape and yield of melons. The flesh thickness of the fruit is a very important agronomic trait and an important component of melon yield, which directly determines the weight of the fruit; the flesh thickness is an agronomic trait after the fruit is fully mature, and it is easily affected by the environment, which is a difficult point in trait improvement. Conventional breeding requires the identification of flesh thickness after the fruit is mature, which is time-consuming and costly.

[0005] For this reason, Northeast Agricultural University disclosed molecular markers, methods, primer pairs, kits and applications for identifying the melon flesh thickness trait in Chinese invention patent application CN 116987814 A. The molecular marker is a CAPS molecular marker, which is mainly developed based on the SNP site found on chromosome 1 of the melon genome using parental hybridization technology. Although the disclosed identification method provides an effective molecular breeding tool for the molecular identification of the melon flesh thickness trait, no genes related to the melon flesh thickness trait have been found on other chromosomes of the melon genome in the prior art, and no reports have been found on InDel molecular markers co-separated with melon flesh thickness. It can be seen that there are relatively few reports on the gene positioning of the melon flesh thickness trait in the prior art, which is not conducive to the directional increase of melon yield and the shortening of the breeding process. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide an InDel molecular marker co-separated with melon pulp thickness.

[0007] The second object of the present invention is to provide an application of the above-mentioned molecular marker in melon molecular breeding.

[0008] Another object of the present invention is to provide a method for determining the thickness of melon pulp.

[0009] To achieve the above object, the present invention provides the following technical solutions:

[0010] The present invention provides an InDel molecular marker co-isolated with melon pulp thickness (Fpt), which is obtained by amplification of the upstream primer CmFpt-F shown in SEQ ID NO: 1 and the downstream primer CmFpt-R shown in SEQ ID NO: 2. The nucleotide sequences of are as follows:

[0011] CmFpt-F: 5'-TAAGAGGGAAAGGTCAGTACAGT (SEQ ID NO. 1);

[0012] CmFpt-R: 5'-TCGTAGAAAACAACCAAACCCC (SEQ ID NO. 2).

[0013] The InDel molecular markers include two genotypes, CTATC and C. The genotype CTATC has a thin-fleshed trait, and the genotype C has a thick-fleshed trait. In the present invention, the thin-fleshed trait preferably has a flesh thickness range of 0.210-2.240 cm, and the thick-fleshed trait preferably has a flesh thickness range of 2.278-3.983 cm.

[0014] The nucleotide sequence of the InDel molecular marker containing the CTATC genotype is shown in SEQ ID NO.3, with a total length of 100 bp; the nucleotide sequence of the InDel molecular marker containing the C genotype is shown in SEQ ID NO.4, with a total length of 96 bp.

[0015] SEQ ID NO.3: 5'-TAAGAGGGAAAGGTCAGTACAGTAGGTACCCA GTATTATTCCAT CTATC CATATTTATGCCTTTTCTTCTTTTATTATGGG GTTTGGTTGTTTTCTACGA;

[0016] SEQ ID NO.4: 5'-TAAGAGGGAAAGGTCAGTACAGTAGGTACCC AGTATTATTCCAT C CATATTTATGCCTTTTCTTCTTTTATTATGGGGTT TGGTTGTTTTCTACGA;

[0017] Among them, the underlined sequences in the sequences shown in SEQ ID NO.3 and SEQ ID NO.4 are variant sequences.

[0018] The present invention also provides a primer pair CmFpt for detecting InDel molecular markers co-separated with melon pulp thickness, wherein the primer pair CmFpt comprises an upstream primer CmFpt-F having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer CmFpt-R having a nucleotide sequence as shown in SEQ ID NO: 2.

[0019] The present invention also provides a kit for detecting InDel molecular markers co-segregated with melon pulp thickness, comprising the above-mentioned primer pair CmFpt for detecting InDel molecular markers co-segregated with melon pulp thickness. The kit can be used to identify the melon pulp thickness trait. Specifically, a reagent containing the above-mentioned primer pair CmFpt can be selected to make a kit, wherein each component in the reagent of the kit can be packaged independently, or two or more components can be mixed and packaged together.

[0020] The present invention also provides an application of the above-mentioned InDel molecular marker co-separated with melon pulp thickness or the above-mentioned primer pair CmFpt or the above-mentioned kit in melon molecular breeding. Among them, the InDel molecular marker or the above-mentioned primer pair CmFpt or the above-mentioned kit is mainly used to identify or assist in identifying the melon pulp thickness phenotype. Using the InDel molecular marker or primer pair or kit, the melon pulp thickness trait gene can be accurately, quickly and effectively identified. Those skilled in the art can understand that, for example, the melon pulp thickness variety can be determined by detecting whether the molecular marker of the present invention exists. Specifically, the primer pair of the molecular marker of the present invention can be used, and the detection can also be performed by a sequencing method.

[0021] The present invention also discloses a method for identifying the melon flesh thickness trait using the above-mentioned InDel molecular marker or the above-mentioned primer pair CmFpt or the above-mentioned kit, comprising PCR amplification of the above-mentioned primer pair CmFpt, and combining electrophoresis detection and / or gene sequencing method, and judging the genotype information of the InDel molecular marker in controlling the melon flesh thickness trait according to the size of the PCR amplification product.

[0022] The method for identifying the melon pulp thickness trait specifically comprises the steps of:

[0023] (1) extracting the genomic DNA of the melon to be tested;

[0024] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification on the template using the above primer pair CmFpt to obtain the PCR amplification product, and performing electrophoresis detection and / or sequencing on the PCR amplification product;

[0025] (3) According to the electrophoresis bands and / or sequencing results of step (2), when the length of the PCR amplification product is 100 bp, the variety to be tested is a homozygous thin-flesh trait; when the length of the PCR amplification product is 96 bp, the variety to be tested is a homozygous thick-flesh trait.

[0026] Among them, there is only one characteristic band for the homozygous thin flesh trait as shown in SEQ ID NO.3, and there is also only one characteristic band for the homozygous thick flesh trait as shown in SEQ ID NO.4.

[0027] In addition, the reagent for detecting the presence of InDel molecular markers is used in the localization of genes that control melon pulp thickness. The molecular markers of the present invention can be used to locate genes that control melon pulp thickness. All of the above applications can be carried out according to conventional methods.

[0028] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0029] The present invention uses a whole genome association analysis method to screen and obtain an InDel molecular marker related to the melon flesh thickness trait on chromosome 8 of melon. The InDel molecular markers are numbered as Chr8_6093182. The genotype C of the InDel molecular marker is a thick-fleshed fruit, and the genotype CTATC is a thin-fleshed fruit. This is used as an auxiliary selection marker for the flesh thickness trait in the melon breeding process. The InDel molecular marker is not only co-segregated with the flesh thickness trait in the natural population, but also its amplification band type is consistent with the flesh thickness phenotype in different breeding materials, so it can be directly used in melon molecular marker-assisted breeding. In addition, the InDel molecular marker can accurately and quickly identify the melon flesh thickness trait at the budding stage or the seedling stage, and has the advantages of convenient detection and stable amplification products.

[0030] The present invention utilizes the primer pair CmFpt and the kit thereof designed based on the InDel molecular marker to carry out melon pulp thickness gene screening at the budding stage or the seedling stage, thereby reducing the production cost of planting a large population, accelerating the breeding process, and improving the breeding efficiency, which has important application value; at the same time, it can improve the accuracy of selection and accelerate the process of variety breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the Manhattan plot of the genome-wide association analysis of melon flesh thickness traits, where the horizontal axis represents the genomic position of each variant site; the vertical axis represents the negative logarithm of the P value of each marker site under the MLM model with a base of 10;

[0032] Figure 2 This is the QQ plot of the genome-wide association analysis of melon flesh thickness trait, where: the horizontal axis represents the negative logarithm of the expected observed P value with a base of 10, assuming that the P value follows a uniform [0, 1] distribution; the vertical axis represents the negative logarithm of the observed P value with a base of 10;

[0033] Figure 3 Analysis of linkage disequilibrium blocks of candidate genes near significant association sites, where the red dots represent the positions of the significant association site Fpt, the indel of the WUS gene frameshift mutation, and the non-synonymous mutation SNP of the WUS gene from left to right;

[0034] Figure 4Sequence alignment and fruit characteristics of CmFpt primer ePCR products of de novo sequenced materials;

[0035] Figure 5 This is a box plot of the distribution of flesh thickness traits of samples of different genotypes corresponding to the significant association site Chr8_6093182; where: *** represents extremely significant differences in flesh thickness between different genotypes at the 0.001 level;

[0036] Figure 6 This is the polyacrylamide gel electrophoresis pattern of the PCR product marked by the InDel of the melon flesh thickness trait gene; among them: the 21 bands represent the screening results of the co-segregating markers of the fruit flesh thickness (Fpt) trait in 21 melon core materials. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described in detail below through specific implementation methods.

[0038] Unless otherwise specified, the terms used in the present invention are commonly used in the field. The technical means used in the examples, such as preparation processes, test methods, etc., are all conventional means well known to those skilled in the art, and the reagents and products used are all commercially available. The sources and trade names of the reagents used, as well as the components thereof, are indicated when they first appear.

[0039] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention.

[0040] The 179 materials used for marker development were provided by the National Watermelon and Muskmelon Germplasm Mid-term Bank (Zhengzhou), and the 21 melon breeding materials used to verify the primer amplification effect were obtained by the Melon Biotechnology and Germplasm Innovation Laboratory of Henan Agricultural University based on the melon seeds provided by the National Watermelon and Muskmelon Germplasm Mid-term Bank (Zhengzhou) through self-pollination and purification. It should be explained that the use of this material as the basis for research is only due to the convenience of obtaining experimental materials, and it should not be understood that the implementation of the relevant technical solutions of this application must rely on this experimental material.

[0041] The present invention mainly constructs a population for GWAS analysis through 179 melon materials. The selected melon materials are planted in a plastic greenhouse in Maozhuang Science and Education Park of Henan Agricultural University in Zhengzhou. 30 days after the plants are planted, the top young leaves of each material are taken as samples for extracting genomic DNA, and the flesh thickness trait is investigated after the melon fruits are ripe as phenotypic data for GWAS analysis. The resequencing of 179 melons was completed by Beijing Biomaike Biotechnology Co., Ltd., using Illumina sequencing technology, with a sequencing depth of >18X. The sequencing data produced are quality controlled and filtered, and the data that pass the quality control are compared with the DHL92 (v3.6.1) reference genome sequence to obtain variation information in the population genome, and molecular markers related to the melon flesh thickness trait are mined through association analysis of flesh thickness-related traits.

[0042] The present invention obtained 2489603 high-quality polymorphic markers (SNPs and InDels, etc.) for genome-wide association analysis. When the P value of the detected marker was less than 2×10 -8 Based on the results of the association analysis of melon flesh thickness, an InDel molecular marker related to melon flesh thickness was screened on chromosome 8 of the melon genome. The InDel molecular marker site is located at position 6093182 on chromosome 8 of the melon genome and is numbered: Chr8_6093182.

[0043] The present invention designs a pair of primers CmFpt based on the InDel molecular marker Chr8_6093182. It has been verified that the InDel molecular marker related to melon flesh thickness obtained by the present invention can be used in the assisted selection of melon flesh thickness traits, and its genotype C is thick-fleshed fruit; genotype CTATC is thin-fleshed fruit.

[0044] The technical solution to be protected by the present invention is further described in detail below with specific embodiments.

[0045] Example 1 Development of InDel Molecular Markers Co-separated with Melon Flesh Thickness

[0046] 1.1 Construction of genome-wide association analysis population

[0047] A melon genome-wide association analysis population was constructed using 179 melon materials provided by the National Watermelon and Muskmelon Germplasm Mid-term Bank (Zhengzhou, China). From 2022 to 2023, all melon materials were planted in a plastic greenhouse in the Maozhuang Science and Education Park of Henan Agricultural University in Zhengzhou. Five plants of each material were planted in spring and autumn each year. The production management process includes soaking seeds at room temperature for 6 hours, germination in dark light at 28°C, sowing in 72-hole trays at dawn, and placing them in a solar greenhouse for seedling cultivation. When they grow to three leaves and one heart, they are transplanted in a plastic greenhouse. Planting method: high ridge preparation, single ridge double row, triangular planting, wide and narrow row spacing (plant spacing 45 cm, narrow row spacing 60 cm, wide row spacing 80 cm). Pruning method: single vine pruning, artificial pollination before 10:00 am during the flowering period, normal fertilizer and water and pest and disease management, and investigation of flesh thickness traits after the fruit matures.

[0048] 1.2 Sample collection and phenotypic data investigation

[0049] When the melon plants grow to adult stage, at 8 am on a sunny day, take the young leaves from the top of the side branches, put them in tin foil and quickly freeze them in liquid nitrogen. After returning to the laboratory, store them in a -80℃ refrigerator.

[0050] After the melon fruits matured, well-developed (non-deformed) mature fruits were selected for measuring the trait of flesh thickness. Each fruit was randomly measured four times and the average value was taken.

[0051] 1.3 Extraction and detection of melon genomic DNA

[0052] The total DNA was extracted using the modified CTAB method. The experimental process included the following steps:

[0053] (1) Use liquid nitrogen to freeze the leaves, and then grind them into powder using a high-throughput cryo-grinder for later use.

[0054] (2) Add 800 μL of 2% CTAB that has been preheated in a 65°C water bath for 1 h to the centrifuge tube, shake to allow the melon leaf powder to fully contact the liquid, and place in a 65°C water bath for 1 h, mixing every 10 min;

[0055] (3) After cooling to room temperature in a water bath, add 800 μL of chloroform / isoamyl alcohol (volume ratio 24:1) solution, shake thoroughly, and centrifuge at 12,000 rpm for 10 min at 4°C;

[0056] (4) Aspirate 600 μL of supernatant and place in a 1.5 mL centrifuge tube, add 600 μL of -20°C precooled isopropanol, shake thoroughly, and precipitate at -20°C for 0.5 to 1 h;

[0057] (6) Remove the centrifuge tube and centrifuge at 12,000 rpm for 9 min at 4°C. After centrifugation, aspirate the supernatant and retain the precipitate.

[0058] (7) Wash with 75% ethanol 2 to 3 times, dry at room temperature, and add distilled water to make up to 80 μL to obtain the melon DNA sample to be tested.

[0059] The purity and concentration of DNA were tested using NanoDrop 2000 ultra-micro spectrophotometer, and the integrity was tested by agarose gel electrophoresis. Those that met the requirements were kept in a -20°C refrigerator for future use.

[0060] 1.4 Sequencing and data filtering

[0061] The genomic DNA samples that passed the above tests were ultrasonically broken and then electrophoretically screened for fragments of 300 bp in size, and then amplified by PCR to build libraries. The libraries that passed the quality inspection were sequenced. After Illumina sequencing, the raw data Raw Reads were subjected to the removal of adapters and random primers and the filtering of low-quality reads. Using melon DHL92 v3.6.1 (http: / / cucurbitgenomics.org / organism / 18) as the reference genome, the Clean Reads were aligned to the reference genome, and the whole genome variation information was obtained using GATK 4.0, and low-quality SNPs and InDels were filtered.

[0062] 1.5 Genome-wide association analysis and primer development

[0063] After the variant site SNP_and_InDel.vcf was quality controlled, the mixed linear model MLM of TASSEL 5.0 software was used for association analysis to mine the variant sites related to melon flesh thickness. -8 When the locus is found, it is considered to be a significant association locus. In this experiment, the melon flesh thickness trait was associated with a significant INDEL locus on chromosome 8: Chr8_6093182, as described in Table 1. The Manhattan plot and QQ plot of the P value of the whole genome locus were drawn using R packages, as shown in the figure below. Figure 1 and Figure 2 As shown, the peak value of GWAS results is significant and the QQ plot fitting consistency is high, proving that the results of association analysis are accurate.

[0064] Table 1 InDel loci significantly associated with melon flesh thickness

[0065] Tag Name chromosome Position / bp refer to Mutations Effect size Standard error P-value chr08-6093182 chr08 6093182 CTATC C 0.33912 0.057711 <![CDATA[1.79×10 -8 ]]>

[0066] Use LDBlockShow software to draw linkage disequilibrium blocks diagram, such as Figure 3 As shown, two candidate genes MELO3C007898 and MELO3C007899 were identified in the linkage disequilibrium region of the significant locus chr08-6093182. Among them, MELO3C007898 (chr08: 6099745..6102041) encodes WUSCHEL protein, referred to as WUS gene, which affects the adventitious root development, sugar accumulation and cytokinin content of crops. The annotation of internal variation of WUS gene in GWAS population found 1 frameshift mutation (ATT->A) and 1 missense mutation (T->C). Candidate gene MELO3C007899 (chr08: 6106785..6110535) encodes WD repeat sequence protein, referred to as WDR82 gene, and there is no site variation in the gene coding region. Therefore, the most likely candidate gene controlling the flesh thickness trait is WUS, and the upstream InDel marker of the gene is chr08-6093182. Fpt is closely linked to the candidate gene WUS, such as Figure 3 shown.

[0067] Aiming at the InDel variation site significantly associated with flesh thickness, a primer pair for InDel molecular marker was designed and named CmFpt. The primer pair CmFpt included an upstream primer CmFpt-F having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer CmFpt-R having a nucleotide sequence as shown in SEQ ID NO: 2.

[0068] It has been verified that the InDel molecular marker is co-segregated with the flesh thickness trait. As shown in Table 2, when the genotype of the chr08-6093182 locus is CTATC, the corresponding flesh thickness range is preferably 0.210-2.240 cm, which is a thin flesh trait; when the genotype of the chr08-6093182 locus mutates from CTATC to C, it exhibits a thick flesh trait, and the corresponding flesh thickness range is preferably 2.278-3.983 cm.

[0069] Table 2 Phenotypic values ​​of flesh thickness and genotype data of chr08_6093182 in melon related population materials

[0070]

[0071]

[0072]

[0073] Example 2 Verifying the polymorphism of InDel molecular markers in sequenced samples

[0074] Six melon varieties that have been sequenced from scratch were collected: thin-fleshed varieties DHL92, IVF77 (http: / / cucurbitgenomics.org / v2) and Ma Pao (https: / / ngdc.cncb.ac.cn / gwh / ), thick-fleshed types Harukei-3, Payzawat and Charmono (http: / / cucurbitgenomics.org / v2); the six varieties have obvious differences in flesh thickness. The ePCR reaction of melon flesh thickness marker primer pair CmFpt was performed on their genomes, and the amplified products are shown in Figure 4 The ePCR amplification results showed that there was a 4 bp insertion and deletion variation among the six varieties, proving that the InDel molecular marker can specifically bind and amplify polymorphisms among the six varieties with different flesh thickness.

[0075] The genotype analysis of 179 materials from the association analysis showed that, as shown in Table 3, the average flesh thickness of the materials with the InDel site as base C was 2.87 cm; the average flesh thickness of the melon materials with the InDel site as base CATCT was 1.50 cm; the average flesh thickness corresponding to the heterozygous site CATCT / C was 2.07 cm. The R software package ggplot2 was used to draw a box plot of the genotype and phenotype distribution as shown in Figure 5 As shown, the flesh thickness corresponding to different genotypes of CATCT and C was significantly different (P<0.01), which proved that the InDel site in the embodiment of the present invention can accurately distinguish the melon flesh thickness trait.

[0076] Table 3 Distribution of pulp thickness of melons of different genotypes

[0077]

[0078] Example 3: Application of co-isolated InDel molecular markers and primer pair CmFpt for melon pulp thickness

[0079] The primer pair CmFpt of the InDel molecular marker developed in Example 1 was used to amplify and verify the 21 melon breeding materials shown in Table 4. The structure is as follows Figure 6 shown.

[0080] 3.1 Extracting DNA from seedlings to be tested using the method in Example 1

[0081] The experimental materials are thick-fleshed melons with a flesh thickness ranging from 2.82 to 3.67 cm and thin-fleshed melons with a flesh thickness ranging from 0.24 to 1.45 cm, wherein the thick-fleshed melons are: HNA24, Net-textured 238, PI-164569, PMR-45, Ames29564, NSL 34600, NSL 60241, NSL 74171, PI 236355, PI 273442, PI 446930, and the thin-fleshed melons are: PI 536473, PI 406737, PI 536473, PI 536476, PI 614174, PI 614440, PI 614481, PI 614574, Yidu Huangyin-1, and ice melon materials.

[0082] Seedlings were raised in 72-hole trays according to the method in Example 1, with 3 plants of each material sown. Leaf samples were taken at the three-leaf and one-heart stage, and fresh leaf DNA was extracted according to the modified CTAB method in Example 1.

[0083] Table 4 Samples and Chr08_6093182 genotype information for validation of the InDel molecular marker for melon flesh thickness

[0084] Grouping Variety name Origin Pulp thickness / cm genotype Amplification product size / bp H HNA24 China 2.82 C 96 H Reticulated 238 China 3.59 C 96 H PI-164569 Russia 3.53 C 96 H PMR-45 Japan 2.98 C 96 H Ames 29564 Turkmenistan 3.05 C 96 H NSL 34600 USA 3.64 C 96 H NSL 60241 USA 3.27 C 96 H NSL 74171 USA 3.67 C 96 H PI 236355 U.K. 3.04 C 96 H PI 273442 Canada 3.37 C 96 H PI 446930 Israel 3.11 C 96 B PI 536473 Maldives 0.41 CTATC 100 B PI 406737 India 0.49 CTATC 100 B PI 536473 India 0.42 CTATC 100 B PI 536476 India 0.47 CTATC 100 B PI 614174 India 0.24 CTATC 100 B PI 614440 India 0.49 CTATC 100 B PI 614481 India 0.55 CTATC 100 B PI 614574 India 0.52 CTATC 100 B Yidu Yellow Silver-1 China 1.45 CTATC 100 B Ice Melon China 0.74 CTATC 100

[0085] Note: Group H melon varieties are thick-fleshed materials, totaling 11 samples; Group B melon varieties are thin-fleshed materials, totaling 10 samples.

[0086] 3.2 InDel-labeled PCR amplification

[0087] Using genomic DNA of 21 melon breeding materials as templates, PCR amplification of CmFpt was performed using the molecular InDel marker primers screened in Example 1. During PCR amplification, a 10 μL reaction system was used, including: a concentration of 100 ng·μL -1 1 μL of genomic DNA, 2× Taq PCR StarMix with Loading Day (including Taq DNA Polymerase, Mg 2+ and dNTPs) 5.0 μL, forward primer 0.5 μL, reverse primer 0.5 μL, ddH 2 O 3μL. The reaction program of the PCR amplification instrument was set as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 72℃ final extension for 10 min after 30 cycles, and storage at 4℃. The PCR amplification products were subjected to Sanger sequencing by Qingke Biotechnology (Nanjing).

[0088] 3.3 Polyacrylamide gel electrophoresis (PAGE) detection of PCR amplification products

[0089] Preparation of polyacrylamide gel, the required reagents and dosages are shown in Table 5. Mix the prepared solution evenly, pour it into the glass plate slowly and evenly (avoid bubbles), then slowly and evenly insert the comb and wait for the solution to solidify. First pour an appropriate amount of 0.5xTBE into the electrophoresis tank, then put the gel removal clamp into the electrophoresis tank, and then pour an appropriate amount of 0.5xTBE on the top of the electrophoresis tank, and slowly and evenly pull out the comb. Spot 1μL 2000 DNA Marker before the first spotting hole of the gel, and then add 1.0μL of each PCR product to the spotting hole in turn. After connecting the line to the electrophoresis instrument and the electrophoresis tank, perform electrophoresis for 1.0h.

[0090] Table 5 Reagents and amounts used in the preparation of polyacrylamide gel

[0091] Reagents Dosage 19:1 polyacrylamide solution 24 mL 5×TBE 16 mL <![CDATA[DdH 2 The]]> 10 mL TEMED 60μL 10% APS 600μL

[0092] After the electrophoresis is completed, the buffer solution is recovered from the electrophoresis tank, the gel is carefully removed from the glass plate, and rinsed in a plastic tank filled with distilled water, then the distilled water is discarded. Add 1000 mL of 1.2 g AgNO 3 The solution was placed on a shaker for 2 minutes. After staining, rinse quickly with a small amount of distilled water and then pour out the distilled water. Add color developing solution to develop the color until the band appears. After rinsing with distilled water, take a photo on a light box for analysis. The formula of color developing solution is 15g NaOH and 15mL formaldehyde solution dissolved in 1000mL distilled water.

[0093] 3.4 Amplification results

[0094] From Table 4 and Figure 6 It can be seen that: when the primer pair CmFpt marked by InDel molecule is used to detect thin flesh material with a flesh thickness range of 0.24-1.45 cm, a characteristic band of 100 bp can be obtained by PCR amplification, and the specific base sequence of the 100 bp characteristic band is shown in SEQ ID NO.3; under the same molecular marker, the product after amplification of thick flesh material with a flesh thickness range of 2.82-3.67 cm is a 96 bp fragment, and the amplified sequence of the thick flesh material is shown in SEQ ID NO.4. Sequence comparison of SEQ ID NO.4 revealed that the deletion of 4 genes TATC occurred at the 46th base of the amplified sequence SEQ ID NO.3 of the thin flesh material.

[0095] Example 4 InDel molecular marker kit for detecting melon flesh thickness trait and its application in flesh thickness genotype identification

[0096] This embodiment provides a kit for detecting InDel molecular markers co-separated with melon pulp thickness, including the primer pair CmFpt for detecting InDel molecular markers co-separated with melon pulp thickness provided in Example 1. In this embodiment, the kit mainly comprises the primer pair CmFpt, Taq DNA polymerase, Mg 2+ , dNTPs and ddH 2 O reagent is made.

[0097] This embodiment also provides an application of the above kit in the identification of genotypes controlling the melon flesh thickness trait, first amplifying the primer pair CmFpt, and then combining the electrophoresis detection and / or gene sequencing results to determine the genotype information controlling the melon flesh thickness trait. Specifically, the implementation method of the application of the kit in the identification of genotypes controlling the melon flesh thickness trait provided in this embodiment is the same as the specific implementation method of the co-segregated InDel molecular marker for melon flesh thickness and its primer pair CmFpt provided in the aforementioned Example 3.

[0098] The above embodiments show that the technical solution protected by the present invention can effectively distinguish between thick-fleshed melon materials and thin-fleshed melon materials, and accurately and quickly detect genotype variations related to the flesh thickness of the materials.

[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or some technical features can be replaced by equivalents without departing from the spirit of the technical solution of the present invention, which should be included in the scope of the technical solution for protection of the present invention.

Claims

1. An InDel molecular marker co-separated with melon pulp thickness, characterized in that: The nucleotide sequence containing the CTATC genotype is shown in SEQ ID NO.3, with a total length of 100 bp; and the nucleotide sequence containing the C genotype is shown in SEQ ID NO.4, with a total length of 96 bp.

2. A primer pair for detecting the InDel molecular marker according to claim 1, characterized in that: It includes an upstream primer CmFpt-F shown in SEQ ID NO:1 and a downstream primer CmFpt-R shown in SEQ ID NO:

2.

3. A kit for detecting the InDel molecular marker according to claim 1, characterized in that: It includes an upstream primer CmFpt-F shown in SEQ ID NO:1 and a downstream primer CmFpt-R shown in SEQ ID NO:

2.

4. Use of the InDel molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in melon molecular breeding; wherein: The application is to identify or assist in identifying the melon flesh thickness phenotype.

5. A method for identifying the melon flesh thickness trait using the InDel molecular marker according to claim 1 or the primer pair according to claim 2 or the kit according to claim 3, comprising PCR amplification of the upstream primer CmFpt-F shown in SEQ ID NO: 1 and the downstream primer CmFpt-R shown in SEQ ID NO: 1, and combining electrophoresis detection and / or gene sequencing to determine the genotype information of the InDel molecular marker in controlling the melon flesh thickness trait according to the size of the PCR amplification product; wherein, When the length of the PCR amplification product is 100 bp, the variety to be tested is a homozygous thin-flesh trait; when the length of the PCR amplification product is 96 bp, the variety to be tested is a homozygous thick-flesh trait.

6. The method according to claim 5, characterized in that Includes steps: (1) Extracting genomic DNA from the melon to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification on the template using the upstream primer CmFpt-F and the downstream primer CmFpt-R to obtain the PCR amplification product, and performing electrophoresis detection and / or gene sequencing on the PCR amplification product; (3) Making a determination based on the electrophoresis bands and / or gene sequencing results detected in step (2).

Images