A fungal laccase overexpression gene, overexpression strain, and expression method

By screening for the transcription factor ThbZIP, which regulates laccase expression, a fungal laccase overexpression strain, Trametes hirsuta AH28-2 (ThbZIP-OE-13), was constructed. This solved the problems of low yield and safety in heterologous fungal laccase expression, and achieved efficient laccase production under conditions without inducing substances, increasing the yield by 1.5 times.

CN118127045BActive Publication Date: 2025-10-28ANHUI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410061876.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-16
Publication Date
2025-10-28
Estimated Expiration
2044-01-16

AI Technical Summary

Technical Problem

Existing technologies for heterologous expression of fungal laccase suffer from low yield, long fermentation cycle, and high cost, and the use of aromatic compounds for induction poses safety and pollution risks.

Method used

By screening for the transcription factor ThbZIP, which regulates laccase expression, a fungal laccase overexpression strain, *Trametes hirsuta* AH28-2 (ThbZIP-OE-13), was constructed to increase laccase yield without inducing substances. The fungal laccase overexpression gene ThbZIP was ligated with the L22 and L24 sequences to construct a fungal laccase overexpression plasmid, which was then transferred into *Trametes sp.* AH28-2 using the *Saccharomyces cerevisiae* homozygous recombination method, achieving high fungal laccase production.

Benefits of technology

The method achieved a significant increase in fungal laccase yield under conditions without inducing substances, stable passage, convenient construction operation, good reproducibility, and an increase in laccase yield of more than 1.5 times.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118127045B_ABST
    Figure CN118127045B_ABST
Patent Text Reader

Abstract

This application discloses a fungal laccase overexpression gene, an overexpressing strain, and an expression method. On one hand, this application provides a fungal laccase overexpression gene, ThbZIP, the nucleotide sequence of which is shown in SEQ ID No: 1. On the other hand, this application provides a fungal laccase overexpression strain, obtained by overexpressing the fungal gene ThbZIP in Trametes hirsuta AH28-2; the fungal laccase overexpression strain is named Trametes hirsuta AH28-2 (ThbZIP-OE-13), deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on December 12, 2023, with accession number CCTCC M 20232545. This application constructs an overexpression strain by screening transcription factors that regulate laccase expression, effectively increasing laccase yield even without induction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of microbial technology, and in particular to a fungal laccase overexpression gene, an overexpression strain, and an expression method. Background Technology

[0002] Laccase (phenylene glycol: oxygen oxidoreductase, EC1.10.3.2) is a copper-containing polyphenol oxidase widely distributed in higher filamentous fungi, especially basidiomycetes. It catalyzes the oxidation of hydroxyl functional groups in various substrates, reducing molecular oxygen to water. In recent years, with the increasing calls for and pursuit of sustainable and environmentally friendly catalysis, the broad substrate specificity of fungal laccases and their catalytic advantages, such as using O2 as an electron acceptor and H2O as a byproduct, have become increasingly apparent. Consequently, research on fungal laccases has attracted widespread attention from researchers worldwide. Currently, fungal laccases have demonstrated enormous application potential in various industries, such as pulp, papermaking, food, textiles, biofuels, bioremediation, biosensors, novel drug synthesis, and cosmetics.

[0003] However, wild-type fungi secrete low levels of laccase and exhibit weak extracellular laccase activity. To increase laccase yield, heterologous expression of fungal laccase is typically employed. Currently, there are literature reports of successful recombinant expression of fungal laccase genes, but such heterologous expression often suffers from drawbacks such as low yield, long fermentation cycles, and high costs, making it difficult to meet industrial-scale requirements.

[0004] Induced expression of fungal laccase is another important pathway to increase fungal laccase yield. Currently, it is generally believed that the mechanism of laccase activation is achieved through the interaction of transcription factors and cis-regulatory elements in the promoter region. In existing technologies, several Chinese invention patents applied for by Anhui University utilize the wild-type strain *Streptomyces* AH28-2, constructing overexpression strains by regulating transcription factors involved in laccase expression, thus increasing laccase yield. However, the strains obtained in these existing technologies require the induction of trace amounts of aromatic compounds to achieve high laccase production. The aromatic compounds used, such as o-toluidine, are toxic, posing pollution and safety risks for industrial application. Summary of the Invention

[0005] To address at least one of the aforementioned technical problems, this application provides a fungal laccase overexpression gene, an overexpression strain, and an expression method. This is achieved by screening transcription factors that regulate laccase expression and constructing an overexpression strain that can effectively increase laccase production without induction.

[0006] On the one hand, this application provides a fungal laccase overexpression gene ThbZIP, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0007] Secondly, this application provides a fungal laccase overexpression plasmid comprising the aforementioned fungal laccase overexpression gene ThbZIP. The fungal laccase overexpression plasmid includes a linearized recombinant pYSK7 plasmid digested with enzymes, and a linked L22-ThbZIP-L24 sequence. The recombinant pYSK7 plasmid is a promoter-recombined pYSK7 plasmid, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2. The L22-ThbZIP-L24 sequence is a fungal laccase overexpression gene ThbZIP with L22 and L24 sequences linked bilaterally, respectively. The nucleotide sequence of the L22 sequence is shown in SEQ ID No: 3, and the nucleotide sequence of the L24 sequence is shown in SEQ ID No: 4.

[0008] Thirdly, this application provides a method for preparing the above-mentioned fungal laccase overexpression plasmid, comprising the following steps:

[0009] Sa, the fungal laccase overexpression gene ThbZIP and the empty vector pet-22b were digested with enzymes and then ligated with DNA ligase to obtain the ligation vector;

[0010] Sb, The ligation vector obtained in step Sa is transformed into E. coli DH5α competent cells, cultured and screened to obtain positive clones, and the pet-22b-ThbZIP recombinant plasmid is obtained;

[0011] Sc. Using the pet-22b-ThbZIP recombinant plasmid obtained in step Sb as a template, and L22-ThbZIP-F and L24-ThbZIP-R as upstream and downstream primers, the target sequence was amplified. After purifying the amplified target sequence, the purified product was used as a template, and the L22 and L24 sequences were used as upstream and downstream primers to amplify the L22-ThbZIP-L24 sequence. The nucleotide sequences of the L22-ThbZIP-F and L24-ThbZIP-R primers are shown in SEQ ID No: 5 and SEQ ID No: 6, respectively.

[0012] Sd. The recombinant pYSK7 plasmid was digested with enzymes to obtain a linearized pYSK7 plasmid. Then, the L22-ThbZIP-L24 sequence obtained in step Sc was ligated to the linearized pYSK7 plasmid using the Saccharomyces cerevisiae homologous recombination method to obtain a fungal laccase overexpression plasmid.

[0013] Optionally, in step S3, the purification is performed using agarose gel purification.

[0014] Optionally, in step S4, the specific preparation steps of the linearized pYSK7 plasmid are as follows: after the recombinant pYSK7 plasmid is digested with enzymes, the digestion product is incubated at 37°C for 1 hour, and then purified by agarose gel to obtain the linearized pYSK7 plasmid.

[0015] Fourthly, this application provides a fungal laccase overexpression strain, which is a strain obtained by overexpressing the fungal gene ThbZIP in Trametes sp. AH28-2; the fungal laccase overexpression strain is named Trametes hirsuta AH28-2(ThbZIP-OE-13); depositary institution: China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: December 12, 2023; accession number: CCTCC M20232545.

[0016] Fifthly, this application provides a method for preparing the above-mentioned fungal laccase overexpression strain, comprising the following steps: preparing protoplasts using the laccase-producing wild-type strain T. hirsutaAH28-2; transforming the above-mentioned fungal laccase overexpression plasmid into the protoplasts of the laccase-producing wild-type strain T. hirsutaAH28-2; and regenerating, initially screening, and rescreening the transformed protoplasts to obtain the fungal laccase overexpression strain.

[0017] Optionally, the fungal laccase overexpression plasmid is transformed into the protoplasts of the laccase-producing wild-type strain T. hirsuta AH28-2 using the PEG / CaCl2 method.

[0018] Sixthly, this application provides the application of the above-mentioned fungal laccase overexpression strain in the field of laccase production.

[0019] Optionally, the specific method for producing laccase includes the following steps:

[0020] S1. The above-mentioned fungal laccase overexpression strain was activated to obtain activated bacterial cells;

[0021] S2. Take the activated bacterial cells obtained in step S1, inoculate them into a liquid culture medium containing cellobiose and asparagine, and ferment them on a shaker for 120-160 hours. Then, centrifuge the fermentation broth to remove the bacterial cells and obtain the fermentation supernatant.

[0022] S3. Purify the fermentation supernatant obtained in step S2 to obtain laccase.

[0023] In summary, the present invention has at least one of the following beneficial technical effects:

[0024] 1. This application selected the fungal laccase overexpression gene ThbZIP through screening. By regulating the overexpression of the above gene by the tethered fungus AH28-2, the resulting strain can stably overexpress the above gene through passage. The laccase yield of the obtained strain can also be significantly increased without any induction.

[0025] 2. This application constructs a fungal laccase overexpression plasmid by linking the L22 and L24 sequences bilaterally to the fungal laccase overexpression gene ThbZIP, and then linking it to the linearized pYSK7 plasmid. This plasmid allows for the convenient transformation of the fungal laccase overexpression gene ThbZIP into *Streptomyces thunbergii* AH28-2 to construct a strain overexpressing the above gene. The transformation operation is convenient and has good reproducibility.

[0026] 3. This application selected the wild-type laccase strain Trametes sp. AH28-2, which has a high laccase yield, as the basic strain and constructed an overexpression strain of fungal laccase that overexpresses the fungal gene ThbZIP of this application, named Trametes hirsutaAH28-2 (ThbZIP-OE-13). The newly constructed strain can not only stably overexpress the above gene through passage, but also the laccase yield can be increased by more than 1.5 times compared with the basic Trametes sp. AH28-2 strain without any inducing substances, which shows excellent yield. Attached Figure Description

[0027] Figure 1 This is an electrophoresis image of the amplified ThbZIP sequence in Example 1 of this application;

[0028] Figure 2 This is a graph showing the changes in the transcriptional level of the laccase gene lacA in ThbZIP overexpressing strains.

[0029] Figure 3 This is a graph showing the changes in the transcriptional level of the ThbZIP gene in ThbZIP-overexpressing strains.

[0030] Figure 4 The graph shows the changes in total laccase activity between the overexpression strain and the wild-type strain.

[0031] Figure 5 This is a diagram showing the changes in isozyme profiles of the overexpressing strain and the wild-type strain. Detailed Implementation

[0032] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.

[0033] This application provides a fungal laccase overexpression gene ThbZIP, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0034] This application obtained the above-mentioned fungal gene ThbZIP through screening. It can be obtained from *Strombus haemolyticus* AH28-2. Overexpression of the above gene in *Strombus haemolyticus* AH28-2 can significantly increase laccase production.

[0035] This application also provides a fungal laccase overexpression strain, which is obtained by overexpressing the fungal gene ThbZIP of this application in Trametes sp. AH28-2; the fungal laccase overexpression strain is named Trametes hirsuta AH28-2(ThbZIP-OE-13); depositary institution: China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: December 12, 2023; accession number: CCTCC M20232545.

[0036] The *Trametes* sp. AH28-2 strain used in this application is a wild-type, high-yielding laccase strain. The depositary institution for *Trametes* sp. AH28-2 is the China Center for Type Culture Collection (CCTCC); address: Wuhan University, Wuhan, China; deposit date: November 22, 2005; accession number: CCTCC NO: M205134.

[0037] The following are embodiments of this application.

[0038] The primer sequences used in this application were all prepared by a third-party biotechnology company commissioned by the applicant, and all primer sequences were designed independently by the inventors of this application.

[0039] Example 1

[0040] Preparation of the fungal laccase overexpression gene ThbZIP

[0041] The preparation of the full-length sequence of the fungal laccase overexpression gene ThbZIP in this embodiment was carried out using the following steps:

[0042] Step 1) Select T. hirsuta AH28-2 strain, extract total RNA, and reverse transcribe it into cDNA;

[0043] Step 2) Using the cDNA obtained in Step 1) as a template, PCR is performed to obtain the full-length sequence of ThbZIP; the amplification primers are shown in Table 1, and the PCR amplification system is shown in Table 2; the PCR amplification conditions are: 94℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 90s, for a total of 30 cycles, and finally 72℃ extension for 10min.

[0044] Table 1 Primer sequences

[0045] Primer name Sequence (5'-3') ThbZIP-F ATGTCCTCATCCTTGCCGCCGT ThbZIP-R TTAGATGGTGTCGAAGGGGGGAG

[0046] Table 2 PCR reaction system

[0047] Component Name Added amount T. hirsuta AH28-2cDNA 3μL 2×ApexHFFLPCRMasterMix 20μL ThbZIP-F 1.5μL ThbZIP-R 1.5μL <![CDATA[ddH2O]]> Add to 40μL

[0048] Step 3) Detect the amplification product obtained in Step 2) using a 1% agarose gel electrophoresis and recover the target fragment. The electrophoresis results are as follows: Figure 1 As shown.

[0049] The recovered target sequence fragment was sequenced, and the sequence of the target fragment was identified as being consistent with the sequence of the fungal laccase overexpression gene ThbZIP of this application.

[0050] The PCR primers described above in this application were designed by the inventors based on the sequence of the fungal laccase overexpression gene ThbZIP obtained through screening in this application. The primers used in the embodiments of this application are merely illustrative examples. Other primers designed using Primer 5 software or other primer sequence design software based on the sequence of the fungal laccase overexpression gene ThbZIP in this application can also achieve the PCR purpose of this application.

[0051] Furthermore, the specific PCR system and PCR conditions in the embodiments of this application can be adjusted as needed during actual implementation.

[0052] Example 2

[0053] Construction of fungal laccase overexpression plasmid

[0054] The recombinant pYSK7 vector and pet-22b vector used in this embodiment, as well as E. coli DH5α competent cells and Saccharomyces cerevisiae competent cells Y1H, were all commercially available. The reagents used were all obtained by purchasing the above-mentioned experimental materials. The recombinant pYSK7 vector was designed and customized according to this application.

[0055] The method for preparing the fungal laccase overexpression plasmid of this application includes the following steps:

[0056] Sa, The fungal laccase overexpression gene ThbZIP and the empty vector pet-22b obtained in Example 1 were double-digested with BamHI and NotI, respectively, and then ligated using T4 DNA ligase to obtain the ligation vector.

[0057] Sb. The ligation vector obtained in step Sa is transformed into E. coli DH5α competent cells, cultured and screened to obtain positive clones, and the pet-22b-ThbZIP recombinant plasmid is obtained.

[0058] The specific steps are as follows:

[0059] 1) Take 100 μL of frozen E. coli DH5α competent cells and place them on ice immediately;

[0060] 2) After the competent cells thaw, quickly add 10 μL of the ligation vector to the competent cells, gently tap to mix, and place on ice for 30 min to obtain the cell mixture.

[0061] 3) Heat the cell mixture to 42°C for 50 seconds, then immediately place it on ice to cool for 3 minutes;

[0062] 4) Add 900 μL of LB medium to the heat-shocked cell mixture, mix gently, and incubate on a shaker at 37°C and 200 rpm for 1 h to obtain the cell incubation solution.

[0063] 5) Centrifuge the cell incubation solution at 1000g for 10s, discard 600μL of supernatant, mix the remaining cells to obtain the bacterial solution;

[0064] 6) Take 200 μL of bacterial culture and spread it evenly on LB solid medium containing 1% Amp. Incubate at 37°C with the culture inverted position for 12 h.

[0065] 7) Select 3 single clones from the cultured bacterial cells and perform colony PCR verification. Culture the positive clones in test tubes containing 5 mL of LB medium and incubate at 37°C for 8 h. Store the bacterial solution in 15% glycerol at -70°C for later use.

[0066] 8) Following the instructions of the Axygen plasmid extraction kit, extract plasmids from the prepared bacterial culture and send them to the company for sequencing. After the sequencing confirms that the plasmids are correct, take the prepared bacterial culture, extract plasmids, and obtain the pet-22b-ThbZIP recombinant plasmid.

[0067] Sc. Using the pet-22b-ThbZIP recombinant plasmid obtained in step Sb as a template, and L22-ThbZIP-F and L24-ThbZIP-R as upstream and downstream primers, the target sequence was amplified by PCR. The specific PCR primers used are shown in Table 3 below, and the PCR system is shown in Table 4 below.

[0068] The PCR conditions used were: 94℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 90s, for a total of 30 cycles, and a final extension at 72℃ for 10min; the product was detected by 1% agarose gel electrophoresis and the target fragment was recovered.

[0069] Table 3 PCR primer sequences

[0070]

[0071] Table 4 PCR reaction system

[0072] Component Name Added amount pet-22b-ThbZIP plasmid 2μL 2×ApexHFFLPCRMasterMix 20μL L22-ThbZIP-F 1.5μL L24-ThbZIP-R 1.5μL <![CDATA[ddH2O]]> Add to 40μL

[0073] Using the target fragment recovered above as a template, and using the L22 and L24 sequences as upstream and downstream primers, the L22-ThbZIP-L24 sequence was amplified by PCR. The specific PCR primers used are shown in Table 5 below, and the PCR system is shown in Table 6 below. The PCR conditions used are the same as above.

[0074] Table 5 PCR primer sequences

[0075] Primer name Sequence (5'-3') L22 ACATCCACCATCTCCGTTTTCCCCATCTACACACAACAAGCTTATCGCC L24 TGACTATAGCAGCCTCCTACCACTGGCCCTCTGGTCAACTATAATATTAT

[0076] Table 6 PCR reaction system

[0077] Component Name Added amount Glue recycling purpose segment 5μL 2×ApexHFFLPCRMasterMix 20μL L22 1.5μL L24 1.5μL <![CDATA[ddH2O]]> Add to 40μL

[0078] The pYSK7 plasmid was double-digested with Sd, BamHI, and HpaI, incubated at 37℃ for 1 h, detected by 1% agarose gel electrophoresis, and the target fragment was recovered to obtain the linearized pYSK7 plasmid; the enzyme digestion reaction system is shown in Table 7.

[0079] Table 7 Double Enzyme Digestion Reaction System

[0080]

[0081]

[0082] Using competent cells of Saccharomyces cerevisiae, the L22-ThbZIP-L24 sequence was linked to the linearized pYSK7 plasmid through homologous recombination to obtain a fungal laccase overexpression plasmid.

[0083] The specific steps of homologous recombination ligation are as follows:

[0084] 1) Take 100 μL of thawed Y1H competent cells from ice, and add 10 μL of pre-cooled Carrier DNA (heated at high temperature for 5 min before use to denature it into a single-stranded state), 10 μL of L22-ThbZIP-L24 target fragment, and 10 μg of linearized pYSK7 plasmid; then add 500 μL of PEG / LiAc (PEG3500, TE Buffer, and LiAc mixed in an 8:1:1 ratio), and gently pipette to mix; incubate in a 30℃ water bath for 30 min (inverting and mixing once every 10 min).

[0085] 2) Place the reaction solution in a centrifuge tube, add 20 μL of DMSO, and mix gently; react in a water bath at 42°C for 15 min (stirring and mixing once every 5 min);

[0086] 3) Centrifuge the reaction solution at 12000g for 10s, discard the supernatant, resuspend the cells in 1mL of YPDA medium, and then incubate at 30℃ and 200rpm for 1h on a shaker.

[0087] 4) Centrifuge the culture medium at 12000g for 10s, discard the supernatant, and resuspend the bacterial cells in 1mL of 0.9% NaCl solution;

[0088] 5) Centrifuge the resuspended solution at 12000g for 10s, discard the supernatant, and spread 200μL of the bacterial solution onto SD / -Ura solid medium. Incubate at 30℃ for 3 days.

[0089] 6) Randomly pick 3 yeast single clones from SD / -Ura plates, place them in 3 mL of YPDA medium, and culture them in a shaker at 30℃ and 200 rpm for 16 h; then centrifuge the culture medium at 12000g for 10 min, collect the cells, and store them in a -70℃ freezer for later use.

[0090] 7) Following the instructions of the TIANGEN yeast plasmid extraction kit, yeast plasmids were extracted and sent to the company for sequencing. After the sequencing confirmed that the plasmids were correct, the obtained bacterial cells were taken, and plasmids were extracted to obtain fungal laccase overexpression plasmids.

[0091] The applicant conducted more than 10 repeated experiments on this embodiment and was able to successfully prepare fungal laccase overexpression plasmids in all of them, showing good reproducibility.

[0092] Example 3

[0093] Construction of fungal laccase overexpression strains

[0094] In this embodiment, the wild high-yielding laccase strain Trametes sp. AH28-2 was selected as the basic strain.

[0095] The method for preparing the fungal laccase overexpression strain in this embodiment includes the following steps:

[0096] Step 1) Preparation of Trametes sp. AH28-2 protoplasts

[0097] The specific steps are as follows:

[0098] 1) Take 10 CPDA plates and culture T. hirsuta AH28-2 strain on each plate. Incubate at 28℃ for 7 days.

[0099] 2) On the clean bench, add 10mL of sterile water to each CPDA plate to soak the mycelium, and gently scrape the mycelium on the surface of the plate with a sterile spatula to obtain a mycelium suspension.

[0100] 3) Use a pipette to draw up the mycelial suspension and filter the mycelium through a spore filter containing glass wool. Transfer the obtained spore suspension to a sterile EP tube and centrifuge at 3000g for 10 minutes. Discard the supernatant to obtain the mycelial precipitate.

[0101] 4) Resuspend the mycelial precipitate in 8 mL of MM buffer, centrifuge at 3000 g for 10 min, discard the supernatant, and obtain the mycelial cells;

[0102] 5) Add 400 μL of enzyme solution (containing 0.5% chitinase and 1.5% cellulase) to the bacterial cells, resuspend the cells by pipetting, and incubate at 37°C for 5 hours. Observe the degree of spore enzymatic hydrolysis with a microscope every hour. When the protoplast formation rate reaches more than 50%, add 5 mL of MMC solution to terminate the enzymatic hydrolysis reaction and obtain a cell suspension.

[0103] 6) Centrifuge the cell suspension at 640g for 10 min, slowly discard the supernatant, and add 350 μL of MMC buffer to the resulting precipitate to obtain Trametes sp. AH28-2 protoplasts.

[0104] The applicant conducted more than 10 repeated experiments in this step, and protoplasts were successfully obtained in each attempt. The protoplasts obtained in these repeated experiments were tested for activity using the FDA method, and the activity consistently reached over 70%.

[0105] Step 2) Transform the fungal laccase overexpression plasmid into protoplasts

[0106] The specific steps are as follows:

[0107] 1) Pre-cool and sterilize EP tubes on ice, then add 50 μL of protoplasts, 12.5 μL of PEG solution and 1 μg of fungal laccase overexpression plasmid to the EP tubes to prepare a mixture.

[0108] 2) Place the mixture on ice and let it stand for 20 minutes, then add 500 μL of PEG solution (prepare fresh and filter sterilize before use), mix gently, and let it stand at room temperature for 5 minutes.

[0109] 3) Add 1 mL of STC buffer to the system, mix well, and then take 350 μL and spread it on a petri dish containing regenerated solid culture medium. Incubate at 28°C for 24 h.

[0110] 4) Cover the petri dish with 5 mL of regeneration medium containing hygromycin (final concentration of 300 μg / mL) and incubate for 3 days to grow transformants.

[0111] Step 3) Primary and secondary screening of positive transformants

[0112] The specific steps are as follows:

[0113] 1) Transfer the transformants obtained in step 2) to a regeneration medium containing hygromycin at a final concentration of 300 μg / mL for screening. Observe the growth of the colonies and select transformant strains with hygromycin resistance.

[0114] 2) The selected hygromycin-resistant transformed strains were transferred to new CPDA medium and cultured. After the mycelium had fully grown in the culture dish, PCR verification and screening were performed.

[0115] Scrape some hyphae, place them in an EP tube, add 100 μL of fungal genome extraction reagent Mighty Prep, vortex to mix, heat at 95°C for 10 min, centrifuge at 12000g for 2 min, and then transfer the supernatant to a new sterile EP tube to obtain the genome solution.

[0116] Using L22 and L24 sequences as upstream and downstream primers, and genomic solution as template solution, PCR amplification was performed. The PCR reaction system is shown in Table 8. The PCR amplification conditions were: 94℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 90s, for a total of 30 cycles, and a final extension at 72℃ for 10min. The products were detected by 1% agarose gel electrophoresis to observe whether there was a band overexpressing the target gene of this application.

[0117] Table 8 PCR reaction system

[0118] Component Name Added amount Genome 3μL 2×ApexHFFLPCRMasterMix 10 μL L22 1μL L24 1μL <![CDATA[ddH2O]]> Add to 20μL

[0119] Transformed strains with target gene bands were screened. These strains were all T. hirsuta AH28-2 strains that had been successfully transformed into fungal laccase overexpression plasmids.

[0120] 3) Perform qRT-PCR rescreening on strains successfully transformed with the fungal laccase overexpression plasmid. The specific steps are as follows:

[0121] Fresh mycelia of wild-type T. hirsuta AH28-2 strain and strains successfully transformed with fungal laccase overexpression plasmid were collected, and total RNA was extracted according to the RNAiso Plus reagent (Takara) instructions, and the purity and concentration were determined.

[0122] Take 1 μg of total RNA and synthesize cDNA according to the instructions for use of PrimeScript RT reagent (Takara);

[0123] Using cDNA as a template, qRT-PCR analysis of the transcriptional levels of lacA and ThbZIP was performed on a LightCycler96 (Roche) using a specific primer set according to the SYBR Premix Ex Taq™ II kit (Takara). The glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was used as an internal control gene, and the relative expression level of each gene was calculated using the 2-ΔΔCT method and LC96SW1.1 software. The specific primer sets are shown in Table 9, and the qRT-PCR reaction system is shown in Table 10. The PCR amplification conditions were: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 5 s, and 60℃ annealing for 20 s, for a total of 40 cycles.

[0124] Table 9 Specific primer sequences

[0125] Primer name Sequence (5'-3') lacA-qF TCCTTCGTGTTGAATGCCGA lacA-qR GTTGATACCGCCCGCAAATC ThbZIP-qF CGTGAGGAACTCGCTGAAG ThbZIP-qR AACACCGAGAAGACTGCCT GAPDH-qF GCCGCTTCAAGGGCAAAGTC GAPDH-qR TGTAGTCGGCACCAACGGA

[0126] Table 10 qRT-PCR reaction system

[0127] Component Name Added amount T. hirsuta AH28-2cDNA 1μL 2×SYBRPremixExTaqII 10 μL lacA-qF / ThbZIP-qF 1μL lacA-qR / ThbZIP-qR 1μL <![CDATA[ddH2O]]> 7μL Total 20μL

[0128] The strains that overexpressed the fungal laccase gene ThbZIP were selected through secondary screening, and the transcription level of ThbZIP was significantly higher than that of the wild-type T. hirsuta AH28-2, thus obtaining the fungal laccase overexpression strains.

[0129] This example selected the strain with the highest transcriptional level of the fungal laccase overexpression gene ThbZIP. The results obtained from the detection and analysis are as follows: Figure 2 and Figure 3 As shown.

[0130] Depend on Figure 2 and Figure 3 As can be seen, compared with the wild-type T. hirsutaAH28-2, the laccase overexpression strains finally screened in this embodiment showed an increase of more than 1.4 times in the transcription level of the laccase gene lacA and an increase of more than 4.5 times in the transcription level of the ThbZIP gene.

[0131] The strain with the highest transcription level obtained in this embodiment was used as the fungal laccase overexpression strain of this application and was preserved.

[0132] Using the strain sent for preservation as the base strain, after subculturing, the bacterial cells obtained from the subculturing were taken and qRT-PCR was performed again, using basically the same operating steps as the qRT-PCR rescreening in this embodiment.

[0133] Testing revealed that the expression levels of the laccase gene lacA and the ThbZIP gene in the subcultured bacterial cells were not significantly different from those in the basal strain. Therefore, the fungal laccase overexpression strain of this application can stably overexpress the fungal laccase overexpression gene ThbZIP.

[0134] Example 4

[0135] Laccase production

[0136] In this embodiment, the *Trametes hirsuta* AH28-2 (ThbZIP-OE-13) strain of this application was selected.

[0137] The culture medium preparation method used in this embodiment is as follows:

[0138] CPDA solid medium (1L): 20.0g glucose, 15.0g agar powder, 3g KH2PO4, 1.5g MgSO4·7H2O, 0.04g VB1, 20% potato filtrate, and deionized water were added to a final volume of 1L. The mixture was then autoclaved at 115℃ for 30 minutes.

[0139] Cellobiose-asparagine liquid culture medium (1L): 15.0g cellobiose, 1.5g DL-asparagine, 1.0g peptone, 1.0g KH2PO4, 0.1g Na2HPO4·12H2O, 0.028g adenine, 0.01g CaCl2, 0.01g FeSO4·7H2O, 0.002g CuSO4·5H2O, 50.0μg VB1, and deionized water were added to a final volume of 1L. The mixture was then autoclaved at 115℃ for 30min.

[0140] The production of laccase in this embodiment includes the following steps:

[0141] Step 1) Inoculate strain Trametes hirsutaAH28-2 (ThbZIP-OE-13) onto CPDA medium plates for activation. Specifically, take a 0.5 cm diameter mycelial block from the preservation slant and inoculate it in the center of the CPDA medium plate. Incubate at 28°C in a constant temperature incubator. Activation is complete when the edge of the mycelium grows to about 1 cm from the edge of the culture dish.

[0142] Step 2) Take 6 mycelial blocks with a diameter of 0.5 cm from the activated plate and inoculate them into 100 mL of cellobiose-asparagine liquid medium (250 mL). Ferment at 28 °C and 120 rpm on a shaker. Monitor enzyme activity during fermentation. Stop fermentation when the enzyme activity reaches its maximum (about 144 h).

[0143] Step 3) Centrifuge the fermentation broth to remove the supernatant, and then concentrate and purify it by ultrafiltration to obtain laccase.

[0144] Testing experiment:

[0145] The wild-type high-laccase-producing strain Trametes sp. AH28-2 was used as a control, and the laccase production steps were exactly the same as those in this example.

[0146] The laccase production capacity of the Trametes hirsutaAH28-2(ThbZIP-OE-13) strain and the wild-type high-laccase-producing Trametes sp.AH28-2 strain were tested respectively.

[0147] At seven time points during fermentation in step 2)—0h, 24h, 48h, 72h, 96h, 120h, and 144h—samples were taken to determine the total enzyme activity and isozyme profile of laccase.

[0148] The test results are as follows Figure 4 and Figure 5 As shown.

[0149] pass Figure 4 and Figure 5 It can be seen that the Trametes hirsuta AH28-2(ThbZIP-OE-13) strain of this application, without the action of any inducing substances, using the laccase production method of this application, produced laccase yields that were more than 1.5 times higher than those of the wild-type high-laccase-producing Trametes sp. AH28-2 strain. This fully demonstrates that the Trametes hirsuta AH28-2(ThbZIP-OE-13) strain of this application has extremely excellent laccase-producing characteristics.

[0150] The above are all preferred embodiments of the present application, and are not intended to limit the scope of protection of the present application. Therefore, any equivalent changes made based on the structure, shape, and principle of the present application should be included in the scope of protection of the present application.

Claims

1. A strain of fungal laccase overexpressing, characterized in that, The fungal laccase overexpression strain was found in the thrombus. Trametes The strain obtained by overexpressing the fungal gene ThbZIP in sp. AH28-2, the nucleotide sequence of the overexpressed gene ThbZIP is shown in SEQ ID No: 1; the fungal laccase overexpression strain is named Trametes hirsuta AH28-2 (ThbZIP-OE-13); Depository: China Center for Type Culture Collection; Address: Wuhan University, Wuhan, China; Date of deposit: December 12, 2023; Accession number: CCTCC M 20232545.

2. A method for preparing the fungal laccase overexpression strain according to claim 1, characterized in that, Includes the following steps: Use thrombus Trametes Protoplasts were prepared using sp. AH28-2; then, fungal laccase overexpression plasmids were transformed into *Strombus haematobium*. Trametes Protoplasts of sp. AH28-2; the transformed protoplasts were regenerated, primary screened, and secondary screened to obtain overexpression strains of fungal laccase; The fungal laccase overexpression plasmid comprises a linearized recombinant pYSK7 plasmid digested with enzymes, and a linked L22-ThbZIP-L24 sequence; the recombinant pYSK7 plasmid is a promoter-recombined pYSK7 plasmid, and the nucleotide sequence of the promoter of the recombinant pYSK7 plasmid is shown in SEQ ID No: 2; the L22-ThbZIP-L24 sequence is a fungal laccase overexpression gene ThbZIP with L22 and L24 sequences linked on both sides, and the nucleotide sequence of the L22 sequence is shown in SEQ ID No: 3, and the nucleotide sequence of the L24 sequence is shown in SEQ ID No:

4.

3. The method for preparing the fungal laccase overexpression strain according to claim 2, characterized in that, The fungal laccase overexpression plasmid was transformed into thrombus. Trametes Protoplasts of sp. AH28-2 were obtained using the PEG / CaCl2 method.

4. The use of an overexpression strain of the fungal laccase according to claim 1 in the production of laccase.

5. The application of the fungal laccase overexpression strain according to claim 4 in laccase production, characterized in that, The specific method for producing laccase includes the following steps: S1. Activate the overexpression strain of fungal laccase according to claim 4 to obtain activated bacterial cells; S2. Take the activated bacterial cells obtained in step S1, inoculate them into a liquid culture medium containing cellobiose and asparagine, and ferment them on a shaker for 120-160 hours. Then, centrifuge the fermentation broth to remove the bacterial cells and obtain the fermentation supernatant. S3. Purify the fermentation supernatant obtained in step S2 to obtain laccase.

Citation Information

Patent Citations

  • Fungal-laccase expression strain and establishing method and application thereof

    CN109666592A

  • Homologous overexpression engineering bacterium of laccase gene MvLac5 and application of homologous overexpression engineering bacterium

    CN117305137A