Oxidase mutant, DNA molecule, expression vector, host cell and application thereof, and preparation method of 3-hydroxybuxinol

Abstract

The invention discloses an oxidase mutant, a DNA molecule, an expression vector, a host cell and an application thereof, and a method for preparing 3-hydroxybuxinol. The oxidase mutant can prepare 3-hydroxybuxinol, and its amino acid sequence is a sequence of wild-type cytochrome P450 BM3 The monooxygenase is obtained by mutation of the amino acid sequence; the mutation includes one of L75A, L75F, L75G, L75I, L75M, L75S, L75T, L75V and one of F87A, F87G, F87I, F87L, F87M, F87S, F87T, F87V, and is not L75F and F87M, and is not L75I and F87L; or includes one of L75A, L75F, L75G, L75M, L75S, L75T, L75V, F87A, F87G, F87M, F87S, F87T, F87V.

Description

Technical Field

[0001] The invention relates to the technical field of biocatalytic enzymes, in particular to an oxidase mutant, a DNA molecule, an expression vector, a host cell and applications thereof, and a method for preparing 3-hydroxybutyric acid. Background Art

[0002] Sesquiterpenes with a bismuthane skeleton and terpenes with a bismuthane skeleton as a synthetic unit and their derivatives are important natural products with rich biological activities. They are distributed in higher plants, fungi, marine microorganisms and mosses. It was first isolated from the bark of the tree Drimys Winteri Fors in 1948 and has since been repeatedly used as a chiral synthetic unit to synthesize bismuth-type compounds. It has 11β-hydroxysteroid dehydrogenase (11β-HSD) inhibitory activity. The half-inhibitory concentration (IC50) for the two isoenzymes 11β-HSD1 and 11β-HSD2 of human origin is 8.0 mg / mL and 220.0 mg / mL, respectively, and the IC50 for the two isoenzymes 11β-HSD1 and 11β-HSD2 of mouse origin is 19.4 mg / mL and 330.3 mg / mL, respectively (Sesquiterpenes from Cultures of the Basidiomycete Clitocybe conglobate and Their 11β-Hydroxysteroid Dehydrogenase Inhibitory Activity, Chem. Pharm. Bull. 2009, 57 (4) 433-435). In addition, some more complex compounds with biological activity of the terpenoid skeleton with hydroxylation of carbon 3 are also widely present, for example, myrothecisins A It has been shown to have anti-tumor and immunomodulatory effects; arigsugacin F Chermesins A has been shown to be a potent acetylcholinesterase inhibitor that can be used to treat Alzheimer's disease. It has been confirmed to have good antibacterial activity against three human pathogens, Candida albicans, Escherichia coli, Micrococcus luteus and an aquatic bacterium, Vibrio alginolyticus. Among them, 3-hydroxybuxinol can be used as a key synthetic precursor for the synthesis of natural products of buxinane. Therefore, it is very necessary to develop a method for the efficient synthesis of 3-hydroxybuxinol.

[0003] Several methods have been developed to synthesize 3-hydroxybuxinol. 3-Hydroxybuxinol can be isolated and extracted from the culture fluid of some large fungi, such as 3-hydroxybuxinol (Sesquiterpenoids from the edible mushroom Pleurotus nebrodensis, Chem. Nat. Compd. 2022, 58, 37-39) isolated and extracted from the culture fluid of Pleurotus nebrodensis. Selective hydroxylation of buxinol by fungal fermentation is also a means. For example, in 1992, Gérard Aranda's research group used buxinol as raw material, and obtained 3-hydroxybuxinol with 7% and 60% isolation yields respectively through Mucor biotransformation for 26-28h and Rhizopus biotransformation for 29h. (Microbiologicalhydroxylation in the drimane series, Tetrahedron Lett. 1992, 33, 7845-7848). Starting from relatively large molecules containing chiral units with hydroxylation at position 3 that are easily commercially available or easily separated and extracted, a synthetic unit with hydroxylation at position 3 similar to 3-hydroxytriterpene alcohol can be obtained by chemical reaction and bond breaking. In 2003, André's Garc1'a-Granados' research group started from oleanolic acid and obtained 3-hydroxytriterpene alcohol with double bonds at carbons 8 and 9 with a yield of 24% through 7 steps of chemical transformation (Degradation of triterpenic compounds from olive-pressing residues. Synthesis of trans-decalin type chiral synthons, Tetrahedron Lett. 2003, 44, 6673-6677). Among the currently known chemical semi-synthetic methods, the earliest one was the biomimetic synthesis strategy of polyene cyclization, followed by boron trifluoride etherate-catalyzed cyclization to synthesize 3-hydroxybushimol. In 1963, Van Tamelen's research group obtained 3-hydroxybushimol through a five-step chemical reaction from a polyene chain structure containing an acetyl group (trans, trans-farnesyl acetate) (The Biogenetically Patterned in vitro Oxidation-Cyclization of Farnesyl Acetate, J.Am.Chem.Soc.1963, 85, 20, 3295-3296).In addition, there are some other synthetic methods for the synthesis of squalane-type terpenes containing a hydroxylation at the 3-position. For example, starting from the chiral element, sclareolide has the same trans-decalin ring structure and chiral center as fungal terpenoid natural products, and is a suitable starting material for the synthesis of this type of natural product.

[0004] However, the above methods have some disadvantages: (1) The practicality of isolating 3-hydroxybuminol from natural sources is low, because the content of 3-hydroxybuminol in natural sources is low and it is difficult to separate; (2) The process of culturing fungi to oxidize buminol to obtain 3-hydroxybuminol is long, the culture conditions are complex, and it is difficult to achieve large-scale production. In addition, the key oxidase gene is unclear, which is not conducive to enzyme engineering and optimization; (3) Starting from a relatively large molecule containing a chiral unit with hydroxylation at the 3rd position, 3-hydroxybuminol cannot be directly obtained by chemical reaction bond breaking. Only its similar structure has been obtained in the studies reported so far, and other chemical reactions are required to obtain the exact same structure; (4) The stereoselectivity of the biomimetic synthesis strategy using chemical means is not ideal, and functional groups such as chiral epoxy need to be introduced, which increases unnecessary synthesis steps and leads to low final yield; (5) The synthesis of heteroterpenes by the chiral meta-strategy needs to start from other similar terpenoid compounds, and it is necessary to undergo multiple steps of functional group transformation to obtain the key reaction precursor. The synthetic route is lengthy, and it is challenging to hydroxylate the C3 position of clarylidene by chemical means. These factors limit the synthesis and biological activity research of succinanthenes natural products with a hydroxyl group at the 3-position.

[0005] Therefore, it is of great significance to develop a synthesis strategy for 3-hydroxybutyric acid with simpler reaction conditions, more efficient reactions, and higher selectivity. Summary of the invention

[0006] Based on the above-mentioned deficiencies of the prior art, the purpose of the present invention is to provide an oxidase mutant, a DNA molecule, an expression vector, a host cell and their application and a method for preparing 3-hydroxybuxanol, aiming to provide a synthesis strategy for 3-hydroxybuxanol with simpler reaction conditions and more efficient reaction.

[0007] The technical solution of the present invention is as follows:

[0008] In a first aspect of the present invention, there is provided an oxidase mutant, wherein the amino acid sequence of the oxidase mutant is a sequence of a wild-type cytochrome P450 BM3 Obtained by mutation of the amino acid sequence of monooxygenase;

[0009] The mutation includes one of L75A, L75F, L75G, L75I, L75M, L75S, L75T, L75V and one of F87A, F87G, F87I, F87L, F87M, F87S, F87T, F87V, and the mutation is not L75F and F87M, and the mutation is not L75I and F87L;

[0010] Or the mutation includes one of L75A, L75F, L75G, L75M, L75S, L75T, L75V, F87A, F87G, F87M, F87S, F87T, and F87V.

[0011] The second aspect of the present invention provides a DNA molecule, wherein the DNA molecule encodes the oxidase mutant of the present invention as described above.

[0012] The third aspect of the present invention provides an expression vector, wherein the expression vector comprises the DNA molecule of the present invention as described above.

[0013] The fourth aspect of the present invention provides a host cell, wherein the host cell comprises the expression vector of the present invention as described above.

[0014] Optionally, the host cell is an Escherichia coli cell.

[0015] The fifth aspect of the present invention provides an application of the oxidase mutant, the DNA molecule, the expression vector or the host cell as described above in the preparation of 3-hydroxybuminol.

[0016] The sixth aspect of the present invention provides a method for preparing 3-hydroxybushimol, wherein the method for preparing 3-hydroxybushimol comprises the steps of:

[0017] Nicotinamide adenine dinucleotide phosphate, glucose, buprenorphine, glucose dehydrogenase and the oxidase mutant of the present invention as described above are mixed and reacted to obtain the 3-hydroxybuprenorphine.

[0018] Optionally, the preparation method of 3-hydroxybuxanol specifically comprises the steps of:

[0019] The expression vector of the present invention and the expression vector containing the glucose dehydrogenase gene are transferred into Escherichia coli, cultured, and then the cells are collected;

[0020] The bacterial cells are mixed with a buffer solution, vortexed to resuspend, lysed and broken by a homogenizer, and centrifuged to obtain a supernatant;

[0021] The supernatant is mixed with nicotinamide adenine dinucleotide phosphate, glucose and buprenorphine, and reacted to obtain the 3-hydroxybuprenorphine.

[0022] The seventh aspect of the present invention provides another method for preparing 3-hydroxybushimol, wherein the method for preparing 3-hydroxybushimol comprises the steps of:

[0023] Nicotinamide adenine dinucleotide phosphate, glucose, buprenorphine, glucose dehydrogenase and the host cell of the present invention are mixed and reacted to obtain the 3-hydroxybuprenorphine.

[0024] Optionally, the preparation method of 3-hydroxybuxanol specifically comprises the steps of:

[0025] The expression vector of the present invention as described above and the expression vector containing the glucose dehydrogenase gene are transferred into Escherichia coli, cultured, and then a single clone is picked and placed in a culture medium containing kanamycin and ampicillin. After growth, the single clone is mixed with nicotinamide adenine dinucleotide phosphate, glucose and succinimidyl alcohol, and reacted to obtain the 3-hydroxysuccinimidyl alcohol.

[0026] Beneficial effects: The oxidase mutant provided by the present invention can be efficiently expressed in Escherichia coli in a soluble form. In the presence of glucose dehydrogenase, glucose and nicotinamide adenine dinucleotide phosphate, the oxidase mutant uses buxinol as a reaction substrate and realizes selective and efficient oxidation of the carbon 3 of buxinol through a one-step reaction, that is, selective and efficient oxidation from buxinol to 3-hydroxybuxinol in one step. The present invention provides a new strategy for synthesizing 3-hydroxybuxinol, and also provides an important lead compound resource for enriching the terpene natural product compound library, especially the heteroterpene natural products. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the overall flow chart of the scheme in the embodiment.

[0028] Figure 2 P450 in Example 3 BM3 (F87A) GC-MS detection results of the catalytic oxidation reaction of buxinol.

[0029] Figure 3 The mass spectrum of 3-hydroxybuxanol prepared in Example 3 is shown in FIG.

[0030] Figure 4 The 3-hydroxy-buxanol prepared in Example 3 1 Figure H.

[0031] Figure 5 The 3-hydroxy-buxanol prepared in Example 3 13 Figure C.

[0032] Figure 6 This is the Dept diagram of 3-hydroxybuxanol prepared in Example 3.

[0033] Figure 7 This is the Cosy diagram of 3-hydroxybuxanol prepared in Example 3.

[0034] Figure 8 This is the HSQC chart of 3-hydroxybuminol prepared in Example 3.

[0035] Fig. 9 This is the HMBC chart of 3-hydroxybuxanol prepared in Example 3.

[0036] Fig.10 This is the Noesy diagram of 3-hydroxybuxanol prepared in Example 3.

[0037] Fig.11 The crystallographic X-ray diffraction pattern of 3-hydroxybuminol prepared in Example 3 is shown in FIG.

[0038] Fig.12 The molecule of buxinol in Example 4 is docked to P450 BM3 (F87A) State diagram of the active pocket.

[0039] Fig.13 For the screening of P450 in Example 6 BM3 Figure 2. Mutation library results.

[0040] Fig.14 P450 was verified for whole cell and crude enzyme in Example 6 BM3 (L75A / F87I) and P450 BM3 (L75G / F87I) Activity and selectivity results.

[0041] Fig.15 This is a diagram showing the results of optimizing the reaction conditions in Example 7. DETAILED DESCRIPTION

[0042] The present invention provides an oxidase mutant, a DNA molecule, an expression vector, a host cell and its application and a method for preparing 3-hydroxybutyric acid. In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0043] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0044] The present invention provides an oxidase mutant, wherein the amino acid sequence of the oxidase mutant is a sequence of a wild-type cytochrome P450 BM3 Obtained by mutation of the amino acid sequence of monooxygenase (the first amino acid methionine of the enzyme is not included in the amino acid numbering);

[0045] The mutation includes one of L75A, L75F, L75G, L75I, L75M, L75S, L75T, L75V and one of F87A, F87G, F87I, F87L, F87M, F87S, F87T, F87V, and the mutation is not L75F and F87M, and the mutation is not L75I and F87L;

[0046] Or the mutation includes one of L75A, L75F, L75G, L75M, L75S, L75T, L75V, F87A, F87G, F87M, F87S, F87T, and F87V.

[0047] That is to say, in this embodiment, the mutation can be a single site mutation (single site mutation) and a double site mutation (two site mutations). The single site mutation can be L75A, L75F, L75G, L75M, L75S, L75T, L75V, F87A, F87G, F87M, F87S, F87T or F87V. The double-site mutation can be one of L75A, L75F, L75G, L75I, L75M, L75S, L75T, L75V and one of F87A, F87G, F87I, F87L, F87M, F87S, F87T, F87V, for example, the double-site mutation is L75A and F87A, L75A and F87F, L75A and F87G, L75A and F87I, L75G and F87I, etc., but the double-site mutation is not L75F and F87M, and the double-site mutation is not L75I and F87L.

[0048] The meanings of these mutation sites, such as L75A, F87I, etc., are the same as those generally understood by technicians in the relevant field. L75A means that the amino acid at position 75 mutates from L (leucine) to A (alanine); F87I means that the amino acid at position 87 mutates from F (phenylalanine) to I (isoleucine), and the meanings of other mutation sites are similar.

[0049] The oxidase mutant provided by the present invention can be efficiently expressed in Escherichia coli in a soluble form and can be reacted under simple and easy-to-operate reaction conditions. The oxidase mutant is active in glucose dehydrogenase, glucose and nicotinamide adenine dinucleotide phosphate (NADP + , i.e., coenzyme II, which is the oxidized form of reduced coenzyme II (NADPH)), using buxinol as a reaction substrate, a selective and efficient oxidation of the carbon No. 3 of buxinol is achieved through a one-step reaction, that is, a selective and efficient oxidation of buxinol to 3-hydroxybuxinol in one step can be achieved, which can solve the problem that the selective and efficient oxidation of the carbon No. 3 of buxinol cannot be achieved directly through a one-step oxidation reaction. The present invention provides a new strategy for the synthesis of 3-hydroxybuxinol, and also provides an important lead compound resource for enriching the terpene natural product compound library, especially the miscellaneous terpene natural products. In addition, the strategy of the oxidase mutant catalyzing the selective oxidation reaction of the inactive CH bond of the terpene skeleton in the present invention can also be applied to the divergent synthesis and post-stage modification of terpene natural products and their analogs with similar structures. This strategy provides a new idea for the synthesis of natural products with medicinal value.

[0050] An embodiment of the present invention further provides a DNA molecule, wherein the DNA molecule encodes the oxidase mutant described in the embodiment of the present invention.

[0051] An embodiment of the present invention further provides an expression vector (such as a plasmid, etc.), wherein the expression vector comprises the DNA molecule of the present invention as described above.

[0052] An embodiment of the present invention further provides a host cell, wherein the host cell comprises the expression vector of the present invention as described above.

[0053] Optionally, the host cell is an Escherichia coli cell.

[0054] The present invention also provides a use of the oxidase mutant, the DNA molecule, the expression vector or the host cell described above in the preparation of 3-hydroxybutyric acid.

[0055] The present invention also provides an application of an oxidase mutant in the preparation of 3-hydroxybutyric acid, wherein the amino acid sequence of the oxidase mutant is a sequence of a wild-type cytochrome P450 BM3 The monooxygenase is obtained by mutation of the amino acid sequence, wherein the mutation includes one of L75I, F87I and F87L, or the mutation is L75I and F87L.

[0056] The present invention also provides two methods for preparing 3-hydroxybuminol. One method (crude enzyme catalysis) comprises the following steps:

[0057] NADP + , glucose, buburtol, glucose dehydrogenase and the oxidase mutant of the present invention as described above are mixed and reacted to obtain the 3-hydroxybuburtol.

[0058] In some embodiments, the preparation method of 3-hydroxybuminol specifically comprises the steps of:

[0059] The expression vector (containing the oxidase mutant gene) and the expression vector containing the glucose dehydrogenase gene of the present invention are transferred into Escherichia coli, cultured, and then the cells are collected;

[0060] The bacterial cells are mixed with a buffer solution, vortexed to resuspend, lysed and broken by a homogenizer, and centrifuged to obtain a supernatant;

[0061] The supernatant was mixed with NADP + , glucose and buxinol are mixed and reacted to obtain the 3-hydroxybuxinol.

[0062] In this embodiment, the oxidase mutant can be efficiently expressed in Escherichia coli in a soluble form. Glucose dehydrogenase is simultaneously transferred into Escherichia coli to provide the oxidase mutant with NADPH required for its oxidative energy supply. The supernatant of the Escherichia coli lysate after expressing the above two proteins is used, and glucose and NADP are added simultaneously. + and buxinol, and can achieve a one-step selective and efficient oxidation of buxinol to 3-hydroxybuxinol.

[0063] Another preparation method (whole cell catalysis) comprises the steps of:

[0064] NADP + , glucose, buburtol, glucose dehydrogenase and the host cells as described above in the embodiment of the present invention are mixed and reacted to obtain the 3-hydroxybuburtol.

[0065] In the preparation method, the host cell can express an oxidase mutant, and the oxidase mutant is expressed in NADP + In the presence of glucose, succinol and glucose dehydrogenase, selective and efficient oxidation of succinol to 3-hydroxysuccinol can be achieved in one step.

[0066] In some embodiments, the preparation method of 3-hydroxybuminol specifically comprises the steps of:

[0067] The expression vector (containing the oxidase mutant gene) and the expression vector containing the glucose dehydrogenase gene of the present invention are transferred into Escherichia coli, cultured, and then single clones are picked and placed in a culture medium containing kanamycin and ampicillin. After growth, the single clones are combined with NADP+ , glucose and buxinol are mixed and reacted to obtain the 3-hydroxybuxinol.

[0068] After E. coli expressed the oxidase mutant and glucose dehydrogenase, glucose, NADP + and buxinol, and can achieve a one-step selective and efficient oxidation of buxinol to 3-hydroxybuxinol.

[0069] The present invention will be further described below by means of specific examples.

[0070] The meanings of some symbols in the following embodiments:

[0071] P450 BM3 :The wild-type cytochrome P450 from Bacillus megaterium BM3 Monooxygenases are referred to as P450 BM3 ;

[0072] P450 BM3 (F87A) and P450 BM3 (F87A) gene: wild-type cytochrome P450 from Bacillus megaterium BM3 The oxidase mutant obtained by mutating the amino acid position 87 of the monooxygenase from phenylalanine to alanine is referred to as P450 BM3 (F87A), will encode P450 BM3 The gene (F87A) is referred to as P450 BM3 (F87A) gene;

[0073] GDH and GDH gene: Glucose dehydrogenase is referred to as GDH, and the gene encoding the glucose dehydrogenase is referred to as GDH gene;

[0074] E.coli: Escherichia coli;

[0075] Kpi: potassium phosphate buffer with pH = 7.4;

[0076] TX-100: polyethylene glycol octylphenyl ether;

[0077] DNAse I: deoxyribonuclease I;

[0078] OD 600 : The absorbance of the solution at a wavelength of 600nm. The absorbance of bacteria is used to measure the concentration of the bacterial culture solution;

[0079] NADPH (reduced coenzyme II): reduced nicotinamide adenine dinucleotide phosphate;

[0080] DMF: N,N-dimethylformamide;

[0081] Vol%: volume percentage;

[0082] σ in the coordinates of the figures: chemical shift;

[0083] Dept (distortion-free polarization transfer technology): a detection technology mainly used to distinguish primary carbon, secondary carbon, tertiary carbon and quaternary carbon in carbon spectra;

[0084] Noesy: Long-range hydrogen-hydrogen correlation spectroscopy;

[0085] Cosy: Hydrogen-Hydrogen correlation spectrum;

[0086] HSQC: heteronuclear single quantum correlation;

[0087] HMBC( 1 Heteronuclear multi-carbon correlation spectrum of H): 1 H nuclei and long-range coupling 13 C nucleus is associated, usually 2-3 bonds have more coupling information between protons and carbon.

[0088] like Figure 1 As shown, the present invention first synthesizes P450 BM3 (F87A) gene and GDH gene were transferred to the expression vector, and then P450 BM3 (F87A) and GDH, followed by a preliminary reaction with buxinol as substrate to identify the product structure and determine the P450 BM3 (F87A) can be used in appropriate GDH, NADP + and glucose concentrations, catalyzing buxinol to 3-hydroxybuxinol. Then, by molecular docking buxinol to P450 BM3 (F87A) active pocket, for pET28a-P450 BM3 (F87A) recombinant plasmid for site-directed mutagenesis and construction of P450 BM3 Mutation library, screening of P450 by in vitro whole-bacteria catalytic assay BM3 The mutant library was used to optimize the reaction conditions and finally prepare gram-level 3-hydroxybuxinol. See Examples 1 to 8 for details.

[0089] Example 1

[0090] Synthetic P450 BM3 (F87A) gene and GDH gene into the expression vector, that is, to prepare a vector containing P450 BM3 The recombinant plasmid containing the (F87A) gene and the recombinant plasmid containing the GDH gene specifically comprises the following steps:

[0091] Targeting P450 from Bacillus megaterium BM3Gene, without changing the amino acid sequence encoded by the original gene (Uniprot number is P14779), selected P450 BM3 The F87 position in the active pocket, which increases steric hindrance, is synthesized as alanine, resulting in the BM3 The 5' end of the (F87A) gene was added with a 6×His tag (6×histidine tag; a protein tag with 6 histidines linked together, used to separate and purify proteins) and a nucleotide sequence of the thrombin site, the specific sequence being 5'-atgggcagcagccatcatcatcatcatcacagcggcctggtgccgcgcggcagccat, and the P450 BM3 The codons of the (F87A) gene were optimized and the G+C content was adjusted. The optimized gene sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. (the optimized P450 BM3 The nucleotide sequence of the (F87A) gene is shown in SEQ ID NO: 1, P450 BM3 The amino acid sequence of (F87A) is shown in SEQ ID NO: 2), and the optimized P450 BM3 The (F87A) gene was cloned into the pET28a plasmid vector to obtain the recombinant plasmid pET28a-P450 BM3 (F87A).

[0092] For the GDH gene (the nucleotide sequence of the GDH gene is shown in SEQ ID NO: 3, and the amino acid sequence of GDH is shown in SEQ ID NO: 4), the gene sequence was provided by the research group of Ouyang Pingkai of Nanjing University of Technology, and the GDH gene was cloned into the pET22b plasmid vector to obtain the template plasmid pET22b-GDH. GDH was amplified using primers GDH-F and GDH-R (see Table 1), and the template plasmid pET22b-GDH was digested with XhoI / NdeI, and the nucleotide sequence of the 6×His tag was added to the 3' end by the homologous recombination method, and the specific sequence was 5'-ctcgagcaccaccaccaccaccactga to obtain the recombinant plasmid pET22b-GDH-His.

[0093] Table 1. Nucleotide sequences of primers GDH-F and GDH-R

[0094] Primer name Nucleotide sequence (5'-3') GDH-F gtggtggtggtggtggtgctcgagGCCTCTTCCTGCTTGGAAAGAAG GDH-R ctttaagaaggagatatacatatgTATACAGATTTAAAAGATAAAGTAG

[0095] Example 2 Preparation and purification of P450 BM3 (F87A) and GDH

[0096] The recombinant plasmid pET28a-P450 obtained in Example 1 was BM3(F87A) was transformed into E. coli BL21 (DE3) cells, and the cells were cultured in P450 (cytochrome P450 monooxygenase) expression medium according to previous reports (Regio-and stereoselectivity of P450-catalysedhydroxylation of steroids, Nat. Chem. 2011, 3, 738-743). After the expression was completed, the cells were centrifuged at 6000 rpm and 20°C for 15 min, the supernatant was discarded, the cells were collected, and stored in a -80°C refrigerator.

[0097] The collected cells were lysed. When lysing the cells, 50 mL of lysis buffer (containing 50 mM Kpi, 0.1 M KCl, 5 mM MgCl2, 5 mM imidazole, 2 mM phenylmethylsulfonyl fluoride, 5 Vol% glycerol, 0.05 Vol% TX-100, 20 mg / L DNAse I and 1 mg / mL lysozyme) was added to each 1 L of initial culture to thaw, and the cells were resuspended by vortexing. The cells were then lysed by a high-pressure homogenizer, centrifuged at 18000 rpm and 4°C for 30 min, the precipitate was discarded, and the brown-red supernatant was collected.

[0098] Purification of P450 by affinity chromatography BM3 (F87A), the specific method is to combine the obtained brown-red supernatant with 15mL nickel filler pre-equilibrated with washing buffer (containing 50mM Kpi, 0.1M KCl, 5mM imidazole and 5Vol% glycerol) in a 4°C refrigerator for 30min. Non-specifically bound proteins were washed from the nickel column with 3 column volumes of washing buffer, and bound proteins were eluted with 3 column volumes of elution buffer A (containing 50mM Kpi, 0.1M KCl, 100mM imidazole and 5Vol% glycerol) and 1 column volume of elution buffer B (containing 50mM Kpi, 0.1M KCl, 250mM imidazole and 5% glycerol). The purified protein was collected, the buffer was replaced with storage buffer (containing 50mM KPi, 100mM KCl and 5Vol% glycerol), and concentrated by ultrafiltration. P450 was measured with a micro-spectrophotometer (Nanodrop). BM3 The concentration of (F87A) was then stored in a -80°C freezer.

[0099] The recombinant plasmid pET22b-GDH-His was transformed into E. coli BL21 (DE3) cells and cultured overnight in 20 mL of LB liquid medium (containing 10 g / L tryptone, 5 g / L yeast extract and 10 g / L sodium chloride) containing 100 μg / mL ampicillin. The culture medium was then inoculated into 1 L of LB liquid medium (containing 10 g / L tryptone, 5 g / L yeast extract and 10 g / L sodium chloride) containing 100 μg / mL ampicillin at a ratio of 1:50 (volume ratio) and cultured at 37°C and 220 rpm. When the E. coli grew to OD 600 When the pH reaches 0.8-0.9, the culture medium is placed in an ice bath to cool the temperature to 4°C, and isopropyl-β-D-thiogalactoside (IPTG, inducer) is added at a final concentration of 0.1 mM, and the expression is induced at 25°C and 180 rpm for 16 hours. After the expression is completed, centrifuge at 6000 rpm and 20°C for 15 minutes, discard the supernatant, collect the bacteria, and store them in a -80°C refrigerator.

[0100] Glucose dehydrogenase was purified by affinity chromatography. The specific purification steps were the same as those of P450 BM3 The purification steps for (F87A) were the same.

[0101] Example 3 Preliminary reaction test using buxinol as substrate

[0102] A small amount of in vitro enzyme catalysis experiment was conducted using fresh pure enzymes and buxinol as substrate for the initial reaction test, as follows:

[0103] Prepare the reaction solution, which contains 100mM Kpi, 100mM glucose, 1mM NADP + , 10μM P450 BM3 (F87A) and 45 μM GDH.

[0104] 100 mg of buxinol dissolved in 4.5 mL of DMF was added to the reaction solution, the total reaction volume was 225 mL, and the final concentration of buxinol was 2 mM. After reacting at 25 ° C and 200 rpm for 32 hours, the reaction solution was extracted 3 times with an equal volume of ethyl acetate. The organic phase was dried over anhydrous Na2SO4 and concentrated by rotary evaporation. The product was purified by silica gel column chromatography, and the eluent was a mixture of petroleum ether and ethyl acetate (volume ratio of 5:2) to obtain 65.4 mg of product.

[0105] 100 μL of the reaction solution after 32 h of reaction at 25 °C and 200 rpm was taken, and 200 μL of ethyl acetate was added for extraction. Then 1 μL was injected into a gas chromatography-mass spectrometer (GC-MS). The retention time (rt) of the product was 14.99 min (see Figure 2 ) and obtained the mass spectrum of the product (see Figure 3, where m / z is the number of protons / charge).

[0106] Wherein, this embodiment uses GC-MS to detect the product. The GCMS-QP2020NX (wherein the GC system uses the GC-2030 series) produced by Shimadzu Corporation of Japan is used, and the gas chromatograph is equipped with a chromatographic column model of SH-Rtx-5MS (30m×0.25mm×0.25μm). High-purity helium is used as the carrier gas, and the injection is carried out in a constant linear velocity mode (40cm / s) and a non-divided flow mode. The injection volume is 1μL and the injection port temperature is 250°C. Heating program: the starting temperature is set to 65°C, and the temperature is increased to 160°C at a heating rate of 25°C / min, and maintained for 1min; the temperature is increased to 230°C at a heating rate of 6°C / min, and maintained for 2min; finally, the temperature is increased to 310°C at a heating rate of 50°C / min, and maintained for 2min. The GC is coupled to a mass-selective detector, and the product peak is determined by comparing the mass spectrum and the retention time (rt).

[0107] In order to identify the structure of the product, the product was subjected to a series of tests, and the resulting H NMR spectrum was 1 H Figure Figure 4 ), NMR carbon spectrum 13 Figure C Figure 5 )、Dept map( Figure 6 )、Cosy graph( Figure 7 )、HSQC diagram( Figure 8 )、HMB C diagram( Fig. 9 )、Noesy diagram( Fig.10 ) and crystallographic X-ray diffraction patterns ( Fig.11 , the gray balls represent C elements, the black balls represent O elements, and the white balls represent H elements) confirm that the structure of the product is 3-hydroxybuxinol

[0108] Other information of the obtained 3-hydroxybutyric acid is as follows:

[0109] Physical state: white powder;

[0110] Thin layer chromatography (TLC): Ratio R f =0.2 (volume ratio of petroleum ether to ethyl acetate 3:1, phosphomolybdic acid color development);

[0111] Melting point: 130-133°C;

[0112] H NMR data 1H NMR (400MHz, CDCl3): δ5.54 (s, 1H), 3.85 (dd, J=11.3, 3.6Hz, 1H), 3.73 (dd, J=11.3, 5.2Hz, 1H), 3.29-3.21 (m, 1H), 2.00 (s, 3H), 1.84 (s, 1H), 1.78 (s, 3H), 1.70-1.56 (m, 3H), 1.29 (t, J=15.4Hz, 3H), 1.20 (dd, J=11.0, 5.7Hz, 1H), 0.99 (s, 3H), 0.87 (s, 3H), 0.86 (s, 3H);

[0113] C NMR data 13 C NMR (101MHz, CDCl3): δ132.81, 123.89, 78.94, 60.74, 57.06, 49.40, 38.65, 37.94, 35.89, 28.09, 27.30, 23.25, 21.78, 15.35, 14.93;

[0114] High resolution mass spectrometry (HRMS) results: C 15 H 26 O2[M+Na] + , the calculated value is 261.1830 and the actual value is 261.1826.

[0115] Example 4 Molecular docking of buxinol to P450 BM3 (F87A) Active pocket

[0116] With P450 BM3 (PDB: 6K24, where PDB is the protein structure database website and 6K24 is one of the protein structures) was used as a template, and the phenylalanine at position 87 was mutated to alanine using Pymol software. The mutated structure was used as the receptor, and the energy of the buxinol molecule was minimized using Chem3D software. The energy-minimized structure was used as the ligand, and the 87th amino acid alanine was used as the center of the molecular docking box. Molecular docking was performed using Vina software, and the 9 buxinols and P450 BM3 (F87A) binding state. According to the oxidation site of the product 3-hydroxybuxinol is carbon 3, the binding state of carbon 3 closest to the iron atom is selected ( Fig.12 ) were used for interaction analysis and it was speculated that the 75th and 87th amino acids were the key sites affecting its oxidation.

[0117] Example 5 Construction of P450 BM3 Mutation library

[0118] In view of the hydrophobicity of buxinol, nine amino acids, including alanine (A), phenylalanine (F), glycine (G), isoleucine (I), leucine (L), methionine (M), serine (S), threonine (T), and valine (V), were selected as mutation targets, and a combined mutation of amino acids at positions 75 and 87 was performed. BM3 (F87A) was used for site-directed mutagenesis to construct pET28a-P450 BM3 The mutant recombinant plasmids (L75A / F / G / I / L / M / S / T / V×F87A / F / G / I / L / M / S / T / V) were combined (the 75 site was mutated to one of A, F, G, I, L, M, S, T, V, and the 87 site was mutated to one of A, F, G, I, L, M, S, T, V), that is, 81 mutant recombinant plasmids, to construct a mutant library containing 81 mutants. These 81 mutants were constructed separately by the Quick-change PCR (polymerase chain reaction) method, each mutant had a separate primer (see Table 2), the annealing temperature was 72°C, the extension time was 3 minutes and 10 seconds, and the number of cycles was 25.

[0119] Table 2. Primers used for 81 mutants

[0120]

[0121]

[0122]

[0123] 81 pET28a-P450 BM3 The mutant recombinant plasmid was transformed into E. coli DH5α cells, and the plasmid after correct sequencing was stored in a -20°C refrigerator.

[0124] Example 6 Screening of P450 BM3 Mutation library

[0125] Co-transfected with pET28a-P450 BM3The mutant recombinant plasmid and the recombinant plasmid pET22b-GDH were added to Escherichia coli BL21 (DE 3) cells and cultured overnight at 37°C on a plate. Three single clones were picked from each plate and inoculated into 96 deep-well plates, and each well was filled with 500 μL of LB liquid medium (containing 10 g / L tryptone, 5 g / L yeast extract and 10 g / L sodium chloride) containing 50 μg / mL kanamycin and 100 μg / mL ampicillin. Grow at 37°C and 500 rpm for 16 hours. The expression medium and the method of collecting bacteria were referred to the previous report (The synthesis of drimane sesquiterpenoids, Nat. Prod. Rep. 1991, 8, 319-337), and the expression conditions were 25°C, 180 rpm, and 8 hours.

[0126] Add 100 mM Kpi, 100 mM glucose, 1 mM NADP to the wells. + 100 μL of the reaction solution containing 1 mM bupropion (the mother solution concentration is 50 mM, dissolved in DMF) was reacted at 25°C and 200 rpm for 16 h. After the reaction, 200 μL of ethyl acetate was added to terminate the reaction and vortex extraction was performed. The mixture was centrifuged at 4000 rpm for 5 min, and 100 μL of the upper organic phase was transferred to a sample bottle and then analyzed by GC-MS. The results are as follows: Fig.13 As shown, the results show that: except for P450 BM3 (L75F / F87M)(P450 BM3 The mutant obtained by simultaneous mutation of L75 to F and F87 to M was denoted as P450 BM3 (L75F / F87M), similar expressions in the following text all have similar meanings), and the remaining 80 mutants can be used to prepare 3-hydroxybuminol. BM3 (L75A / F87I) (whose nucleotide sequence is shown in SEQ ID NO: 5 and its amino acid sequence is shown in SEQ ID NO: 6) and P450 BM3 The two oxidase mutants (L75G / F87I) showed the best activity and selectivity, were re-cultivated in 96-deep-well plates, and were validated by both whole-cell catalysis and crude enzyme catalysis, with three parallel experiments per group.

[0127] The whole-cell catalysis experiment was the same as above.

[0128] The crude enzyme solution is obtained by ultrasonic lysis of the collected bacteria from the wells. The cell concentration measured by UV spectrophotometer is about 14OD / mL. 87μL 100mM Kpi is added, and the cells are ultrasonically treated for 15min (power is 30%, open for 1s, close for 3s) to obtain lysate. The lysate is centrifuged at 25℃ and 15000rpm for 2min, and the brown-red supernatant is transferred to a new 2mL EP tube, which is the crude enzyme solution; then glucose with a final concentration of 100mM and 1mM NADP are added. + and 1mM buxinol (mother solution concentration is 50mM, dissolved in DMF), react at 25°C, 200rpm for 16h, add 200μL ethyl acetate to terminate the reaction, vortex extraction; centrifuge the mixture at 15000rpm for 1min, take 100μL of the upper organic phase and transfer to a sample bottle, and then perform GC-MS analysis. The results are as follows Fig.14 shown.

[0129] Example 7 Optimization of reaction conditions

[0130] To screen for suitable cosolvents and their concentrations, 3 mM bupropion and DMF (2 Vol%, 3 Vol%, 4 Vol%, 5 Vol%, or 6 Vol%) were added to the reaction mixture containing 28 OD / mL P450 BM3 (L75A / F87I) crude enzyme solution (100 mM Kpi was added during lysis), 100 mM glucose and 1 mM NADP + The reaction was carried out at 25°C and 200 rpm for 16 h. The extraction and analysis methods after the reaction were the same as those in Example 6. The results are shown in FIG. Fig.15 As shown, the optimal concentration of DMF is 5%.

[0131] Example 8 Preparation of gram-grade 3-hydroxybutyric acid

[0132] The recombinant plasmid pET28a-P450 BM3 (L75A / F87I) and pET22b-GDH were co-transfected into E. coli BL21(DE3) cells and cultured in 13L P450 expression medium at 37°C and 220 rpm until OD 600Reach 0.8-0.9. Cool the culture medium to 4°C in an ice bath, and add IPTG at a final concentration of 100μM. After expressing for 16 hours at 25°C and 180rpm, the cell concentration was measured by a UV spectrophotometer and was approximately 8300OD / L. Collect the bacteria by centrifugation at 6000rpm and 20°C for 15min. The bacterial precipitate obtained from each 0.76L initial culture medium was collected in a 50mL tube and stored in a -80°C refrigerator. When lysing the bacteria, 200mL Kpi (100mM) was added to the bacterial precipitate obtained from each 0.76L culture medium to thaw and resuspend by vortexing. The bacteria were lysed and broken by a homogenizer, centrifuged at 18000rpm and 4°C for 30min, the precipitate was discarded, and the brown-red supernatant obtained was added to 17 2.8L conical flasks, and 200mL Kpi (100mM) and 335mg NADP were pre-added to each conical flask. + and 7.6g glucose, and finally 140mg of buxinol dissolved in 21mL DMF was added. The reaction was carried out at 25°C and 200rpm for 16h, and 2.38mg of buxinol was contained in 17 conical flasks. After the reaction was completed, the mixture was extracted 3 times with 1 / 2 volume of ethyl acetate. The organic phase was dried over anhydrous Na2SO4, and the solvent was dried using a rotary evaporator. After purification by silica gel column chromatography, 1.55g of 3-hydroxybuxinol was obtained, and the isolated yield was 68%.

[0133] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. An oxidase mutant, characterized in that The amino acid sequence of the oxidase mutant is shown in SEQ ID NO:

6.

2. A DNA molecule, characterized in that The DNA molecule encodes the oxidase mutant according to claim 1.

3. An expression vector, characterized in that: The expression vector comprises the DNA molecule according to claim 2.

4. A host cell, characterized in that The host cell comprises the expression vector according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is an Escherichia coli cell.

6. Use of the oxidase mutant according to claim 1, the DNA molecule according to claim 2, the expression vector according to claim 3 or the host cell according to any one of claims 4 to 5 in the preparation of 3-hydroxybutyric acid.

7. A method for preparing 3-hydroxybuxanol, characterized in that: The preparation method of 3-hydroxybuxinol comprises the steps of: Nicotinamide adenine dinucleotide phosphate, glucose, buprenorphine, glucose dehydrogenase and the oxidase mutant according to claim 1 are mixed and reacted to obtain the 3-hydroxybuprenorphine.

8. The preparation method according to claim 7, characterized in that: The preparation method of the 3-hydroxybuxinol specifically comprises the steps of: The expression vector according to claim 3 and the expression vector containing the glucose dehydrogenase gene are transferred into Escherichia coli, cultured, and then the cells are collected; The bacterial cells are mixed with a buffer solution, vortexed to resuspend, lysed and broken by a homogenizer, and centrifuged to obtain a supernatant; The supernatant is mixed with nicotinamide adenine dinucleotide phosphate, glucose and buprenorphine, and reacted to obtain the 3-hydroxybuprenorphine.

9. A method for preparing 3-hydroxybuxanol, characterized in that: The preparation method of 3-hydroxybuxinol comprises the steps of: The expression vector of claim 3 and the expression vector containing the glucose dehydrogenase gene are transferred into Escherichia coli, cultured, and then a single clone is picked and placed in a culture medium containing kanamycin and ampicillin. After growth, the single clone is mixed with nicotinamide adenine dinucleotide phosphate, glucose and succinimidyl alcohol, and reacted to obtain the 3-hydroxysuccinimidyl alcohol.

Images