pJEV-CMV-p54 replicon plasmid and its preparation method and application

Abstract

The present invention provides a pJEV-CMV-p54 replicon plasmid and a preparation method and application thereof, and belongs to the technical field of molecular biology. The present invention uses the gene type I Japanese encephalitis virus genome lacking C, prM and E structural protein genes as a skeleton, inserts the African swine fever virus P54 intracellular region protein gene into the site where the structural protein is missing, and successfully constructs a pJEV-CMV-p54 replicon plasmid capable of efficiently expressing the African swine fever virus P54 intracellular region protein. The pJEV-CMV-p54 has self-replication ability and can efficiently express the African swine fever virus P54 intracellular region protein, which further provides ideas for the research and development of ASFV vaccines.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to a pJEV-CMV-p54 replicon plasmid and a preparation method and application thereof. Background Art

[0002] African swine fever (ASF) is a severe, acute, virulent, and highly contagious disease of domestic and wild pigs. Although the onset is short, the mortality rate is as high as 100%. ASF can be transmitted through contact with wild boars, contaminated pig products, and vector insects. Since the disease was first reported in 1921, it has been prevalent in sub-Saharan Africa. In 2007, an ASF outbreak occurred in Georgia, and then the epidemic quickly spread throughout the Caucasus and Russia. In 2014, ASF was introduced to most countries in Eastern Europe and initially showed a trend of expanding the epidemic. The World Organization for Animal Health (OIE) has listed ASF as a notifiable animal disease.

[0003] The pathogen of ASF, ASFV, is the only member of the genus African swine fever virus of the family Asfrican swine fever virus. It is a large double-stranded DNA virus that replicates mainly in macrophages. Its genome is about 170-193kb, contains 150-167 ORFs, and encodes 150-200 proteins. Among them, there are many proteins related to virus replication, immune escape, and virus transmission, including p54, p72, and p30. The p54 protein is encoded by E183L and is about 30Ku in size. It is an important component of virus survival and replication and is related to the adsorption of the virus. As the main structural protein of African swine fever virus, the p54 protein is the main binding site of serum antibodies and has good immunogenicity. It can be used as a marker for early detection of African swine fever virus.

[0004] RNA replicon is an RNA vector that can replicate autonomously. It retains the viral non-structural protein (replication / transcriptase) gene, while the structural protein gene is missing or replaced by an exogenous antigen gene. The replication / transcriptase can control the high-level replication of the vector RNA in the cytoplasm and the high-level expression of the exogenous gene. Based on the infectious clone of the flavivirus, its replicon vector has been successfully constructed. However, it should be noted that the insertion principle of the exogenous gene should be based on the minimum change of the viral genome, otherwise it will lead to the non-expression of the exogenous gene or the gradual loss of the coding sequence during the passage process, so that it cannot function. The p54 intracellular region protein has good immunogenicity and can be used as an antigen for the preparation of monoclonal antibodies. However, to date, the replicon expression vector that can efficiently express the intracellular region encoding gene of the p54 protein has not been successfully constructed. Summary of the invention

[0005] The object of the present invention is to provide a pJEV-CMV-p54 replicon plasmid capable of efficiently expressing p54 intracellular region protein and a preparation method thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a pJEV-CMV-p54 replicon plasmid, and the nucleic acid sequence of the replicon plasmid is shown as SEQ ID NO.1.

[0008] Preferably, the replicon plasmid comprises a nucleic acid sequence encoding the African swine fever virus p54 intracellular region protein as shown in SEQ ID NO.2.

[0009] The present invention also provides a primer set for providing a nucleic acid sequence encoding the African swine fever virus p54 intracellular region protein in the replicon plasmid, comprising a forward primer JD-p54-F and a reverse primer JD-p54-R, the sequence of the forward primer JD-p54-F is shown in SEQ ID NO.3, and the sequence of the reverse primer JD-p54-R is shown in SEQ ID NO.4.

[0010] The present invention also provides a method for preparing the pJEV-CMV-p54 replicon plasmid, comprising the following steps:

[0011] S1. Connect the nucleic acid sequence of SEQ ID NO.2 between the EcoRI and XhoI restriction sites of the pCAGGS plasmid to construct a eukaryotic expression plasmid pCAGGS-p54;

[0012] S2. Construction of pJEV-CMV-B602L replicon;

[0013] S3. Using the eukaryotic expression plasmid pCAGGS-p54 described in S1 as a template, amplify a target fragment containing BamHI at the 5' end and XbaI at the 3' end, wherein the target fragment contains the sequence of SEQ ID NO.2;

[0014] S4. The pJEV-CMV-B602L plasmid and the target fragment described in S3 were double-digested with BamHI and XbaI restriction endonucleases respectively and then ligated to obtain the pJEV-CMV-p54 replicon plasmid.

[0015] Preferably, the forward primer for amplifying the target fragment in step S3 is AP-p54-F, whose sequence is as described in SEQ ID NO.11; and the reverse primer is AP-p54-R, whose sequence is as described in SEQ ID NO.12.

[0016] Preferably, the method for preparing the pJEV-CMV-B602L replicon plasmid comprises the following steps:

[0017] (1) Designing a first primer and a third primer to amplify the pJEV-CMV-EGFP plasmid sequence, respectively. Adding a Pme I restriction site upstream of the first primer to amplify fragment 1; adding a Bspe I restriction site downstream of the third primer to amplify fragment 2;

[0018] (2) Designing a second primer to amplify the B602L gene of the ASFV virus to obtain fragment 3;

[0019] (3) PCR fusion of fusion fragment 1 and fusion fragment 2 to obtain fusion fragment 1+2;

[0020] (4) PCR fusion of fusion fragment 1+2 and fragment 3 to obtain P2A-B602L-T2A fragment;

[0021] (5) using Pme I restriction endonuclease to perform single restriction digestion on the pJEV-CMV-EGFP replicon plasmid and the P2A-B602L-T2A fragment, respectively, to recover the vector 1 and the B602L fragment;

[0022] (6) Vector 1 was digested with endonuclease Bspe I to obtain vector 2, which was then ligated with the B602L fragment to obtain pJEV-CMV-B602L.

[0023] Preferably, in step (6), the mass ratio of the vector 2 to the B602L fragment is 1:3 to 1:10.

[0024] The present invention also provides the use of the P54 intracellular region protein expressed by the pJEV-CMV-p54 replicon plasmid in preparing monoclonal antibodies.

[0025] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention uses the gene type I Japanese encephalitis virus genome lacking C, prM and E structural protein genes as the skeleton, inserts the African swine fever virus P54 intracellular region protein gene at the site of the missing structural protein, and successfully constructs the pJEV-CMV-p54 replicon plasmid that can efficiently express the African swine fever virus P54 intracellular region protein. pJEV-CMV-p54 has the ability of self-replication and can efficiently express the African swine fever virus P54 intracellular region protein, which further provides ideas for the research and development of ASFV vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the plasmid structure of pJEV-CMV-p54.

[0027] Figure 2Agarose gel electrophoresis diagram.

[0028] (a) shows the result of pJEV-CMV-B602LBamHI / XbaI digestion (M: D15000; 1: pJEV-CMV-B602L);

[0029] (b) is the result of colony screening with AP-p54-F / AP-p54-R primers after pJEV-CMV-p54 plasmid transformation (M: D2000; 1-6: single colonies; 7: negative control);

[0030] (c) is the result of BamHI / XbaI restriction enzyme digestion of pJEV-CMV-p54 replicon (M:

[0031] D15000; 1: pJEV-CMV-p54).

[0032] Figure 3 This is the result of indirect immunofluorescence analysis (IFA) of 293T cells transfected with pJEV-CMV-p54 replicon.

[0033] Figure 4 The figure is the result of Western Blot of 293T cells transfected with pJEV-CMV-p54 replicon;

[0034] Note: (a) M: 26616 protein marker; 1: pJEV-CMV-EGFP; 2: pJEV-CMV-p54; 3: pJEV-CMV-p72; 4: Mock;

[0035] b:M: 26616 protein Marker; 1::pJEV-CMV-EGFP; 2::pJEV-CMV-p54; 3::pJEV-CMV-p72; 4: Mock;

[0036] c: M: 26616 protein Marker; 1: pJEV-CMV-EGFP; 2: pJEV-CMV-p54; 3: Mock. DETAILED DESCRIPTION

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] The instrument table of the embodiment of the present invention is shown in Table 1:

[0039] Table 1 Test Instruments

[0040]

[0041] The main reagents and biological materials of the present invention are shown in Table 2:

[0042] Table 2 Main reagents

[0043]

[0044]

[0045] Example 1 Construction of pJEV-CMV-p54 replicon

[0046] 1. Construction of pCAGGS-p54

[0047] According to the complete p54 (E183L) gene in the ASFVSY-18 strain (GenBank: MH766894.3) published on NCBI, the amino acids encoded by this gene were predicted by the protein transmembrane region prediction website of NovoPro (https: / / www.novopro.cn / tools / tmhmm.html), and only the nucleotide sequence corresponding to the intracellular region was retained, as shown in SEQ ID NO.2. Primers JD-p54-F and JD-p54-R were designed, and the primer sequences are shown in Table 3. The primers were synthesized by Shanghai Seheng Biotechnology Co., Ltd. Using SEQ ID NO.2 as a template, the target fragment was amplified, and the length of the target fragment was 477bp. The PCR amplification system is shown in Table 4, and the PCR reaction program is shown in Table 5.

[0048] Table 3 Primer JD-p54-F and JD-p54-R sequences

[0049]

[0050] Table 4 PCR amplification system

[0051]

[0052] Table 5 Reaction procedure

[0053]

[0054] After PCR amplification, 1% agarose gel electrophoresis was performed and the target fragment was recovered. Subsequently, EcoRⅠ and XhoI restriction endonucleases were used to double-digest the pCAGGS plasmid. The digestion conditions were 37°C water bath reaction for 3h. The digestion system is shown in Table 6. After the digestion was completed, 1% agarose gel electrophoresis was performed and the target fragment was recovered.

[0055] Table 6 Double enzyme digestion system

[0056]

[0057] The target fragment recovered from the gel was homologously recombined with the vector fragment after double enzyme digestion, and connected using the homologous recombination kit of Nanjing Novozymes Biotech Co., Ltd. The optimal amount of cloning vector used in the recombination reaction system was 0.03 pmol. The corresponding molar number of linearized vector and target fragment can be calculated by the following formula:

[0058] Optimal amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol)

[0059] Optimal amount of insert fragment = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0060] Calculate the volume of linearized vector and target fragment to be added according to the above formula, and prepare the reaction system as shown in Table 7 on ice:

[0061] Table 7 Homologous recombination system

[0062]

[0063] Use a pipette to gently mix the homologous recombination system (do not oscillate to mix), centrifuge briefly, and react at 37°C for 30 minutes; immediately cool on ice to obtain a ligation product.

[0064] The ligation product was transformed into DH5α competent cells. The transformation steps are as follows:

[0065] (1) Take 50 μL of E. coli DH5α competent cells and place on ice for 5 min.

[0066] (2) Take 10 μL of the ligation product and add it to 50 μL of E. coli DH5α competent cells. Mix well by flicking gently and place on ice for 30 min.

[0067] (3) Heat shock in a 42°C water bath for 60 seconds, place on ice for 2-3 minutes, add 750 μL LB medium (without antibiotics), and place on a shaker at 37°C for renaturation for 1 hour.

[0068] (4) Centrifuge at 5000 rpm for 3 min, discard 700 μL of supernatant, spread the remaining bacterial solution on an ampicillin-resistant LB plate, and culture it in a 37°C constant temperature bacterial incubator overnight.

[0069] Colony PCR identification was performed using primers JD-p54-F and JD-p54-R in Table 1. The monoclonal colony with correct identification results was inoculated into 5 mL of LB medium with ampicillin resistance and placed in a constant temperature shaker at 37°C and 220 rpm for 18 h. The plasmid was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The recombinant plasmid with correct sequencing was named pCAGGS-p54.

[0070] 2. Construction of pJEV-CMV-B602L replicon

[0071] According to the complete B602L gene sequence of the ASFV SY-18 strain (GenBank: MH766894.3) published on NCBI, it was sent to Nanjing GenScript Biotech Co., Ltd. for optimization and synthesis for Homo sapiens cells. The pJEV-CMV-EGFP replicon plasmid was previously constructed and preserved by our laboratory.

[0072] The construction method of pJEV-CMV-EGFP was constructed according to the method in the literature: (Xia Qiqi. Analysis of the virulence of Japanese encephalitis GⅠ / GⅤ chimeric virus and its cross-protection with GⅠ and GⅢ viruses. 2021), the main difference being that the C53-E478 sequence of the JEV SD12-F120 strain was replaced with the EGFP sequence, and then the CMV promoter and hammerhead ribozyme were introduced at the 5' end of the genome, and the hepatitis deltavirus (HDV) ribozyme and SV40 polyA tailing signal sequence were introduced at the 3' end of the genome, and it was named pJEV-CMV-EGFP.

[0073] In order to replace the GFP gene in the pJEV-CMV-EGFP replicon plasmid with the B602L gene, the pJEV-CMV-EGFP replicon needs to be modified. First, three pairs of specific fusion PCR primers were designed to amplify the complete B602L gene and the pJEV-CMV-EGFP replicon sequences at both ends, wherein PmeI and BspeI restriction sites were added upstream of the first pair of primers and downstream of the third pair of primers, respectively. The primers were synthesized by Shanghai Saiheng Biotechnology Co., Ltd., and their sequence information is shown in Table 8.

[0074] Table 8 Primer sequences

[0075]

[0076]

[0077] The first and third pairs of specific primers in Table 8 were used to amplify the pJEV-CMV-EGFP vector sequence, and the second pair of primers were used to amplify the ASFVB602L gene. The amplification system is shown in Table 9, and the reaction procedure is shown in Table 10.

[0078] Table 9 PCR amplification system

[0079]

[0080] Table 10 Reaction procedure

[0081]

[0082] After PCR amplification, 1% agarose gel electrophoresis was performed, and the target fragments were respectively recovered by gel extraction using EZNA Gel Extraction Kit. Subsequently, fusion PCR was used to fuse fragment 1 (197 bp) and fragment 2 (1704 bp). The fusion PCR reaction system is shown in Table 11, and the reaction procedure is shown in Table 12.

[0083] Table 11 PCR amplification system

[0084]

[0085] Table 12 Reaction procedure

[0086]

[0087] After the reaction is completed, the sample is taken out from the PCR instrument, and 1.5 μL 5utrPmeI and B602LMCST2A are added respectively. After adding the primers, the sample is placed in the PCR instrument for another 25 cycles of amplification. After the amplification is completed, 1% agarose gel electrophoresis is performed, and the target fragment is gel-recovered using EZNA Gel Extraction Kit to obtain fragment 1+2 after PCR fusion. Subsequently, the same method is used to fuse fragments 1+2 and fragment 3 using 5utrPme I and NS1BspeI primers. After the fusion is completed, the target fragment with a total length of 3109 bp containing the B602L gene is obtained, which is named P2A-B602L-T2A.

[0088] The pJEV-CMV-EGFP replicon plasmid and the target fragment (3109 bp) were digested with PmeI restriction endonuclease, respectively, according to the reaction system in Table 13, reacted in a water bath at 37°C for 8 hours, and gel recovered after 1% agarose gel electrophoresis. The recovered vector and the P2A-B602L-T2A fragment were further digested with restriction endonuclease BspeI in the same manner, and the digested products were verified with 1% agarose gel. The results were viewed with a gel imager after 120V30min, and the corresponding target band was cut off, and the target band was recovered and its concentration was measured according to the instructions of the gel recovery kit.

[0089] Table 13 Single enzyme digestion system

[0090]

[0091]

[0092] T4 DNA ligase was used to connect the target fragments, and the volume of each fragment to be added was calculated based on the mass ratio of vector to B602L fragment between 1:3 and 1:10. The connection system was as shown in Table 14, and the connection was carried out in a metal bath at 16°C for 8 hours.

[0093] Table 14T4 DNA ligase ligation system

[0094]

[0095] The ligation product was transformed into DH5α competent cells. The transformation steps are as follows:

[0096] (1) Take 50 μL of DH5α competent cells and place them on ice for 5 min.

[0097] (2) Take 10 μL of the ligation product and add it to 50 μL of DH5α competent cells. Mix well by flicking gently and place on ice for 30 min.

[0098] (3) Heat shock at 42°C in a water bath for 90 seconds, place on ice for 2-3 minutes, add 1 mL of LB medium (without antibiotics), and place on a shaker at 37°C for 1 hour to renature.

[0099] (4) Centrifuge at 4000 rpm for 3 min, discard 900 μL of supernatant, spread the remaining bacterial solution on a kanamycin-resistant LB plate, and culture it in a 37°C constant temperature bacterial incubator overnight.

[0100] Colony PCR identification was performed using the 5utrPmeI and NS1BspeI primers and the second pair of primers in Table 8. The monoclonal colony with the correct identification result was inoculated into 5 mL LB medium containing kanamycin and shaken for 3 h. Subsequently, 2 mL of the bacterial solution was added to a conical flask containing 200 mL LB medium (containing kanamycin) and shaken in a constant temperature shaker at 37°C and 200 rpm for 18 h. The plasmid was extracted using the Tiangen Endotoxin Removal Kit and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The plasmid with the correct sequencing was named pJEV-CMV-B602L.

[0101] 3. Construction of JEV replicon expressing p54 protein (named pJEV-CMV-p54 replicon after successful sequencing)

[0102] Using the pCAGGS-p54 constructed in 1 as a template, an upstream primer containing a BamHI restriction site and a downstream primer containing an XbaI restriction site were designed for p54, and primers AP-p54-F and AP-p54-R were used to amplify the target sequence containing a BamHI restriction site at the 5' end and an XbaI restriction site at the 3' end by PCR. The amplification system is shown in Table 16. The reaction procedure is shown in Table 17. The primers were synthesized by Shanghai Saiheng Biotechnology Co., Ltd., and the sequence information is shown in Table 15. The length of the amplified fragment is 444bp.

[0103] Table 15 Primer sequences

[0104]

[0105] Table 16 PCR amplification system

[0106]

[0107] Table 17 Reaction Procedure

[0108]

[0109] After PCR amplification, 1% agarose gel electrophoresis was performed, and the results were viewed with a gel imager after 130V for 30min, and the corresponding target bands were cut out. The target fragments were respectively recovered by gel recovery kit (EZNA Gel Extraction Kit) and their concentrations were measured. Subsequently, based on the genotype I JEV replicon pJEV-CMV-B602L that can express ASFVB602L constructed in the laboratory in the early stage, pJEV-CMV-B602L was double-digested with two restriction endonucleases, BamHI and XbaI, to obtain two linearized fragments, namely the replicon empty vector with sticky ends at both ends and B602L, as shown in FIG. Figure 2 As shown in (a). The recovered target fragment (target sequence containing a BamHI restriction site at the 5' end and an XbaI restriction site at the 3' end) was double-digested with BamHI and XbaI. The reaction system is as shown in Table 18. The reaction was carried out in a water bath at 37°C for 3 hours. After 1% agarose gel electrophoresis, the double-digested vector and target fragment were recovered and the concentration was measured.

[0110] Table 18 Double enzyme digestion system

[0111]

[0112] T4 DNA ligase was used to connect the target fragments. The connection system is shown in Table 19. The volume of each fragment to be added was calculated based on the mass ratio of the vector to the p54 fragment between 1:3 and 1:10. The connection system is shown in Table 11. The connection was carried out in a metal bath at 16°C for 8 hours to obtain the connection product.

[0113] Table 19T4 DNA ligase ligation system

[0114]

[0115] The ligation product was transformed into E. coli DH5α competent cells. The transformation steps are as follows:

[0116] (1) Take 50 μL of E. coli DH5α competent cells and place on ice for 5 min.

[0117] (2) Take 10 μL of the ligation product and add it to 50 μL of E. coli DH5α competent cells. Mix well by flicking gently and place on ice for 30 min.

[0118] (3) Heat shock in a 42°C water bath for 60 seconds, place on ice for 2-3 minutes, add 750 μL LB medium (without antibiotics), and place on a shaker at 37°C for renaturation for 1 hour.

[0119] (4) Centrifuge at 5000 rpm for 3 min, discard 700 μL of supernatant, spread the remaining bacterial solution on a kanamycin-resistant LB plate, and culture it in a 37°C constant temperature bacterial incubator overnight.

[0120] Use AP-p54-F and AP-p54-R primers in Table 15 for colony PCR identification, inoculate the monoclonal colony with the correct identification result into 5 mL LB medium containing kanamycin and shake culture for 3 h, then take 2 mL of bacterial solution and add it into a conical flask containing 200 mL LB medium (containing kanamycin), shake and culture it in a constant temperature shaker at 37°C and 200 rpm for 18 h, use Tiangen Endotoxin Removal Kit to extract the plasmid and send it to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the plasmid with the correct sequencing is named pJEV-CMV-p54.

[0121] The sequence of the obtained pJEV-CMV-p54 replicon plasmid is shown as SEQ ID NO.1, and the sequence of the p54 intracellular region protein expressed by the pJEV-CMV-p54 replicon plasmid is shown as SEQ ID NO.2.

[0122] Example 2 Identification of pJEV-CMV-p54 Replicon

[0123] 1. Colony PCR Identification of pJEV-CMV-p54

[0124] The AP-p54-F and AP-p54-R primers in Table 15 were used to perform colony PCR identification on the pJEV-CMV-p54 replicon colonies in Example 1. The amplification system is shown in Table 20, and the reaction procedure is shown in Table 21. The identification results are shown in Table 21. Figure 2As shown in (b), a fragment of the size of the p54 gene (396bp) was obtained. The monoclonal colony with the correct identification result was inoculated into 5mL LB medium containing kanamycin and shaken for 3h. Subsequently, 2mL of the bacterial solution was added to a conical flask containing 200mL LB medium (containing 50mg / ml kanamycin) and shaken in a constant temperature shaker at 37℃ and 200rpm for 18h. The plasmid was extracted using the Tiangen Endotoxin Extraction Kit and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The plasmid with the correct sequencing was named pJEV-CMV-p54.

[0125] Table 20 PCR amplification system

[0126]

[0127] Table 21 Reaction procedure

[0128]

[0129] 2. pJEV-CMV-p54 double restriction enzyme digestion identification

[0130] 1 μg of the plasmid successfully sequenced was taken and double-digested with restriction endonucleases BamHI and XbaI for identification. The double-digestion system was as shown in Table 14. The digestion was performed at 37° C. for 1 h and the identification was performed by 1% agarose gel electrophoresis.

[0131] Table 22 Double enzyme digestion system

[0132]

[0133] Agarose gel electrophoresis results Figure 2 As shown in (c) in Figure 2 As can be seen from C in the figure, a JEV replicon linear backbone with a fragment size of 11993 bp and a p54 gene with a fragment size of about 396 bp were obtained.

[0134] 3. IFA identification of pJEV-CMV-p54 (immunofluorescence identification)

[0135] Take 4 μg of pJEV-CMV-p54 plasmid and use Lipofectamine TM 3000Reagent transfection reagent was transiently transfected into 293T cells, and pJEV-CMV-EGFP replicon was transfected as a positive control group, and the Mock group was used as a negative control group. The transfection steps were as follows:

[0136] (1) 293T cells were passaged to a six-well plate. Cell culture slides had been added to the six-well plate in advance. The cells were grown in high-glucose DMEM containing 10% FBS and 1% SP until the density reached 50-60%, and then transfected.

[0137] (2) Dilution of pJEV-CMV-p54 plasmid (Solution A): Add 8 μL P3000TM Reagent (transfection reagent) to 250 μL Opti-MEM medium without fetal bovine serum and antibiotics, then add 4 μg pJEV-CMV-p54 plasmid, vortex to mix, centrifuge briefly, and let stand for 5 min.

[0138] (3) Lipofectamine TM Dilution of 3000 Reagent transfection reagent (Solution B): Take 6 μL Lip3000 transfection reagent and add it to 250 μL Opti-MEM medium, vortex to mix, centrifuge instantly, and let it stand for 5 minutes.

[0139] (4) Mix solution A and solution B and let it stand for 20 minutes. After standing, discard the culture medium in the six-well plate, add 1.5mL Opti-MEM culture medium, and then drop the mixture of solution A and solution B into the six-well plate. Gently shake the cell plate to evenly distribute the liquid. After standing for 6 hours in a 37°C, 5% CO2 constant temperature incubator, replace the medium with high-glucose DMEM containing 2% FBS and 1% SP, and continue to stand for 48 hours in a 37°C, 5% CO2 constant temperature incubator.

[0140] The cells cultured for 48 hours after transfection were taken out for indirect immunofluorescence identification. The specific steps are as follows:

[0141] (1) Discard the original culture medium from the wells containing the cells, add 1 ml of 4% paraformaldehyde (PFA) to each well, and fix at 4°C for 30 min.

[0142] (2) After discarding the 4% paraformaldehyde, add 500 μL of permeabilization buffer (1% NP40-PBS) to each well and permeabilize for 15 min at room temperature.

[0143] (3) After discarding the 1% NP40, add 1 ml of PBS to each well and rinse three times.

[0144] (4) Add 1 ml of blocking solution (7% bovine serum albumin BSA + 1% fetal calf serum + 0.05% sodium azide - PBS) to each well and block for 30 min at room temperature.

[0145] (5) Add 500 μL of a mixture of mouse HA tag monoclonal antibody (1:200 dilution) and rabbit JEVNS1 protein monoclonal antibody (1:200 dilution) (500 μL of liquid contains 2.5 μL of mouse HA tag monoclonal antibody stock solution and 2.5 μL of rabbit JEVNS1 protein monoclonal antibody stock solution), incubate at room temperature for 1 hour, discard the primary antibody and wash three times with PBS on a shaker, each time for 5 minutes.

[0146] (6) Add 500 μL of a mixture of Alexa Fluor 488-labeled goat anti-mouse IgG (1:400 dilution) and Alexa Fluor 594-labeled goat anti-rabbit IgG (1:400 dilution), incubate at room temperature in the dark for 1 h, discard the secondary antibody and wash three times with PBS on a shaker in the dark, each wash for 5 min.

[0147] (7) Add 500 μL of DAPI nuclear staining solution to each well at room temperature in the dark to stain the cell nucleus, incubate at room temperature in the dark for 15 min, and wash three times with PBS in the dark.

[0148] (8) Observe the results under an inverted fluorescence microscope and set normal cells as negative control.

[0149] The identification results are as follows Figure 3 As shown, 293T cells transfected with pJEV-CMV-p54 can be recognized by HA antibodies to produce specific green fluorescence signals, and the NS1 protein (structural protein on the JEV replicon backbone) in the JEV replicon vector containing p54 can be recognized by NS1 antibodies to produce specific red fluorescence signals, and the green fluorescence signal and the red fluorescence signal appear simultaneously in the same cell, indicating that p54 can be efficiently expressed using the JEV replicon backbone.

[0150] 4. Western Blot Identification of pJEV-CMV-p54

[0151] 4 μg of pJEV-CMV-p54 plasmid was used to TM 3000Reagent transfection reagent was transiently transfected into 293T cells, and pJEV-CMV-EGFP replicon was transfected as a positive control group, and the Mock group was used as a negative control group. The transfection steps were as follows:

[0152] (1) 293T cells were passaged to a six-well plate. Cell culture slides had been added to the six-well plate in advance. The cells were grown in high-glucose DMEM containing 10% FBS and 1% SP until the density reached 50-60%, and then transfected.

[0153] (2) Dilution of pJEV-CMV-p54 plasmid (solution A): 8 μL P3000 TM Reagent was added to 250 μL of Opti-MEM medium without serum and antibiotics, followed by 4 μg of pJEV-CMV-p54 plasmid, vortexed to mix, centrifuged instantaneously, and allowed to stand for 5 min.

[0154] (3) Lipofectamine TMDilution of Lip3000 transfection reagent (liquid B): add 6 μL of Lip3000 transfection reagent to 250 μL of Opti-MEM culture medium, vortex to mix, centrifuge instantly, and let stand for 5 minutes.

[0155] (4) Mix solution A and solution B and let it stand for 20 minutes. After standing, discard the culture medium in the six-well plate, add 1.5mL Opti-MEM culture medium, and then drop the mixture of solution A and solution B into the six-well plate. Gently shake the cell plate to evenly distribute the liquid. After standing for 6 hours in a 37°C, 5% CO2 constant temperature incubator, replace the medium with high-glucose DMEM containing 2% FBS and 1% SP, and continue to stand for 48 hours in a 37°C, 5% CO2 constant temperature incubator.

[0156] Take out the cells cultured for 48 hours after transfection for Western Blot. The specific steps are as follows:

[0157] (1) After 48 h of culture, discard the culture medium, wash the cell plate twice with PBS, add 600 μL of PBS and scrape the cells with a cell scraper. Collect the scraped cells into a 1.5 ml centrifuge tube.

[0158] (2) After centrifugation at 12000 rpm for 3 min, the supernatant was discarded, and lysis buffer containing 1% protein inhibitor was added. After mixing by pipetting, ultrasonic lysis was performed using an ultrasonic disruptor (25% power, instantaneous lysis).

[0159] (3) After sonication, centrifuge at 12,000 rpm for 10 min at 4°C. Transfer the supernatant to a new 1.5 mL centrifuge tube and add 5× SDS Loading Buffer by volume. Mix well and boil for 10 min.

[0160] (4) Prepare gel: Prepare 15% SDS-PAGE separation gel according to Table 23. After the separation gel solidifies, prepare 5% SDS-PAGE concentration gel according to Table 24. Then insert the sample comb and wait for it to solidify before use.

[0161] Table 2315% SDS-PAGE separation gel recipe

[0162]

[0163] Table 2 Recipe for 45% SDS-PAGE stacking gel

[0164]

[0165] SDS-PAGE electrophoresis was performed using 15% polypropylene gel. After loading the sample, the voltage was kept constant at 80 V for 30 min, then the voltage was adjusted to 120 V and the gel was run for another 90 min.

[0166] Transfer: Use wet transfer method for transfer. After electrophoresis, take out the gel and transfer the protein bands to the NC membrane. Place them in the order of sponge-three-layer filter paper-separation gel-NC membrane-three-layer filter paper-sponge, and place them in the transfer tank. Add ice box and prepared 1× transfer solution, and transfer at 240mA constant current for 120min.

[0167] Blocking: After the transfer, the NC membrane was taken out, and blocking solution (5% skim milk) was added, and the membrane was placed on a shaker for blocking at room temperature for 3 hours. After the blocking was completed, it was rinsed three times with TBST.

[0168] (10) Incubation with primary antibody: Use rabbit HA tag polyclonal antibody (1:2000 dilution) or rabbit JEVNS1 protein polyclonal antibody (1:2000 dilution) as the primary antibody and incubate overnight on a shaker at 4°C. After incubation, wash three times with TBST on a shaker for 10 min each time.

[0169] (11) Incubation with secondary antibody: Use HRP-labeled goat anti-rabbit antibody (1:10000 dilution) as the secondary antibody and incubate on a shaker at room temperature for 50 min. After incubation, wash three times with TBST on a shaker, each time for 10 min.

[0170] (12) After completion, the gel imaging system was used to expose and analyze the results.

[0171] Western blot results Figure 4 As shown by Figure 4 It can be seen that the expression of p54 protein with HA tag was detected in cells transfected with pJEV-CMV-p54 replicon plasmid, and the size was about 18kDa. At the same time, the expression of NS1 protein on the pJEV-CMV-p54 replicon vector was detected, and the size of NS1 was about 40kDa and 55kDa. Figure 4 As shown in C, the expression of p54 was detected by using positive serum of African swine fever, and it was found that the positive serum of African swine fever could also specifically identify the expression of p54 in the replicon vector. The above results show that ASFVp54 protein can be expressed in JEV replicon vector, and the GI JEV replicon vector pJEV-CMV-p54 capable of expressing ASFV p54 protein was successfully constructed.

[0172] SEQ ID NO.1:

[0173]

[0174] SEQ ID NO.2:

[0175] TCTTCAAGAAAGAAAAAAGCTGCTGCTATTGAGGAGGAAGATATACAGTTTATAAATCCTTATCAAGATCAGCAGTGGGTAGAAGTCACTCCACAACCAGGTACCTCTAAACCAGCTGGAGCGACTACAGCAAGTGTAGGCAAGCCAGTCACGGGCAGACCGGCAACAAACAGACCAGCAACAAACAAACCAGTTACG GACAACCCAGTTACGGACAGACTAGTCATGGCAACTGGCGGCCGGCGGCCGCACCTGCGGCCGCGAGTGCTCCTGCTCATCCGGCTGAGCCTTACACGACAGTCACTACTCAGAACACTGCTTCACAAACAATGTCGGCTATTGAAAATTTACGACAAAGAAACACCTATACGCATAAAGACCTAGAAAACTCCTTG

[0176] From the above examples, it can be seen that the present invention provides a pJEV-CMV-p54 replicon plasmid and a preparation method thereof. The pJEV-CMV-p54 replicon plasmid of the present invention can efficiently express p54 intracellular region protein, indicating that the replicon vector pJEV-CMV-p54 is successfully constructed.

[0177] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. pJEV-CMV-p54 replicon plasmid, characterized in that The nucleic acid sequence of the replicon plasmid is shown in SEQ ID NO.

1.

2. The pJEV-CMV-p54 replicon plasmid according to claim 1, characterized in that The replicon plasmid includes a nucleic acid sequence encoding the African swine fever virus p54 intracellular region protein as shown in SEQ ID NO.

2.

3. The pJEV-CMV-p54 replicon plasmid according to claim 2, characterized in that The primer set used to amplify the nucleic acid sequence encoding the African swine fever virus p54 intracellular region protein in the replicon plasmid includes a forward primer JD-p54-F and a reverse primer JD-p54-R, the sequence of the forward primer JD-p54-F is shown in SEQ ID NO.3, and the sequence of the reverse primer JD-p54-R is shown in SEQ ID NO.

4.

4. The method for preparing the pJEV-CMV-p54 replicon plasmid according to claim 1, characterized in that: The following steps are involved: S1. Connect the nucleic acid sequence described in SEQ ID NO. 2 between the EcoRI and XhoI restriction sites of the pCAGGS plasmid to construct the eukaryotic expression plasmid pCAGGS-p54; S2. Construction of pJEV-CMV-B602L replicon; S3. Using the eukaryotic expression plasmid pCAGGS-p54 described in S1 as a template, amplify the target fragment containing BamHI at the 5' end and XbaI at the 3' end, wherein the target fragment contains the sequence of SEQ ID NO.2; S4. The pJEV-CMV-B602L plasmid and the target fragment described in S3 were double-digested with BamHI and XbaI restriction endonucleases, respectively, and then connected to obtain the pJEV-CMV-p54 replicon plasmid; The preparation method of the pJEV-CMV-B602L replicon plasmid comprises the following steps: (1) Designing the first pair of primers and the third pair of primers to amplify the pJEV-CMV-EGFP plasmid sequence, respectively, adding a Pme I restriction site upstream of the first pair of primers to amplify fragment 1; adding a Bspe I restriction site downstream of the third pair of primers to amplify fragment 2; (2) Designing a second pair of primers to amplify the B602L gene of the ASFV virus to obtain fragment 3; (3) Fragment 1 and fragment 2 are fused by PCR to obtain fusion fragment 1+2; (4) PCR fusion of fusion fragment 1+2 and fragment 3 to obtain P2A-B602L-T2A fragment; (5) using Pme I restriction endonuclease to perform single restriction digestion on the pJEV-CMV-EGFP replicon plasmid and the P2A-B602L-T2A fragment, respectively, to recover the vector 1 and the B602L fragment; (6) digesting vector 1 with endonuclease Bspe I to obtain vector 2, which was then ligated with the B602L fragment to obtain pJEV-CMV-B602L; The sequences of the first pair of primers are as SEQ ID No.5 and SEQ ID No.6; The sequences of the second pair of primers are as SEQ ID No.7 and SEQ ID No.8; The sequences of the third pair of primers are SEQ ID No.9 and SEQ ID No.

10.

5. The preparation method according to claim 4, characterized in that: The forward primer for amplifying the target fragment in step S3 is AP-p54-F, whose sequence is as described in SEQ ID NO.11; the reverse primer is AP-p54-R, whose sequence is as described in SEQ ID NO.

12.

6. The preparation method according to claim 5, characterized in that: In step (6), the molar ratio of the vector 2 to the B602L fragment is 1:3 to 1:10.

Images