An Agrobacterium-mediated genetic transformation method for Erianthus fulvus in sugarcane complex

By optimizing the induction and vacuum penetration of the embryonic callus tissue of the cane, combined with Agrobacterium mediation technology, the genetic transformation problem of the sugarcane complex was solved, efficient genetic transformation of the cane complex was achieved, and the functional gene research and variety improvement of the sugarcane complex were promoted.

CN118147220BActive Publication Date: 2025-07-04YUNNAN AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410324599.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-21
Publication Date
2025-07-04
Estimated Expiration
2044-03-21

AI Technical Summary

Technical Problem

The genetic background of sugarcane complex plants is complex and lacking an efficient genetic transformation system, which leads to lag in functional gene research and makes it difficult to explore and utilize the main effect genes of the target traits. As the only diploid species in the sugarcane complex, its excellent traits have not been effectively utilized.

Method used

By optimizing the induction system of the embryonic callus of the cane, selecting plant expression vectors marked with herbicide-resistant Bar gene or hygromycin-resistant hpt gene, preparing engineered bacterial infiltration solution, combining vacuum infiltration, callus recovery culture and subsequent screening, Agrobacterium-mediated genetic transformation of the cane cane is achieved.

Benefits of technology

The genetic transformation system of cane grass was successfully constructed, with a transformation efficiency of 14.21%, providing a model plant for the study of functional genes of sugarcane complexes and promoting the genetic improvement of sugarcane varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118147220B_ABST
    Figure CN118147220B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for Agrobacterium-mediated genetic transformation of Erianthus fulvus in sugarcane complex, belonging to the technical field of plant tissue culture and genetic transformation. Through Agrobacterium-mediated transformation, the present invention develops a genetic transformation system for diploid Erianthus fulvus in sugarcane complex. By optimizing the callus induction medium of Erianthus fulvus, the embryogenicity of Erianthus fulvus callus is improved; through vacuum infiltration, the infection intensity of Erianthus fulvus callus is strengthened; through the recovery culture and subculture screening culture of callus, the transformation efficiency is increased. Using the genetic transformation method of the present invention, when transforming 70-90 pieces of embryogenic callus of Erianthus fulvus, 10-14 transgenic lines can be obtained, and the transformation efficiency is as high as 14.21%. The present invention constructs a genetic transformation system for Erianthus fulvus for the first time, laying a foundation for further developing Erianthus fulvus into a model plant of sugarcane complex and providing technical support for carrying out research on functional genes of sugarcane complex.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant tissue culture and genetic transformation, and particularly to an Agrobacterium-mediated genetic transformation method for Erianthus fulvus in the sugarcane complex. Background Art

[0002] Sugarcane (Saccharum officinarum L.) contributes 80% of the world's sugarcane production and 40% of fuel ethanol, and is an important economic crop for both sugar and energy. Modern sugarcane cultivars are selected from the main species within the genus Saccharum through "interspecific hybridization" and "noble breeding", so they are allopolyploid plants with complex genetic backgrounds [Chai Jin, Yu Fan, Xie Shuwei, et al. Research progress on molecular cytogenetics in the noble breeding of Saccharum spontaneum L. [J]. Acta Agriculturae Boreali-Sinica, 2019, 34(S1): 386-393]. However, the blood relationship of current sugarcane cultivars mainly comes from 2-3 species / protoplasts within the genus Saccharum, and their genetic backgrounds are narrow. Exploring and utilizing germplasm resources with excellent traits is an important direction to break through the bottleneck of "poor germplasm and narrow genetic basis" in sugarcane varieties.

[0003] Erianthus fulvus is a wild species of the genus Erianthus in the sugarcane complex, with excellent traits such as cold tolerance, drought resistance, barren tolerance, strong tillering ability, and high brix. Erianthus fulvus has important value in sugarcane breeding and has been successfully used in distant hybridization breeding of sugarcane, which enriches the blood relationship and genetic diversity of sugarcane hybrids [Zhang Zhen. Success in breeding "high-altitude sugarcane" [J]. Agricultural Knowledge, 2006(13): 9]. However, the long breeding period and high cost of hybridization breeding greatly limit the breeding process of sugarcane varieties. The development of transgenic technology has brought opportunities for sugarcane transgenic breeding, and a few sugarcane varieties have been used in genetic transformation research [Li Chunjia, Liu Xinlong, Li Xujuan, et al. An efficient Agrobacterium-mediated genetic transformation method for sugarcane callus [P]. Yunnan Province: CN114774464B, 2023-09-12.]. Nevertheless, the genetic backgrounds of most sugarcane complex plants are complex and can resist the integration of foreign genes, making it difficult to mine the major genes of target traits and the functional analysis technical system is not mature, which has led to a serious lag in the sugarcane transgenic breeding process.

[0004] Although Erianthus fulvus has many excellent traits, including the main target traits for sugarcane variety improvement such as cold tolerance, drought resistance, barren tolerance, and high brix. However, what are the key genes regulating these traits and the key genes of E. fulvus that can be used to improve the defects of sugarcane varieties? What is the specific expression regulation mechanism? All along, these important scientific questions have restricted the effective utilization of E. fulvus resources. Solving these scientific questions requires an effective genetic transformation system for E. fulvus to provide genetic manipulation techniques for genomic research on its functional genes. In addition, due to the lack of an efficient genetic transformation system in the sugarcane complex, the systematic analysis of its functional genes has been restricted. E. fulvus is the only diploid species in the sugarcane complex, and its genome is also the smallest, making it the best model plant for functional gene research in the sugarcane complex [Ling K, Aasim M, Xianhong W, et al. A chromosome-level genome assembly for Erianthus fulvus provides insights into its biofuel potential and facilitates breeding for improvement of sugarcane[J]. Plant communications, 2023, 4(4):100562-100562]. Therefore, in view of the excellent traits and genomic characteristics of E. fulvus, developing an efficient genetic transformation system for E. fulvus to promote genetic manipulation of functional genes in the sugarcane complex can bring an ideal model species for functional gene research in the sugarcane complex, and also promote the exploration of functional genes related to agronomic traits of E. fulvus and the research on its mechanisms, providing a theoretical basis and technical support for genetic improvement of sugarcane varieties.

[0005] Plant tissue culture is the basis of genetic transformation technology. In previous studies, a tissue culture and regeneration system for E. fulvus has been established [Li Fusheng, Yang Qinghui, Xiao Fengjiong, et al. Study on callus induction and differentiation of Erianthus rufipilus[J]. Sugarcane, 1998, (01):1-3.]. However, there is still a lack of a genetic transformation system for E. fulvus. Summary of the Invention

[0006] The object of the present invention is to provide an Agrobacterium-mediated genetic transformation method for Erianthus fulvus in sugarcane complex, so as to solve the problems existing in the above-mentioned prior art. By optimizing the induction system of embryogenic callus of Erianthus fulvus, selecting a plant expression vector with a herbicide-resistant Bar gene marker or a hygromycin-resistant hpt gene marker, preparing an engineering bacteria infection solution, optimizing the infection conditions of Erianthus fulvus callus, strengthening the restoration of embryogenicity of callus after Agrobacterium infection and the screening system of resistant callus, the genetic transformation of Erianthus fulvus callus mediated by Agrobacterium is finally realized, and transgenic Erianthus fulvus is successfully obtained, laying a foundation for further developing Erianthus fulvus into a model plant of sugarcane complex and providing technical support for carrying out research on functional genes of sugarcane complex.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an Agrobacterium-mediated genetic transformation method for Erianthus fulvus in sugarcane complex, comprising the following steps:

[0009] Step 1: Inoculate the young tender heart leaves of Erianthus fulvus into the callus induction medium CIM for culture, and transfer the obtained callus to the CIM medium again for subculture to obtain embryogenic callus;

[0010] Step 2: Select a plant expression vector carrying a herbicide-resistant Bar gene marker or a hygromycin-resistant hpt gene marker, transform the plant expression vector into Agrobacterium competent cells, and screen positive colonies carrying the plant expression vector, which are engineering bacteria;

[0011] Step 3: Inoculate the engineering bacteria into the YEP medium, expand the culture, centrifuge to collect the bacterial cells, and suspend them with the resuspension solution RS to prepare an infection solution containing the engineering bacteria;

[0012] Step 4: Transfer the embryogenic callus obtained in Step 1 to the infection solution containing the engineering bacteria for culture, then perform vacuum filtration and shaking culture, and transfer the cultured callus to the callus co-culture medium CCM for co-culture; after the co-culture is completed, transfer the callus to the recovery medium CRM for recovery culture;

[0013] Step 5: Transfer the callus after the recovery culture to the callus subculture screening medium CRSM for subculture screening to obtain resistant callus; transfer the resistant callus to the callus differentiation screening medium CDSM for differentiation screening to obtain resistant buds;

[0014] Step 6: After the resistant buds are rooted and identified by PCR, positive transgenic seedlings are obtained;

[0015] Among them, the callus induction medium CIM comprises the following components in the following concentrations: MS + 25 - 30 g / L of sucrose + 1 - 2 mL of sugarcane vitamins + 25 - 50 mL of coconut water + 0.3 - 0.5 g / L of casein hydrolysate + 0.15 - 0.2 g / L of citric acid + 0.03 - 0.05 g / L of cysteine + 0.1 - 0.2 g / L of inositol + 2 - 3 mg / L of 2,4-D + 1 - 2 mg / L of silver nitrate + 3 - 5 g / L of phytagel;

[0016] The YEP medium comprises the following components in the following concentrations: 10 g / L of yeast extract + 10 g / L of beef extract + 5 g / L of NaCl + 50 mg / L of kanamycin + 50 mg / L of rifampicin;

[0017] The resuspension RS comprises the following components in the following concentrations: 1 / 2 MS + 2 - 5 g / L of glucose + 2 - 5 g / L of maltose + 100 - 200 μM of acetosyringone;

[0018] The callus co-culture medium CCM comprises the following components in the following concentrations: MS + 25 - 30 g / L of sucrose + 1 - 2 mL of sugarcane vitamins + 25 - 50 mL of coconut water + 0.3 - 0.5 g / L of casein hydrolysate + 0.15 - 0.2 g / L of citric acid + 0.03 - 0.05 g / L of cysteine + 0.1 - 0.2 g / L of inositol + 2 - 3 mg / L of 2,4-D + 1 - 2 mg / L of silver nitrate + 100 - 200 μM of acetosyringone + 3 - 5 g / L of phytagel;

[0019] The recovery medium CRM comprises the following components in the following concentrations: MS + 25 - 30 g / L of sucrose + 1 - 2 mL of sugarcane vitamins + 25 - 50 mL of coconut water + 0.3 - 0.5 g / L of casein hydrolysate + 0.15 - 0.2 g / L of citric acid + 0.03 - 0.05 g / L of cysteine + 0.1 - 0.2 g / L of inositol + 2 - 3 mg / L of 2,4-D + 1 - 2 mg / L of silver nitrate + 3 - 5 g / L of phytagel + 300 - 400 mg / L of cefamycin;

[0020] The callus subculture screening medium (CRSM medium) comprises the following components at the following concentrations: MS + 25 - 30 g / L sucrose + 1 - 2 mL sugarcane vitamins + 25 - 50 mL coconut water + 0.3 - 0.5 g / L casein hydrolysate + 0.15 - 0.2 g / L citric acid + 0.03 - 0.05 g / L cysteine + 0.1 - 0.2 g / L inositol + 2 - 3 mg / L 2,4-D + 1 - 2 mg / L silver nitrate + 3 - 5 g / L phytagel + 300 - 400 mg / L cefamycin + 2 - 3 mg / L herbicide basta or 25 - 30 mg / L hygromycin;

[0021] The callus differentiation screening medium (CDSM) comprises the following components at the following concentrations: MS + 25 - 30 g / L sucrose + 1 - 2 mL sugarcane vitamins + 25 - 50 mL coconut water + 0.15 - 0.2 g / L citric acid + 0.03 - 0.05 g / L cysteine + 0.1 - 0.2 g / L inositol + 1 - 2 mg / L 6-BA + 3 - 5 g / L phytagel + 300 - 400 mg / L cefamycin + 2 - 3 mg / L herbicide basta or 25 - 30 mg / L hygromycin;

[0022] The sugarcane vitamins contain: 1 g vitamin B1, 0.5 g vitamin B6, 0.5 g nicotinic acid, 2 g glycine, 50 g arginine and 1 L water.

[0023] Further, in step 1, the conditions for the culture are dark culture at 28°C for 20 - 30 d; the number of subculture times is two, and the conditions for each subculture are dark culture at 28°C for 15 - 20 d.

[0024] Further, in step 2, the plant expression vector is transformed into Agrobacterium EHA105 competent cells, and then spread on YEP solid medium. After dark culture at 28°C for 48 h, positive colonies carrying the plant expression vector are screened.

[0025] Further, in step 3, after suspension with the resuspension solution RS, shake the bacteria in the dark for 3 - 5 h for activation culture.

[0026] Further, in step 4, the conditions for both the culture and the shaking culture are shaking culture at 90 rpm in the dark for 10 min; the conditions for the vacuum filtration are filtration under 0.7 Mpa vacuum for 5 min.

[0027] Further, in step 5, the time for subculture screening culture is 10 - 20 d; the time for differentiation screening culture is 20 - 30 d.

[0028] Further, in step 6, the resistant buds are first transferred to the subculture screening medium DSM for adventitious buds for secondary screening culture, and then transferred to the rooting screening medium DRSM for adventitious buds for rooting screening culture.

[0029] Further, the subculture screening medium DSM for adventitious buds contains the following concentration components: MS + sucrose 25 - 30 g / L + 6 - BA 2 - 3 mg / L + NAA 0.6 - 1 mg / L + phytagel 3 - 5 g / L + activated carbon 0.1 - 0.2 g / L + cefotaxime 300 - 400 mg / L + herbicide basta 2 - 3 mg / L or hygromycin 25 - 30 mg / L; the rooting screening medium DRSM for adventitious buds contains the following concentration components: MS + sucrose 25 - 30 g / L + 6 - BA 0.6 - 1 mg / L + NAA 2 - 3 mg / L + phytagel 3 - 5 g / L + activated carbon 0.1 - 0.2 g / L + cefotaxime 300 - 400 mg / L + herbicide basta 2 - 3 mg / L or hygromycin 25 - 30 mg / L.

[0030] Further, the young tender heart leaves of Erianthus fulvus are prepared as follows: Take the stem tip with leaf sheath part of Erianthus fulvus at the seedling stage, after surface disinfection, peel off the outer leaf sheath, and cut the young tender heart leaves 0 - 3 cm near the growth point into small pieces 0.5 - 1 cm long.

[0031] Further, the plant expression vector carrying the herbicide - resistant Bar gene marker contains the PCAMBIA3301 plant expression vector; the plant expression vector carrying the hygromycin - resistant hpt gene marker contains the Pu1300 vector.

[0032] The present invention discloses the following technical effects:

[0033] In order to solve the problem of difficult genetic transformation of the sugarcane complex and the lack of a suitable model plant for functional gene research, the present invention developed a genetic transformation system for diploid Erianthus fulvus of the sugarcane complex through Agrobacterium-mediated transformation. By optimizing the callus induction medium of Erianthus fulvus, the embryogenicity of the callus of Erianthus fulvus was improved; through vacuum infiltration, the infection intensity of the callus of Erianthus fulvus was strengthened; through the recovery culture and subculture screening culture of the callus, the transformation efficiency was increased; finally, the optimal scheme suitable for the genetic transformation of Erianthus fulvus was determined, and the scheme of the present invention is applicable to the vector skeletons with herbicide resistance Bar gene and hygromycin resistance hpt gene as screening markers. Using the method of the present invention, when transforming 70 - 90 embryogenic calli of Erianthus fulvus, 10 - 14 transgenic lines can be obtained, and the transformation efficiency is as high as 14.21%.

[0034] The present invention constructs a genetic transformation system for Erianthus fulvus for the first time, laying a foundation for further developing Erianthus fulvus into a model plant of the sugarcane complex and providing technical support for carrying out functional gene research on the sugarcane complex. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0036] Figure 1 It is the Agrobacterium-mediated genetic transformation system of Erianthus fulvus callus of the present invention; A: embryogenic callus of Erianthus fulvus; B: screening of green fluorescent GFP protein of resistant callus, the red arrow indicates the GFP signal; C: screening of herbicide basta for differentiating resistant buds from resistant callus; D: subculture proliferation screening of herbicide basta for resistant buds; E: rooting screening of herbicide basta for resistant seedlings; F: bar gene immunostrip detection of leaf tissues of resistant seedlings, the strip WT represents non-transgenic lines, and the strips 1 - 10 represent transgenic lines; G: PCR detection of Bar gene of resistant seedlings, the expected target fragment is 430 bp, the lane M is MarkerD2000, the lane P is the positive control (plasmid), the lane WT is the non-transgenic line, and the lanes 1 - 20 are resistant seedling lines; H: PCR detection of hpt gene of resistant seedlings, the expected target fragment is 274 bp, the lane M is MarkerD2000, the lane P is the positive control (plasmid), the lane WT is the non-transgenic line, and the lanes 1 - 20 are resistant seedling lines;

[0037] Figure 2 It is the plasmid map of the PCAMBIA3301 plant expression vector;

[0038] Figure 3 Plasmid map of Pu1300 vector. Detailed implementation manners

[0039] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0040] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0041] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0042] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0043] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0044] Research idea of the present invention:

[0045] Due to the complex genetic background, most plants in the sugarcane complex, especially those in the genus Saccharum, resist the introduction of foreign DNA. This has led to a serious lag in the research on functional genes of sugarcane complex plants, especially the serious shortage in the mining and utilization of genes for important traits. Erianthus arundinaceus is the only diploid species in the sugarcane complex, and its excellent agronomic traits have important value in sugarcane breeding. At present, it is necessary to develop a genetic transformation system for Erianthus arundinaceus to provide an ideal model species for the research on functional genes of the sugarcane complex and to provide theoretical and technical support for the genetic improvement of sugarcane varieties. Therefore, after a series of repeated screening, optimization and verification in the early stage, the present invention has developed an efficient genetic transformation system for Erianthus arundinaceus: by adding vitamins, antioxidants and coconut water to the callus induction medium, the induction rate of embryogenic callus is increased; by vacuum infiltration, the infection intensity of callus is strengthened; by the recovery culture and subculture screening culture of callus after Agrobacterium infection, the transformation efficiency is increased. Finally, the present invention has realized the efficient genetic transformation of the diploid wild species Erianthus arundinaceus in the sugarcane complex mediated by Agrobacterium. The specific research is as follows:

[0046] Example 1

[0047] Step 1, induction of embryogenic callus of Erianthus arundinaceus: Take the shoot tip with leaf sheath part of the 'Erianthus arundinaceus 99-1' clone (provided by the Sugarcane Research Institute of Yunnan Agricultural University, collected and conserved in Kunming in 1999, recorded in the literature "Identification of Cold Tolerance at Seedling Stage of 7 Wild Species of Erianthus arundinaceus and Their Progeny Materials"), surface disinfect it with 75% ethanol, peel off the outer leaf sheath, cut the young tender heart leaves 0-3 cm near the growth point into small pieces 0.5-1 cm long, and inoculate them onto the callus induction medium CIM, and culture them in the dark at 28 °C for 20-30 d to induce callus. Cut the obtained callus and transfer it to the CIM medium for the first subculture for 15-20 d to obtain embryogenic callus with dry surface, good granularity, light yellow or white color ( Figure 1 A in). Select the embryogenic callus with better growth state and inoculate it onto the same CIM medium for the second subculture, and also obtain embryogenic callus equivalent to that of the first subculture. The conditions for the first and second subcultures are both culturing in the dark at 28 °C. Select the embryogenic callus from the first and second subcultures for subsequent genetic transformation.

[0048] The components of the CIM medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel (purchased from coolaber, product number CP8581Z).

[0049] The sugarcane vitamin component is as follows: add 1 g of vitamin B1, 0.5 g of vitamin B6, 0.5 g of nicotinic acid, 2 g of glycine, and 50 g of arginine into 1 L of pure water respectively. The same applies hereinafter.

[0050] Step 2, construction of plant expression vector and preparation of engineering bacteria: Construct the PCAMBIA3301 plant expression vector, whose T-DNA region consists of two double-expression cassettes of 35S::Bar::PolyA and 35S::GFP::NOS ( Figure 2 ). The process of vector construction is as follows: Use NcoⅠ and BstEⅡ restriction endonucleases to perform double digestion on the PCAMBIA3301 plasmid (presented by the Institute of Potato Crops, Yunnan Agricultural University), and use gel recovery and purification as the linearized vector; Design homologous recombination primers for the GFP gene (F: acgggggactcttgaccatggATGTGTATCGTGAAGGGCGAG and R: ggggaaattcgagctggtcaccTCAGTAGAGCTCGTCCATGCC) for PCR amplification (use the PrimeSTAR GXL DNA Polymerase enzyme of Takara Company for PCR amplification, and the system and program refer to the instruction manual No. R051A), and use gel recovery and purification as the target fragment; Use homologous recombinase to ligate the linearized vector and the target fragment to construct the PCAMBIA3301 plant expression vector. Transform the competent cells of Agrobacterium tumefaciens EHA105 with the said vector, coat the YEP solid medium, and after culturing in the dark at 28 °C for 48 h, pick single colonies for PCR positive colony detection. Inoculate the positive colonies into the YEP liquid medium and shake the bacteria in the dark at 28 °C to obtain engineering bacteria.

[0051] The composition of the said YEP medium is as follows: yeast extract 10 g / L + beef extract 10 g / L + NaCl 5 g / L + kanamycin 50 mg / L (bacterial resistance) + rifampicin 50 mg / L (bacterial resistance) (solid: add agar powder 15 g / L). The same applies hereinafter.

[0052] Step 3, preparation of engineering bacteria infection solution: Inoculate the engineering bacteria into the YEP medium, expand the culture until the OD 600 value is 0.4 - 0.6, centrifuge at 5000 rpm to collect the bacterial cells, and suspend them with the resuspension solution RS to prepare an infection solution containing engineering bacteria, and shake the bacteria in the dark and activate the culture for 3 h.

[0053] The composition of the said resuspension solution RS is as follows: 1 / 2 MS + glucose 2 g / L + maltose 2 g / L + acetosyringone 100 μM.

[0054] Step 4, Infection of Erianthus fulvus callus: Pick Erianthus fulvus embryogenic callus with a diameter of 0.2 - 0.5 cm on a super-clean bench, place it on sterile filter paper, and blow it with gentle wind for 30 min to make its surface slightly dry. Further, transfer the slightly dry callus to the activated infection solution, culture it with shaking at 90 rpm in the dark for 10 min, then transfer it to a vacuum filtration at 0.7 Mpa for 5 min, and then culture it with shaking at 90 rpm in the dark for 10 min. Then, transfer the callus to sterile filter paper, absorb the bacterial liquid on the surface of the callus, blow it dry with gentle wind for 30 min, and transfer it to the callus co-culture medium CCM for co-culture for 3 d. After the co-culture is completed, transfer the callus to soak and rinse in sterile water 6 - 8 times, place it on sterile filter paper to absorb the moisture, blow it with gentle wind for 30 min to make its surface slightly dry, and then transfer it to the recovery medium CRM for recovery culture for 15 d.

[0055] The CCM medium is: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 100 µM acetosyringone + 3 g / L phytagel;

[0056] The CRM medium is: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime.

[0057] Step 5, Screening of resistant callus: Transfer the callus after the above-mentioned recovery culture to the callus subculture screening medium CRSM for subculture screening culture for 15 d, observe the green fluorescent protein with LUYOR-3280, and screen the callus with herbicide resistance and expressing green fluorescent protein ( Figure 1 in B).

[0058] The CRSM medium is: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime + 2 mg / L herbicide basta.

[0059] Step 6, differentiation screening and transgenic detection of resistant callus: Then transfer the resistant callus to the callus differentiation screening medium CDSM for differentiation screening culture for 20 - 30 d to obtain resistant shoots ( Figure 1 as shown in C), then transfer the resistant shoots to the adventitious bud subculture screening medium DSM for secondary screening culture for 15 d ( Figure 1 as shown in D). Further, transfer the resistant shoots to the adventitious bud rooting screening medium DRSM for rooting screening culture for 20 d to obtain complete resistant seedlings ( Figure 1 as shown in E).

[0060] The components of the CDSM medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 1 mg / L 6-BA + 3 g / L phytagel + 400 mg / L cefotaxime + 2 mg / L herbicide basta;

[0061] The components of the DSM medium are: MS + 30 g / L sucrose + 2 mg / L 6-BA + 0.6 mg / L NAA + 3 g / L phytagel + 0.1 g / L activated carbon + 400 mg / L cefotaxime + 2 mg / L herbicide basta;

[0062] The components of the DRSM medium are: MS + 30 g / L sucrose + 0.6 mg / L 6-BA + 2 mg / L NAA + 3 g / L phytagel + 0.1 g / L activated carbon + 400 mg / L cefotaxime + 2 mg / L herbicide basta.

[0063] Step 7, transgenic detection of resistant seedlings: After obtaining complete resistant seedlings, conduct Bar gene immunochromatographic strip detection and PCR analysis on them to verify positive transgenes in the resistant seedlings. As Figure 1As shown in Figure F, 10 resistant plant lines were randomly selected and tested using a Bar gene immunochromatographic test strip (purchased from Artron, catalog number A0713413). The results showed that all 10 resistant plant lines were positive transgenic lines. As Figure 1 As shown in Figure G, 20 resistant plant lines were randomly selected, DNA was extracted, and PCR was performed using Bar gene-specific primers (F: atcgtcaaccactacatcgagac and R: ccagctgccagaaacccacgtc). PCR reaction system: 10 μl of 2xDet PCR MasterMix (purchased from Tiangen, catalog number KG203), 0.5 μl of F, 0.5 μl of R, 1 μl of template, 8 μl of ddH2O; amplification program: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, 32 cycles, and final extension at 72°C for 5 min. The test results showed that all 20 resistant plant lines were positive transgenic lines.

[0064] Example 2

[0065] Step 1 is the same as Step 1 of Example 1.

[0066] Step 2 is the same as Step 2 of Example 1, except that the Pu1300 vector (purchased from Wuhan Tianwen Biotechnology Co., Ltd., with the hygromycin resistance gene hpt as the plant selection marker) was directly used for transformation ( Figure 3 ), and the other steps are the same.

[0067] Step 3 is the same as Step 3 of Example 1.

[0068] Step 4 is the same as Step 4 of Example 1.

[0069] Step 5 is the same as Step 5 of Example 1, except that there is no step for observing green fluorescence, and 30 mg / L hygromycin was used in the callus subculture screening medium CRSM1 instead of the herbicide, and the other steps are the same.

[0070] The components of the CRSM1 medium are: MS + 30 g / L sucrose + 1 mL of sugarcane vitamins + 50 mL of fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefamycin + 30 mg / L hygromycin.

[0071] Step 6 is the same as Step 6 of Example 1, except that 30 mg / L of hygromycin is used instead of the herbicide in the callus differentiation screening medium CDSM1, the adventitious bud subculture screening medium DSM1, and the adventitious bud rooting screening medium DRSM1, and the rest of the steps are the same.

[0072] The components of the CDSM1 medium are: MS + 30 g / L of sucrose + 1 mL of sugarcane vitamins + 50 mL of fresh coconut water + 0.15 g / L of citric acid + 0.05 g / L of cysteine + 0.1 g / L of inositol + 1 mg / L of 6-BA + 3 g / L of phytagel + 400 mg / L of cefotaxime + 30 mg / L of hygromycin; the components of the DSM1 medium are: MS + 30 g / L of sucrose + 2 mg / L of 6-BA + 0.6 mg / L of NAA + 3 g / L of phytagel + 0.1 g / L of activated carbon + 400 mg / L of cefotaxime + 30 mg / L of hygromycin; the components of the DRSM1 medium are: MS + 30 g / L of sucrose + 0.6 mg / L of 6-BA + 2 mg / L of NAA + 3 g / L of phytagel + 0.1 g / L of activated carbon + 400 mg / L of cefotaxime + 30 mg / L of hygromycin.

[0073] Step 7 is the same as Step 7 of Example 1, except that after obtaining complete hygromycin-resistant seedlings, 20 resistant seedling lines are randomly selected, DNA is extracted, and PCR detection is performed using hygromycin hpt gene-specific primers (F: CTTGACATTGGGGAGTTTAGC and R: TGTCGTCCATCACAGTTTGC). The results show that all 20 resistant seedling lines are positive transgenic lines ( Figure 1 in H).

[0074] Comparative Example 1

[0075] The difference from Example 1 is only that the callus of sugarcane variety ROC22 is used as the transformation receptor, and the concentration of 2,4-D in the subsequent callus induction medium CIM1, callus co-culture medium CCM1, callus recovery medium CRM1 and callus subculture screening medium CRSM2 is 1 mg / L (because previous studies have shown that the optimal concentration of 2,4-D for callus culture of sugarcane variety ROC22 is 1 mg / L [Wang W, Wang J, Feng C, et al. Establishment of an efficient transgenic selection system and its utilization in Saccharum officinarum. 2023. Tropical Plants 2:11]), and the rest are the same.

[0076] The components of the CIM1 medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 1 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel; the components of the CCM1 medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 1 mg / L 2,4-D + 2 mg / L silver nitrate + 100 μM acetosyringone + 3 g / L phytagel; the components of the CRM1 medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 1 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime; the components of the CRSM2 medium are: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 1 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime + 2 mg / L herbicide basta.

[0077] Comparative Example 2

[0078] The difference from Example 1 is only that there are no sugarcane vitamins, fresh coconut water, and antioxidants (casein hydrolysate, citric acid, cysteine, and silver nitrate) in the Erianthus fulvus callus induction medium CIM2, co-culture medium CCM2, recovery medium CRM2, callus subculture screening medium CRSM3, and callus differentiation screening medium CDSM2, and the rest are the same.

[0079] The components of the CIM2 medium are: MS + 30 g / L of sucrose + 0.1 g / L of inositol + 3 mg / L of 2,4-D + 3 g / L of phytagel; the components of the CCM2 medium are: MS + 30 g / L of sucrose + 0.1 g / L of inositol + 3 mg / L of 2,4-D + 100 μM of acetosyringone + 3 g / L of phytagel; the components of the CRM2 medium are: MS + 30 g / L of sucrose + 0.1 g / L of inositol + 3 mg / L of 2,4-D + 3 g / L of phytagel + 400 mg / L of cefotaxime; the components of the CRSM3 medium are: MS + 30 g / L of sucrose + 0.1 g / L of inositol + 3 mg / L of 2,4-D + 3 g / L of phytagel + 400 mg / L of cefotaxime + 2 mg / L of herbicide basta; the components of the CDSM2 medium are: MS + 30 g / L of sucrose + 0.1 g / L of inositol + 1 mg / L of 6-BA + 3 g / L of phytagel + 400 mg / L of cefotaxime + 2 mg / L of herbicide basta.

[0080] Comparative Example 3

[0081] The difference from Example 1 is only that there is no vacuum filtration during the Agrobacterium infection process of the Erianthus fulvus callus, and it is only cultured with shaking at 90 rpm in the dark for 25 min, and the rest of the steps are the same.

[0082] Comparative Example 4

[0083] The difference from Example 1 is only that after the Agrobacterium infection and co-culture of the Erianthus fulvus callus, it is directly transferred to the differentiation screening medium for differentiation screening, without the recovery culture of the callus and the subculture screening culture of the callus, and the rest of the steps are the same.

[0084] Effect verification

[0085] The above Examples 1-2 and Comparative Examples 1-4 are different method systems for the genetic transformation of Erianthus fulvus callus in the present invention, which reflect the superiority of the transformation systems in Examples 1-2 disclosed in the present invention. The transformation results of Examples 1-2 and Comparative Examples 1-4 are shown in Table 1.

[0086] Table 1. Genetic transformation results of Erianthus fulvus callus mediated by different methods

[0087] Method Transformation receptor Plant resistance screening marker Number of infected calli Number of positive strains Transformation efficiency (%) Example 1 Erianthus fulvus Herbicide Bar gene 81.67±7.64 aA 11.67±2.08 aA 14.21±1.19 aA Example 2 Erianthus fulvus Hygromycin hpt gene 86.00±3.00 aA 12.00±1.00 aA 13.94±0.68 aA Comparative Example 1 Sugarcane ROC22 Herbicide Bar gene 83.33±4.51 aA 8.33±1.15 bA 9.98±1.01 bA Comparative Example 2 Erianthus fulvus Herbicide Bar gene 81.00±4.58 aA 2.67±2.08 cdB 3.30±2.53 cdB Comparative Example 3 Erianthus fulvus Herbicide Bar gene 84.00±5.57 aA 4.33±1.53 cB 5.26±2.21 cB Comparative Example 4 Erianthus fulvus Herbicide Bar gene 78.67±4.16 aA 1.00±1.00 dB 1.31±1.35 dB

[0088] Note: The positive seedlings differentiated from the same callus are all of the same strain. Transformation efficiency = number of positive strains / number of infected calli × 100%. The numbers represent the mean ± standard deviation of three independent replicate experiments. Lowercase letters indicate significant differences (P < 0.05), and uppercase letters indicate extremely significant differences (P < 0.01).

[0089] Table 1 results show that there is no difference in the number of calli used in each method, but there are differences between the number of positive seedlings and the transformation efficiency. The vectors of Example 1 (herbicide-resistant Bar gene screening marker) and Example 2 (hygromycin-resistant hpt gene screening marker) are different, and the remaining transformation methods and media are the same. Both can obtain the highest transformation efficiency, which is the scheme described in detail in the present invention. The results indicate that the transformation methods of Examples 1-2 in the present invention are applicable to the vector skeletons with herbicide-resistant Bar gene and hygromycin-resistant hpt gene as screening markers, and are beneficial to the genetic transformation of Erianthus fulvus. In addition, there are significant differences in the transformation efficiency of different genotypes. Compared with Examples 1-2 (the transformation receptor is Erianthus fulvus), the transformation efficiency of Comparative Example 1 (the transformation receptor is sugarcane ROC22) is significantly reduced, indicating that the transformation efficiency of the present invention scheme is the best in Erianthus fulvus.

[0090] In Comparative Example 2, the callus induction and subsequent co-culture and screening media of Erianthus fulvus are the conventional media in previous studies, which do not contain antioxidants, sugarcane vitamins and coconut water, resulting in weak embryogenicity of the callus and extremely significant reduction in its transformation efficiency, indicating that the embryogenicity of the callus is the key factor determining the success of transformation. Therefore, the present invention optimizes the best medium for callus induction of Erianthus fulvus. In addition, during the infection process of calli in Comparative Example 3, there is no vacuum infiltration step, which makes the engineering bacteria unable to fully contact with the calli, resulting in extremely significant reduction in the transformation efficiency, indicating that vacuum infiltration plays an important promoting role in the Agrobacterium-mediated genetic transformation of Erianthus fulvus calli. In addition, in Comparative Example 4, after the calli of Erianthus fulvus are infected with Agrobacterium and co-cultured, they are directly subjected to differentiation screening culture, without the steps of callus recovery culture and callus subculture screening culture, which makes the calli unable to recover embryogenicity after Agrobacterium infection, and the calli at the infection site cannot proliferate rapidly, resulting in extremely significant reduction in the transformation efficiency, indicating that the callus recovery culture and subculture screening culture after Agrobacterium infection contribute to the improvement of the transformation efficiency.

[0091] In summary, the present invention systematically constructs a genetic operation system for Erianthus rufipilus. By optimizing the callus induction medium of Erianthus rufipilus, the embryogenicity of the callus of Erianthus rufipilus is improved; through vacuum infiltration, the infection intensity of the callus of Erianthus rufipilus is strengthened, and the transformation efficiency is improved; through the recovery culture and subculture screening culture of the callus, the transformation efficiency is increased; finally, a scheme suitable for the genetic transformation of Erianthus rufipilus is determined, and the scheme of the present invention is applicable to the vector backbone with the herbicide resistance Bar gene and the hygromycin resistance hpt gene as screening markers. The superiority of the present invention lies in constructing a genetic transformation system for Erianthus rufipilus, the only diploid species in the sugarcane complex, providing a reference for model species for the study of the sugarcane complex.

[0092] The embodiments described above are only used to describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solution of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An Agrobacterium-mediated genetic transformation method for Erianthus fulvus in sugarcane complex, characterized in that, It includes the following steps: Step 1: Inoculate the young tender heart leaves of Erianthus fulvus into the callus induction medium (CIM) for cultivation. Transfer the obtained callus to the CIM medium again for subculture to obtain embryogenic callus; Step 2: Select a plant expression vector carrying the herbicide-resistant Bar gene marker or the hygromycin-resistant hpt gene marker. Transform the plant expression vector into Agrobacterium competent cells, and screen for positive colonies carrying the plant expression vector, which are the engineered bacteria; Step 3: Inoculate the engineered bacteria into the YEP medium, expand the culture, centrifuge to collect the bacterial cells, and resuspend them with the resuspension solution (RS) to prepare an infection solution containing the engineered bacteria; Step 4: Transfer the embryogenic callus obtained in Step 1 to the infection solution containing the engineered bacteria for cultivation, then perform vacuum filtration and shaking culture. Transfer the cultured callus to the callus co-culture medium (CCM) for co-culture; after the co-culture is completed, transfer the callus to the recovery medium (CRM) for recovery culture; Step 5: Transfer the callus after the recovery culture to the callus subculture and screening medium (CRSM) for subculture and screening to obtain resistant callus; Transfer the resistant callus to the callus differentiation and screening medium (CDSM) for differentiation and screening to obtain resistant shoots; Step 6: After rooting and PCR identification of the resistant shoots, obtain positive transgenic seedlings; Among them, the callus induction medium (CIM) consists of the following components at the following concentrations: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel; The YEP medium consists of the following components at the following concentrations: 10 g / L yeast extract + 10 g / L beef extract + 5 g / L NaCl + 50 mg / L kanamycin + 50 mg / L rifampicin; The resuspension solution (RS) consists of the following components at the following concentrations: 1 / 2 MS + 2 g / L glucose + 2 g / L maltose + 100 μM acetosyringone; The callus co-culture medium (CCM) consists of the following components at the following concentrations: MS + 30 g / L sucrose + 1 mL sugarcane vitamin + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 100 μM acetosyringone + 3 g / L phytagel; The recovery medium CRM medium consists of the following components at the following concentrations: MS + 30 g / L sucrose + 1 mL sugarcane vitamins + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime; The callus subculture screening medium CRSM medium consists of the following components at the following concentrations: MS + 30 g / L sucrose + 1 mL sugarcane vitamins + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime + 2 mg / L herbicide basta or 30 mg / L hygromycin; The callus differentiation screening medium CDSM consists of the following components at the following concentrations: MS + 30 g / L sucrose + 1 mL sugarcane vitamins + 50 mL fresh coconut water + 0.5 g / L casein hydrolysate + 0.15 g / L citric acid + 0.05 g / L cysteine + 0.1 g / L inositol + 3 mg / L 2,4-D + 2 mg / L silver nitrate + 3 g / L phytagel + 400 mg / L cefotaxime + 2 mg / L herbicide basta or 30 mg / L hygromycin; The sugarcane vitamins are: 1 g vitamin B1, 0.5 g vitamin B6, 0.5 g nicotinic acid, 2 g glycine, 50 g arginine and 1 L water.

2. The genetic transformation method according to claim 1, wherein In step 1, the culture conditions are dark culture at 28°C for 20 - 30 d; the number of subculture times is two, and the conditions for each subculture are dark culture at 28°C for 15 - 20 d.

3. The genetic transformation method according to claim 1, wherein In step 2, the plant expression vector is transformed into Agrobacterium EHA105 competent cells, and then spread on YEP solid medium. After dark culture at 28°C for 48 h, positive colonies carrying the plant expression vector are screened.

4. The genetic transformation method according to claim 1, wherein In step 3, after suspension with the resuspension solution RS, shake the bacteria in the dark for 3 - 5 h for activation culture.

5. The genetic transformation method according to claim 1, wherein In step 4, the conditions for both culture and shaking culture are dark shaking culture at 90 rpm for 10 min; the conditions for vacuum filtration are filtration under 0.7 Mpa vacuum for 5 min.

6. The genetic transformation method according to claim 1, wherein In step 5, the time for subculture screening is 10 - 20 d; the time for differentiation screening is 20 - 30 d.

7. The genetic transformation method according to claim 1, wherein In step 6, the resistant buds are first transferred to the adventitious bud subculture screening medium DSM for secondary screening culture, and then transferred to the adventitious bud rooting screening medium DRSM for rooting screening culture.

8. The genetic transformation method according to claim 7, wherein The adventitious bud subculture screening medium DSM consists of the following components in the given concentrations: MS + 30 g / L sucrose + 2 mg / L 6-BA + 0.6 mg / L NAA + 3 g / L phytagel + 0.1 g / L activated carbon + 400 mg / L cefotaxime + 2 mg / L herbicide basta or 30 mg / L hygromycin; the adventitious bud rooting screening medium DRSM consists of the following components in the given concentrations: MS + 30 g / L sucrose + 0.6 mg / L 6-BA + 2 mg / L NAA + 3 g / L phytagel + 0.1 g / L activated carbon + 400 mg / L cefotaxime + 2 mg / L herbicide basta or 30 mg / L hygromycin.

9. The genetic transformation method according to claim 1, wherein The young tender heart leaves of Erianthus fulvus are obtained as follows: Take the shoot tip part with leaf sheaths at the seedling stage of Erianthus fulvus. After surface disinfection, peel off the outer leaf sheaths, and cut the young tender heart leaves 0 - 3 cm near the growth point into small pieces 0.5 - 1 cm long.

10. The genetic transformation method according to claim 1, characterized in that, The plant expression vector carrying the herbicide-resistant Bar gene marker is the PCAMBIA3301 plant expression vector; the plant expression vector carrying the hygromycin-resistant hpt gene marker is the Pu1300 vector.

Citation Information

Patent Citations

  • Enhanced transformation of recalcitrant monocots

    CN103620040A

  • Method for Agrobacterium-mediated genetic transformation of sugarcane growth points

    CN111893138A

  • Agrobacterium tumefaciens-mediated sugarcane callus efficient genetic transformation method

    CN114774464A

  • Method to enchance agrobacterium-mediated transformation of plants

    US20010034888A1