Application of Ginkgo biloba flavonoids in the preparation of preparations against porcine Seneca virus

Abstract

The present invention provides a use of ginkgo biflavonoids for preparing a product for preventing and / or treating SVA infection; in another aspect, the present invention also provides a product for preventing and / or treating SVA infection, wherein the product contains ginkgo biflavonoids at a pharmacologically effective concentration. The present invention provides the use of ginkgo biflavonoids in preparing a preparation for preventing and / or treating SVA infection. Ginkgo biflavonoids has a very significant effect on preventing SVA infection, can reduce cell infection caused by SVA, and inhibit the adsorption, replication, assembly and release stages of SVA, providing a scientific and reliable theoretical basis for the clinical treatment of swine Seneca virus disease.

Description

Technical Field

[0001] The invention belongs to the technical field of antiviral preparation preparation, and particularly relates to the application of ginkgo biflavonoids in the preparation of preparations against porcine Seneca virus. Background Art

[0002] Senecavirus A (SVA), formerly known as Seneca Valley virus (SVV), is the only member of the genus Seneca Valley virus in the family Picornaviridae. Senecavirus is a positive-sense single-stranded RNA virus that does not have an envelope. It is a spherical virus particle with a diameter range of 26-30nm and icosahedral symmetry. The main symptoms of swine Senecavirus disease caused by Senecavirus A SVA are vesicular lesions, blisters and ulcers appear on the skin or mucous membranes of the nose, snout and hoof crown of the sick pigs, and in severe cases, it can cause acute death of newborn piglets. Clinically, the disease is difficult to distinguish from swine foot-and-mouth disease, vesicular stomatitis, and infectious vesicular disease of swine. It can only be identified by laboratory means, which is easy to cause panic in pig farming companies. The virus has spread widely around the world, affecting major pig farming countries such as the United States, Canada, and Thailand. SVA was first introduced to Guangdong Province, China in 2015, and has since spread widely in many provinces and regions of China, causing serious economic losses to China's pig industry. As of 2019, SVA has occurred in at least 16 provinces, municipalities, and autonomous regions in my country, causing significant economic losses.

[0003] The prevention and control of new and emerging infectious diseases is a common problem faced by the world. As a new swine epidemic, porcine Seneca virus disease caused by SVA has no effective prevention and control technology. Among them, commercial vaccines and antibodies are still in the development stage, and few teams have reported on drug development. In addition, SVA has been constantly evolving in recent years, and its strains frequently show genomic mutations and recombination phenomena, which further hinders the development of effective vaccines. In the prevention and control of animal diseases, chemical drugs have the characteristics of easy use, low price, and obvious effect. They can be used in combination with vaccines to prevent the occurrence of diseases. Therefore, the timely development of drugs with SVA antagonistic activity is of great research significance for the prevention and control of SVA. Summary of the invention

[0004] The object of the present invention is to provide an application of ginkgo biflavonoids in the preparation of an anti-SVA preparation, thereby being able to effectively prevent and treat SVA disease.

[0005] The present invention first provides a use of ginkgo biflavonoids for preparing a product for preventing and / or treating SVA infection;

[0006] In another aspect, the present invention provides a product for preventing and / or treating SVA infection, wherein the product contains ginkgo biflavonoids in a pharmacologically effective concentration;

[0007] Preferably, the preparation is a liquid preparation;

[0008] The pharmacologically effective concentration, as specifically described in some embodiments, is 10 to 100 μmol / L.

[0009] Preferably, the concentration of ginkgo biloba flavonoids in the preparation is 20-80 μmol / L.

[0010] Preferably, the concentration of ginkgo biloba flavonoids in the preparation is 40-60 μmol / L.

[0011] Furthermore, the liquid preparation is PBS buffer or DMSO.

[0012] Preferably, the concentration of the PBS buffer is 0.05-0.15 mol / L.

[0013] Preferably, the concentration of the PBS buffer is 0.08-0.12 mol / L.

[0014] The present invention provides an application of ginkgo biloba flavonoids in the preparation of a preparation for preventing and / or treating SVA infection. The ginkgo biloba flavonoids have a very significant anti-SVA infection effect, can reduce cell infection caused by SVA, and inhibit the adsorption, replication, assembly and release stages of SVA, thus providing a scientific and reliable theoretical basis for the clinical treatment of swine Seneca virus disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Photographs showing the effect of Ginkgo biloba flavonoids on the infection efficiency of BSR cells infected with SVA were observed under a fluorescence microscope.

[0016] Figure 2 The effect of ginkgo biloba flavonoids on SVA infection in BSR cells; A is the Western blot assay of the effect of ginkgo biloba flavonoids on SVA infection in BSR cells; B is the TCID50 assay of the effect of ginkgo biloba flavonoids on SVA infection in BSR cells; C is the fluorescence quantitative RT-PCR assay of the effect of ginkgo biloba flavonoids on SVA infection in BSR cells;

[0017] Figure 3 This is a graph showing the effect of Ginkgo biloba flavonoids on SVA adsorption on BSR cells as determined by fluorescence quantitative RT-PCR;

[0018] Figure 4The figure shows the effect of ginkgo biloba flavonoids on SVA intracellular incorporation in BSR cells; A shows the effect of ginkgo biloba flavonoids on SVA intracellular incorporation in BSR cells determined by Western blot; B shows the effect of ginkgo biloba flavonoids on SVA intracellular incorporation in BSR cells determined by fluorescence quantitative RT-PCR;

[0019] Figure 5 Figure 1 is a graph showing the effect of ginkgo biloba flavonoids on SVA replication in BSR cells; A is a Western blot assay showing the effect of ginkgo biloba flavonoids on SVA replication in BSR cells; B is a TCID50 assay showing the effect of ginkgo biloba flavonoids on SVA replication in BSR cells; C is a fluorescence quantitative RT-PCR assay showing the effect of ginkgo biloba flavonoids on SVA replication in BSR cells;

[0020] Figure 6 The figure shows the effect of ginkgo biloba flavonoids on the assembly and release of SVA in BSR cells; wherein, A is the TCID50 assay for the effect of ginkgo biloba flavonoids on the release of SVA, and B is the fluorescence quantitative RT-PCR assay for the effect of ginkgo biloba flavonoids on the assembly of SVA in BSR cells. DETAILED DESCRIPTION

[0021] The ginkgo biflavonoids used in the present invention have the advantages of wide drug sources, easy to obtain raw materials, low cost, etc. It is derived from traditional Chinese medicine, has little environmental pollution after being metabolized by animal bodies, and has no toxic side effects on animals. The present invention has no special requirements on the source of the ginkgo biflavonoids used, and can use conventional commercial products in the field or prepare them by themselves.

[0022] The present invention also provides a preparation for preventing and / or treating SVA infection, wherein the concentration of ginkgo biloba flavonoids in the preparation is 10 to 100 μmol / L, preferably 20 to 80 μmol / L, more preferably 40 to 60 μmol / L, and most preferably 50 μmol / L. In the present invention, the drug is preferably a liquid preparation, and the solvent of the drug is preferably PBS buffer or DMSO; when the solvent is PBS buffer, the concentration of the PBS buffer is preferably 0.05 to 0.15 mol / L, more preferably 0.08 to 0.12 mol / L, and most preferably 0.1 mol / L.

[0023] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0024] Example 1: Preparation of Ginkgo Biflavonoids Preparation

[0025] In this example, two ginkgo biflavonoids preparations were prepared, one of which was obtained by dissolving ginkgo biflavonoids in 0.1 mol / L PBS buffer, and the concentration of ginkgo biflavonoids was 10 mmol / L.

[0026] Another preparation is obtained by dissolving ginkgo biloba flavonoids in DMSO, and the concentration of ginkgo biloba flavonoids is 10 mmol / L.

[0027] To verify the effect of Ginkgo biloba flavonoids on the infection efficiency caused by SVA, the specific experimental method is as follows:

[0028] The trypsin-digested BSR cells were diluted with a nutrient solution containing 10% fetal bovine serum and counted according to 5×10 5 The cells were plated in a six-well plate at a concentration of 100 cells / well and placed in a 37°C incubator containing 5% CO2. After the cells grew to a density of 80-90% (approximately 24 hours), they were washed three times with PBS solution, pretreated with empty DMEM and different concentrations of Ginkgo biloba PBS solution (10 μM, 20 μM, 50 μM) for 1 hour, and then infected with the SVASVA strain (MOI=1). The medium was changed after 1 hour. The infection lasted for 24 hours with the drug present. The infection of the cells was observed under a fluorescence microscope. Figure 1 The results showed that Ginkgo biloba flavonoids could reduce the green fluorescence produced by SVA, indicating that Ginkgo biloba flavonoids may reduce the infection of SVA.

[0029] Example 2

[0030] The specific steps to verify the effect of Ginkgo biloba flavonoids in inhibiting the infection activity of SVA during the whole infection cycle (Western blot, fluorescence quantitative PCR and TCID50 experiments) are as follows:

[0031] 1) Western blot analysis of the inhibitory activity of Ginkgo biloba flavonoids on SVA infection in BSR cells

[0032] Dilute the BSR cells with DMEM containing 10% FBS to a volume concentration of 5 × 10 5 / well was added to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells attached to the wall to form a monolayer (about 24h), and then the cells were washed three times with PBS solution. After the residual PBS was aspirated, 1mL of serum-free DMEM was added to dilute the corresponding concentration of ginkgo biloba (50μM), and incubated with BSR cells at 37°C for 1h. The cells were infected with SVA (MOI=1) in the presence of the corresponding concentration of ginkgo biloba (50μM), placed in a 37°C, 5% CO2 incubator for 1h, and then replaced with 2mL of DMEM containing 2% FBS. The cells were maintained in the presence of the corresponding concentration of Ginkgo biloba (50 μM) and cultured in a 37°C, 5% CO2 incubator. After 8h, 12h, 24h, and 36h of infection, the cell supernatant was collected (1 mL was stored at -70°C for later TCID50 experiments), washed three times with PBS, and the residual liquid was removed. The cells were lysed using a lysis buffer containing protease inhibitors. After the concentration of the lysis buffer was determined, 5× protein loading was added to collect the cell samples, boiled in a metal bath at 96°C for 15min, and then Western blot was performed. It was found that Ginkgo biloba reduced the expression of SVA VP3 protein, which preliminarily confirmed that Ginkgo biloba reduced the infection of SVA.

[0033] 2) TCID50 determination of the inhibitory activity of Ginkgo biloba flavonoids on SVA infection in BSR cells

[0034] Dilute the BSR cells with DMEM containing 10% FBS to a volume concentration of 2 × 10 4 / well concentration was added to a 96-well plate, placed in a 37°C, 5% CO2 incubator, and after the cells adhered to the wall and formed a monolayer, they were washed three times with PBS. After the residual liquid was sucked out, the virus supernatant collected in the previous experiment diluted with serum-free DMEM was added. Eight replicates were made for each concentration. After 1.5 hours of infection, DMEM containing 2% FBS was replaced for maintenance. After 72 hours of infection, the cell infection was observed and observed until 120 hours after infection. It was found that ginkgo biloba flavonoids reduced the virus titer of SVA infection supernatant ( Figure 2 B) in the figure confirmed that Ginkgo biloba flavonoids reduced the infection of SVA.

[0035] 3) Fluorescence quantitative RT-PCR determination of the inhibitory activity of Ginkgo biloba flavonoids on SVA infection in BSR cells

[0036] After digestion, BSR cells were diluted with DMEM containing 10% FBS to a concentration of 5 × 10 5 / well concentration was added dropwise into a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells attached to the wall into a monolayer (about 24h), the cells were washed three times with PBS solution, and after the residual PBS was sucked out, 1mL of serum-free DMEM diluted to the corresponding concentration of ginkgo biloba (10μM) was added, and incubated with BSR cells at 37°C for 1h, the cells were infected with SVA in the presence of ginkgo biloba (10μM), placed in a 37°C, 5% CO2 incubator for 1h, replaced with 2mL of DMEM nutrient solution containing 2% FBS and maintained in the presence of the corresponding concentration of ginkgo biloba (10μM), placed in a 37°C, 5% CO2 incubator for culture, and after 24h of infection, directly frozen and placed in a -70°C refrigerator. After repeated freezing and thawing 3 times, viral RNA was extracted for real-time fluorescence quantitative RT-PCR detection. The fluorescent quantitative RT-PCR primers and probes used were: SVA-FCTGCGCTGGGACCGTATCTCA, SVA-R CGCCGCGCCACCTCATT, SVA-PTCGCCGTAAGCGTGCACCGAGACAG. The 20 μL reaction system used contained 5×One Step U + Mix 4μL, OneStep U + Mix 1μL, upstream and downstream primers 0.4μL each, probe 0.2μL, RNase-free water 14.0μL, template 5μL. Amplification program is reverse transcription at 55℃ for 15min, pre-denaturation at 95℃ for 2min30s, PCR reaction is denaturation at 95℃ for 8s, annealing at 60℃ for 16s, a total of 45 cycles, and fluorescence reading at 60℃. The results are as follows Figure 2 As shown in Figure C, ginkgo biloba flavonoids can reduce the number of SVA nucleic acid copies, confirming that ginkgo biloba flavonoids reduce the infection of SVA.

[0037] Example 3: Verification of the effect of ginkgo biloba flavonoids on SVA adsorption

[0038] After digestion, BSR cells were diluted with 10% FBS DMEM nutrient solution to a concentration of 5 × 10 5 / well concentration was added to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall into a monolayer (about 24 hours), and then washed three times with PBS solution. After the residual PBS was sucked out, 1 mL of serum-free DMEM was added to dilute the corresponding concentration of ginkgo biloba (10 μM, 20 μM, 50 μM), and incubated with BSR cells at 37°C for 1 hour, and then replaced with cold serum-free DMEM. SVA was infected at 4°C and the corresponding concentration of ginkgo biloba (10 μM, 20 μM, 50 μM) was present. After incubation for 1 hour, it was washed three times with cold PBS, 1 mL of cold serum-free DMEM was added, and it was frozen in a -70°C refrigerator. The viral RNA was extracted by repeated freezing and thawing three times for fluorescence quantitative RT-PCR determination. The results are shown in Figure 3As shown in , it was found that ginkgo biloba flavonoids reduced the number of SVA nucleic acid copies, confirming that ginkgo biloba flavonoids reduced the adsorption of SVA.

[0039] Example 4: Verification of the effect of Ginkgo biloba flavonoids on SVA cell entry (Western blot and fluorescent quantitative RT-PCR)

[0040] The digested BSR cells were diluted to an appropriate density of 5 × 10 cells / mL using DMEM containing 10% FBS. 5 / well concentration was added to a 6-well plate, placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall and formed a monolayer (about 24 hours), washed with PBS three times, and after absorbing the residual PBS, 1 mL of serum-free cold DMEM was added and infected with SVA (MOI = 10), incubated at 4°C for 1 hour, washed three times with cold PBS and the residual liquid was absorbed, added with 1 mL of cold DMEM containing 2% FBS and the corresponding concentration of dipotassium glycyrrhizinate (0μM, 10μM, 20μM and 50μM), incubated at 37°C for 1 hour, washed three times with citric acid and then washed three times with PBS, and the residual liquid was absorbed, replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance, placed in a 37°C, 5% CO2 incubator, and cultured 18 hours after infection, and cell samples were collected for Western blot and fluorescent quantitative RT-PCR detection. The results are as follows Figure 4 As shown, Ginkgo biloba flavonoids did not reduce the expression of SVA VP3 protein entering cells, nor did it reduce the amount of SVA nucleic acid entering cells, confirming that Ginkgo biloba flavonoids did not reduce the level of SVA entering cells.

[0041] Example 5: Verification of the effect of Ginkgo biloba flavonoids on SVA replication (Western blot, TCID50, fluorescent quantitative RT-PCR)

[0042] Dilute the BSR cells to an appropriate density of 5 × 10 cells / mL in DMEM with 10% FBS. 5 / well concentration was added to a 6-well plate and placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall and formed a monolayer (about 24 hours). The cells were washed three times with PBS solution, and after the residual PBS was sucked out, 1 ml of empty DMEM containing SVA virus (MOI=1) was added. After incubation at 37°C for 1 hour, the cells were washed three times with PBS, and 2 ml of DMEM (containing 2% serum) containing 10μmol / L, 20μmol / L and 50μmol / L ginkgo biloba flavonoids was added to the cells. After incubation at 37°C for 12 hours, Western blot, TCID50, and fluorescent quantitative RT-PCR were performed, and the results are shown as follows. Figure 5 As shown in the results, it was found that ginkgo biloba flavonoids reduced the expression of SVA VP3 protein, reduced the number of SVA nucleic acid copies and viral titer, confirming that ginkgo biloba flavonoids can inhibit SVA replication.

[0043] Example 6: Verification of the effect of Ginkgo biloba flavonoids on SVA assembly and release (Western blot, TCID50, fluorescent quantitative RT-PCR)

[0044] BSR cells were cultured on different cell plates and grown to a monolayer. After SVA (MOI=1) infected BSR cells at 37°C for 1 hour, the cells were washed 3 times with PBS and the residual liquid was aspirated. The cells were incubated with 2% DMEM culture medium containing 0μmol / L, 10μmol / L, 20μmol / L and 50μmol / L reboxetine mesylate for 12 hours, which is about one virus replication cycle. The supernatant was taken for later use. The cells were added with 1mL PBS and repeatedly frozen and thawed 3 times, and then the solution was collected. Within a replication cycle, when the virus assembly and release mechanism is normal, the ratio of virus titer and nucleic acid in the supernatant and cells should be basically constant. TCID50 was used to detect the ratio of SVA virus titer in the supernatant to that in the cells, and fluorescent quantitative RT-PCR was used to detect the ratio of SVA nucleic acid copy number in the supernatant to that in the cells. The results are shown in Figure 6 As shown in A, Ginkgo biloba flavonoids reduced the titer ratio of SVA inside and outside the cells, confirming that Ginkgo biloba flavonoids can inhibit the release of SVA. Figure 6 Ginkgo biloba flavonoids shown in B can reduce the ratio of SVA nucleic acid inside and outside the cell, proving that Ginkgo biloba flavonoids can inhibit the SVA assembly process.

Claims

1. A use of ginkgo biflavonoids, characterized in that: The use is in the preparation of medicines for preventing and / or treating type A Seneca virus infection.

2. The use according to claim 1, characterized in that The medicine contains ginkgo biflavonoids in pharmacologically effective concentration.

3. The use according to claim 2, characterized in that The pharmacologically effective concentration is a concentration that can prevent type A Seneca virus from infecting cells.

4. The use according to claim 2, characterized in that The pharmacologically effective concentration is 10 to 100 μmol / L in the liquid preparation.

5. The use according to claim 4, characterized in that The pharmacologically effective concentration is 20 to 80 μmol / L in the liquid preparation.

6. The use according to claim 4, characterized in that The pharmacologically effective concentration is 40 to 60 μmol / L in the liquid preparation.

7. The use according to claim 4, characterized in that The liquid preparation is PBS buffer or DMSO.

Images