Bacillus subtilis-derived antimicrobial peptide NDYT-8 and its application

Abstract

The present invention belongs to the field of bioengineering technology, and specifically discloses a Bacillus subtilis-derived antimicrobial peptide NDYT-8 and its application. The present invention finally obtains the Bacillus subtilis-derived antimicrobial peptide NDYT-8 through mass spectrometry identification of Bacillus subtilis fermentation metabolites, genomic data mining, database prediction and synthesis verification. The amino acid sequence of the antimicrobial peptide NDYT-8 is PRKILLMVKA, the molecular weight is 1168.551 Daltons, and it can form an amphipathic α-helical structure; the antimicrobial peptide NDYT-8 provided by the present invention has a significant inhibitory effect on various foodborne pathogens such as Escherichia coli and Staphylococcus aureus, can target and destroy bacterial cell membranes, and has a low hemolytic effect; the amino acids of the antimicrobial peptide NDYT-8 provided by the present invention are all L-configuration, and the synthesis cost is low. Therefore, it is expected to replace antibiotics and chemical preservatives, and has significant potential for exploration and application prospects in the fields of biomedicine, food and agricultural product preservation.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a Bacillus subtilis-derived antimicrobial peptide NDYT-8 and an application thereof. Background Art

[0002] Foodborne pathogens are microorganisms that cause illness in humans by using food as a carrier. Typical examples include Salmonella, diarrheagenic Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus. The prevention and control of foodborne pathogens is a crucial requirement for ensuring food safety. Currently, the common method for preventing and controlling foodborne pathogens is the addition of chemical preservatives. However, a growing body of research indicates that the use of chemical preservatives poses significant safety risks, leading to an increasing urgency for the development of green, safe, and effective natural preservatives. Nisin, the most intensively researched natural preservative in the food industry, has been approved by the U.S. Food and Drug Administration for use as a food additive and is also one of the natural food preservatives approved for use in my country. However, nisin only inhibits Gram-positive bacteria and has no activity against Gram-negative bacteria or fungi. Its antibacterial activity is also unstable and only works in acidic environments. These factors significantly limit its application in the food industry. Therefore, developing broad-spectrum natural preservatives and improving their antibacterial stability and scope of application are issues that need to be urgently addressed today.

[0003] Antimicrobial peptides (AMPs) are a class of small polypeptides with strong cationic properties, also known as cationic host defense peptides. They are widely found in bacteria, animals, and plants. Their sequences consist of only a few to dozens of amino acids. As an emerging class of natural biopreservatives, AMPs possess a unique membrane-disrupting mechanism: most AMPs possess both cationic and hydrophobic amino acid residues, making them amphipathic in polar biological environments. This allows them to rapidly lyse bacteria through electrostatic interactions with negatively charged bacterial cell membranes. This unique mechanism of action minimizes the potential for bacterial resistance. Furthermore, unlike the negatively charged bacterial cell membranes, the surface of normal mammalian cells is primarily composed of neutrally charged phospholipids, allowing AMPs to selectively kill bacteria without harming normal cells. Therefore, AMPs are considered to have great potential as natural preservatives due to their broad-spectrum antibacterial properties and strong biocompatibility.

[0004] Bacillus subtilis natto, a strain isolated from natto, is designated as Bacillus subtilis natto by the FDA as Generally Recognized as Safe (GRAS). Research has shown that some strains of Bacillus subtilis natto have the ability to produce antimicrobial peptides, making them promising safe and green alternatives to preservatives and antibiotics. Summary of the Invention

[0005] In order to overcome the shortcomings of the existing technology and provide a new antimicrobial peptide, the primary purpose of the present invention is to provide an antimicrobial peptide NDYT-8 derived from Bacillus subtilis.

[0006] The second object of the present invention is to provide an application of the Bacillus subtilis-derived antimicrobial peptide NDYT-8.

[0007] The primary purpose of the present invention can be achieved through the following technical solutions:

[0008] A Bacillus subtilis-derived antimicrobial peptide NDYT-8, whose amino acid sequence is as follows: Pro-Arg-Lys-Ile-Leu-Leu-Met-Val-Lys-Ala, and the single-letter abbreviation of the amino acid sequence is PRKILLMVKA;

[0009] The antimicrobial peptide NDYT-8 has a molecular weight of 1168.551 Da, a hydrophobicity of 60%, a positive charge of +3, and a molecular formula of C 54 H 101 N 15 O 11 S1, average hydrophilicity 0.61, isoelectric point 11.63, APD3 predicted that the antimicrobial peptide NDYT-8 can form an α-helix.

[0010] Preferably, the Bacillus subtilis-derived antimicrobial peptide NDYT-8 comprises a nucleic acid segment encoding the antimicrobial peptide NDYT-8.

[0011] Preferably, the nucleic acid sequence fragment encoding the antimicrobial peptide NDYT-8 is as follows:

[0012] ATTGAAGAATTTGTCCAATCCTGAAACA

[0013] CCCGCGCAAAATCTTATTAATGGTTAAAGCG

[0014] GGAACTGCAACAGATGCGACAATTCAATCT

[0015] CTTCTTCCTCATCTAGAGAAGGATGATATT (SEQ ID NO: 2).

[0016] Preferably, the method for preparing the Bacillus subtilis-derived antimicrobial peptide NDYT-8 comprises the following steps:

[0017] A peptide resin was obtained by solid-phase chemical synthesis using a peptide synthesizer. The obtained peptide resin was cleaved with trifluoroacetic acid to obtain the antimicrobial peptide NDYT-8. After purification by reverse-phase high-performance liquid chromatography, the preparation of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 was completed.

[0018] Preferably, the preparation method of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 comprises the following specific steps:

[0019] (1) Weigh 2-chlorotrityl chloride resin (2-CTC resin), swell it with dichloromethane in a reactor for half an hour, drain it, and wash it with DMF (N,N-dimethylformamide) three times;

[0020] (2) Take 1 eq of Fmoc-Ala-OH (N-fluorenylmethoxycarbonyl-alanine) and DMF (N,N-dimethylformamide) as solvent, and 1.5 eq of DIEA (N,N-diisopropylethylamine) to catalyze the reaction on the resin. Then, remove the reaction solution and wash with DMF 6 times.

[0021] (3) Seal the resin with methanol + DIEA for 1 hour and wash with DMF 6 times;

[0022] (4) Remove Fmoc (amino acid protecting group) with 20% piperidine in DMF solution and wash with DMF 8 times;

[0023] (5) 3eq of Fmoc-Lys(Boc)-OH (tert-butyloxycarbonyl-fluorenylmethoxycarbonyl-lysine), DMF as solvent, 3eq of DIC+HoBT (N,N'-diisopropylcarbodiimide+1-hydroxybenzotriazole) react with the resin, drain and wash;

[0024] (6) Remove amino acid protecting groups with 20% piperidine in DMF solution and wash;

[0025] (7) Repeat steps 5-6 according to the amino acid sequence until the N-terminal Pro is attached and the N-terminal Fmoc is removed;

[0026] (8) After the reaction is completed, the resin is washed and dried;

[0027] (9) 95% TFA + 2% Tis (triisopropylsilyl chloride) + 2% EDT (1,2-ethanedithiol) + 1% H2O were used to cut and cleave the resin, and then washed with ether to obtain a crude product;

[0028] (10) Purify and separate the crude product by high performance liquid chromatography to obtain a pure product;

[0029] (11), freeze-drying, and testing.

[0030] The second object of the present invention can be achieved through the following technical solutions:

[0031] The invention relates to an application of a Bacillus subtilis-derived antimicrobial peptide NDYT-8 in antimicrobial drugs or food preservatives.

[0032] Specifically, the Bacillus subtilis-derived antimicrobial peptide NDYT-8 is used in inhibiting and / or killing one or more antimicrobial drugs of Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella enteritidis.

[0033] Specifically, the Bacillus subtilis-derived antimicrobial peptide NDYT-8 is used in a food preservative for inhibiting and / or killing one or more of Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella enteritidis.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The antimicrobial peptide NDYT-8 described in the present invention has significant inhibitory effects against various foodborne pathogens, including Escherichia coli and Staphylococcus aureus, and offers advantages such as low hemolytic activity and high stability. This antimicrobial peptide was screened from FDA-certified "Generally Recognized as Safe" (GRAS) microorganisms, ensuring its safety. Furthermore, the amino acids in the antimicrobial peptide NDYT-8 provided by the present invention are all L-configured, resulting in a low synthesis cost. Therefore, it is expected to replace antibiotics and chemical preservatives, and has significant potential and application value in the fields of biomedicine, food preservation, and agricultural product preservation. The antimicrobial peptide NDYT-8 described in the present invention can be formulated into an antimicrobial drug or food preservative for the prevention and control of Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella enteritidis. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0037] Figure 1 This is the helical wheel diagram of the antimicrobial peptide NDYT-8;

[0038] Figure 2 This is the HPLC chromatogram of the solid phase synthesized antimicrobial peptide NDYT-8;

[0039] Figure 3This is the electrospray ionization mass spectrometry (ESI-MS) diagram of the solid-phase synthesized antimicrobial peptide NDYT-8;

[0040] Figure 4 This is a graph showing the antibacterial effect of the antimicrobial peptide NDYT-8 on Escherichia coli ATCC25922;

[0041] Figure 5 This is the bactericidal curve of the antimicrobial peptide NDYT-8 against Escherichia coli ATCC25922;

[0042] Figure 6 This is the experimental result of the hemolytic effect of the antimicrobial peptide NDYT-8 on mouse red blood cells. DETAILED DESCRIPTION

[0043] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described in detail below in conjunction with specific embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0044] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0045] Example 1: Screening of antimicrobial peptide NDYT-8

[0046] Combining the full genome sequence (CP121266.1) of Bacillus subtilis subsp. natto ND107105 and mass spectrometry identification of its antimicrobial metabolites, the researchers used the antimicrobial peptide prediction website APD3 (https: / / aps.unmc.edu / ) and the DRAMP Database (http: / / dramp.cpu-bioinfor.org / ) to screen for cationic short peptides with an α-helical structure and fewer than 15 amino acids, with a probability of antimicrobial activity exceeding 99%. Furthermore, the DBAASP database (https: / / dbaasp.org / tools?page=linear-amp-prediction) was used to screen for peptides with positive antibacterial activity against Staphylococcus aureus ATCC25923 and Escherichia coli ATCC25922 using a clustering and AI learning approach. This method yielded several short peptide sequences, including the antimicrobial peptide NDYT-8, which was chemically synthesized with a purity exceeding 95%.

[0047] The antimicrobial peptide NDYT-8 described in the present invention is a natural antimicrobial peptide derived from Bacillus subtilis natto subspecies. Combining mass spectrometry identification of metabolites and analysis and prediction of antimicrobial peptide databases, a novel antimicrobial peptide NDYT-8 with high efficiency and broad spectrum was screened out from the natural genome of Bacillus subtilis natto subspecies. The antimicrobial peptide NDYT-8 provided by the present invention has 10 amino acid residues, and its amino acid sequence is specifically: Pro-Arg-Lys-Ile-Leu-Leu-Met-Val-Lys-Ala. The single-letter abbreviation sequence of the amino acid sequence is PRKILLMVKA. The molecular weight of the antimicrobial peptide NDYT-8 is 1168.551Da, the hydrophobicity is 60%, the total electrostatic charge is +3, and the molecular formula is C 54 H 101 N 15 O 11 S1, average hydrophilicity 0.61, isoelectric point 11.63. The antimicrobial peptide NDYT-8 described in the present invention has significant antibacterial activity against both Gram-positive and Gram-negative pathogens, and has advantages such as low hemolysis, high stability, and high efficacy. This antimicrobial peptide was screened from FDA-certified "Generally Recognized as Safe" (GRAS) microorganisms, ensuring safety and promising potential as an alternative to antibiotics and chemical preservatives. It has significant potential and application value in the fields of biomedicine, food, and agricultural product preservation.

[0048] Example 2: Preparation method of the antimicrobial peptide NDYT-8 described in Example 1

[0049] The antimicrobial peptide NDYT-8 was synthesized by solid-phase chemical synthesis: the preparation of the antimicrobial peptide NDYT-8 was carried out one by one from the C-terminus to the N-terminus using a peptide synthesizer. The specific steps are as follows:

[0050] (1) Weigh 2-CTC resin, swell it with DCM in a reactor for 0.5 h, drain it, and wash it with DMF three times;

[0051] (2) Take 1 eq of Fmoc-Ala-OH, use DMF as solvent, and catalyze the reaction on the resin with 1.5 eq of DIEA. Then remove the reaction solution and wash with DMF 6 times.

[0052] (3) Seal the resin with methanol + DIEA for 1 hour and wash with DMF 6 times;

[0053] (4) Remove Fmoc with 20% piperidine in DMF solution and wash with DMF 8 times;

[0054] (5) 3eq of Fmoc-Lys(Boc)-OH, DMF as solvent, 3eq (DIC+HoBT) reacted with the resin, dried, and washed;

[0055] (6) Remove Fmoc with 20% piperidine in DMF solution and wash;

[0056] (7) Repeat steps (5)-(6) from the C-terminus to the N-terminus in the order of amino acids PRKILLMVKA until the Pro at the N-terminus is connected and the Fmoc at the N-terminus is removed; obtain a resin with the side chain protection of the Fmoc group removed;

[0057] (8) After the reaction is completed, the resin is washed and dried;

[0058] (9) Add a cleavage reagent to the peptide resin obtained above, 95% TFA (trifluoroacetic acid) + 2% Tis (triisopropylsilyl chloride) + 2% EDT + 1% H2O to cleave the resin, and wash with ether precipitation to obtain a crude polypeptide;

[0059] (10) The peptide was dissolved in 15% ACN solution, and the eluent A was 0.1% TFA / water solution; the eluent B was 0.1% TFA / acetonitrile solution, the elution concentration was 10% to 70%, the elution time was 30 min, the detection wavelength was 220 nm, the flow rate was 1 mL / min, the main peak was collected, and lyophilized; the purified antimicrobial peptide NDYT-8 (such as Figure 2 shown);

[0060] (11) Identification of antimicrobial peptide NDYT-8: The antimicrobial peptide NDYT-8 obtained above was analyzed by electrospray mass spectrometry. The theoretical molecular weight was basically consistent with the measured molecular weight. The purity of the antimicrobial peptide NDYT-8 was greater than 95% (e.g. Figure 3 shown).

[0061] Example 3: Determination of antibacterial activity of antimicrobial peptide NDYT-8

[0062] The antibacterial activity of the antimicrobial peptide NDYT-8 was tested using the doubling microdilution method. The minimum inhibitory concentration (MIC) was determined, i.e., the lowest drug concentration that can inhibit bacterial growth and reproduction. The strains involved in this example include Gram-positive pathogens Staphylococcus aureus ATCC 29213 and Listeria monocytogenes ATCC 19115; Gram-negative pathogens Escherichia coli ATCC 25922, Salmonella enteritidis ATCC 14028, and Vibrio parahaemolyticus ATCC 17802.

[0063] Cultivate the indicator bacteria in LB medium until the exponential growth phase, dilute the bacterial solution with MH medium to adjust the concentration to 107 CFU / mL, and dispense 90 μL of the bacterial solution into each well of a 96-well plate;

[0064] The antimicrobial peptide NDYT-8 (4 mg / mL) was dissolved in DMSO and gradiently diluted with MH medium to (2-1000 μg / mL). 90 μL was added to a 96-well culture plate containing the bacterial solution to be tested according to the concentration gradient, and three wells were set for each concentration; 90 μL sterile PBS + 90 μL MH medium was used as a negative blank control, and 90 μL MH medium + 90 μL bacterial suspension was used as a positive blank control.

[0065] The 96-well plate was placed in a constant temperature shaker at 37°C and 160 rpm for 24 h;

[0066] The light absorbance of the bacterial solution at 600 nm was detected using an enzyme-labeled instrument, and the average of the sample concentrations of the well where no bacterial growth was detected and the adjacent wells was taken as the minimum inhibitory concentration (MIC).

[0067] The antibacterial activity of the antimicrobial peptide NDYT-8 against various foodborne pathogens was verified in three replicates, as shown in the table below. The MIC values ​​ranged from 16 to 128 μg / mL. NDYT-8 exhibited relatively strong antibacterial activity against Gram-negative bacteria, with MIC values ​​less than 40 μg / mL.

[0068]

[0069] Example 4: Determination of bacterial growth inhibition curve of antimicrobial peptide NDYT-8

[0070] The bacterial strains involved in this embodiment are the Gram-positive bacteria Staphylococcus aureus subsp. Aureus ATCC 29213 and the Gram-negative bacteria Escherichia coli ATCC 25922.

[0071] The bacteria to be tested were placed in LB medium and cultured at 37°C and 220 rpm for 12 h; then transferred to MH medium at a ratio of 1:100 and cultured for another 2.5 h at 37°C and 220 rpm; the bacterial solution was diluted with MH medium to OD600 = 0.1;

[0072] Take 150 μL of MH culture medium and place it in a 96-well plate. Add 10 μL of the test bacterial solution to each well. Add the antimicrobial peptide NDYT-8 with final concentrations of 0 MIC, 1 MIC, 3 MIC, and 5 MIC in sequence, mix well, place in a microplate reader, culture at 37°C, measure OD600 readings every 2 hours, and measure for 10 hours; draw a growth curve.

[0073] The results are as follows Figure 5As shown, three repeated experiments showed that as the concentration of antimicrobial peptide NDYT-8 increased, bacterial growth was inhibited. When the concentration of antimicrobial peptide increased to 3MIC (50-200 μg / mL), the growth of Escherichia coli and Staphylococcus aureus was significantly inhibited.

[0074] Example 5: Hemolytic activity of antimicrobial peptide NDYT-8 on fresh mouse erythrocytes

[0075] Fresh mouse blood was collected and centrifuged at 1000 rpm for 10 min in a centrifuge tube. The supernatant was removed and the red blood cell pellet was taken out. The pellet was washed twice with PBS and centrifuged again at 1000 rpm for 10 min. The supernatant was removed and physiological saline was added to the centrifuge tube to prepare a cell suspension containing 6% (v / v) red blood cells. 100 μL / well of the suspension was aliquoted into a 96-well plate.

[0076] PBS buffer (pH 7.4) was prepared with different concentration gradients of antimicrobial peptides (0 μg / mL, 40 μg / mL, 100 μg / mL, 200 μg / mL); PBS solution was used as the negative control group, and polymyxin (200 μg / mL) was used as the positive control.

[0077] Add 100 μL of antimicrobial peptide and positive control to a 96-well plate containing mouse blood and incubate at 37°C for 60 min.

[0078] The 96-well plate was removed and centrifuged (3000×g, 5 min, 4°C). 100 μL of the supernatant was transferred to a new 96-well plate, and the hemoglobin release in the supernatant was evaluated by measuring the absorbance at 540 nm using a microplate reader.

[0079] like Figure 6 As shown, three repeated experiments showed that the antimicrobial peptide solution was incubated with mouse red blood cell suspension. The OD540 test results showed that compared with the control group, the antimicrobial peptide NDYT-8 did not cause obvious hemolysis of red blood cells when the concentration reached 200 μg / mL, and was relatively safe.

[0080] In summary, the present invention provides an antimicrobial peptide NDYT-8, the amino acid sequence of which is shown in SEQ ID NO. 1, specifically PRKILLMVKA.

[0081] The antimicrobial peptide NDYT-8 provided by the present invention is a short sequence that can form an amphipathic α-helical structure. It contains 10 amino acids, has a molecular weight of 1168.551 daltons, and is a linear polypeptide with all amino acids in L-type form. In vitro antibacterial experiments demonstrated that the antimicrobial peptide NDYT-8 has broad-spectrum antimicrobial activity, exhibiting significant antibacterial activity against standard strains of Staphylococcus aureus, Listeria monocytogenes, Salmonella Enteritidis, and Vibrio parahaemolyticus, with a minimum inhibitory concentration (MIC) of 16 μg / mL. It also exhibits low hemolytic activity.

[0082] In the present invention, the preparation method of the antimicrobial peptide NDYT-8 is a polypeptide solid phase synthesis method. The present invention has no special requirements for the polypeptide solid phase synthesis method, and methods well known to those skilled in the art can be used.

[0083] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A Bacillus subtilis-derived antimicrobial peptide NDYT-8, characterized in that: Its amino acid sequence is as follows: Pro-Arg-Lys-Ile-Leu-Leu-Met-Val-Lys-Ala, the single-letter abbreviation sequence of the amino acid sequence is PRKILLMVKA; The antimicrobial peptide NDYT-8 has a molecular weight of 1168.551 Da, a hydrophobicity of 60%, a positive charge of +3, a molecular formula of C54H101N15O11S1, an average hydrophilicity of 0.61, an isoelectric point of 11.63, and is predicted by APD3 to form an α-helix.

2. A nucleic acid fragment encoding the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 1.

3. The nucleic acid fragment of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 2, wherein: The nucleic acid fragment is selected from any one of the following: ATTGAAGAATTTGTCCAATCCTTGGAAACA; CCCGCGCAAAATCTTATTAATGGTTAAAGCG; GGAACTGCAACAGATGCGACAATTCAATCT; CTTCTTCCTCATCTAGAGAAGGATGATATT.

4. A method for preparing the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 1, characterized in that: The steps include: The peptide resin was obtained by solid-phase chemical synthesis using a peptide synthesizer, and the obtained peptide resin was cut with TFA to obtain the antimicrobial peptide NDYT-8; after purification by reverse-phase high-performance liquid chromatography, the preparation of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 was completed.

5. The method for preparing the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 4, characterized in that: The specific steps are as follows: (1) Weigh 2-CTC resin, swell it with DCM in a reactor for half an hour, drain it, and wash it with DMF three times; (2) Take 1eq of Fmoc-Ala-OH, use DMF as solvent, and catalyze the reaction with 1.5eq of DIEA on the resin. Draw off the reaction solution and wash with DMF 6 times. (3) Seal the resin head with methanol + DIEA for 1 hour and wash with DMF 6 times; (4) Remove Fmoc with 20% piperidine in DMF solution and wash with DMF 8 times; (5) 3eq of Fmoc-Lys(Boc)-OH, DMF as solvent, 3eq (DIC+HoBT) reacted with the resin, dried, and washed; (6) Remove Fmoc with 20% piperidine in DMF solution and wash; (7) Repeat steps 5-6 according to the amino acid sequence until the N-terminal Pro is attached and the N-terminal Fmoc is removed; (8) After the reaction is completed, the resin is washed and dried; (9) The resin was cleaved by 95% TFA + 2% Tis + 2% EDT + 1% H2O, and washed with ether to obtain a crude product; (10) Purify and separate the crude product by high performance liquid chromatography to obtain a pure product; (11), freeze-drying, and testing.

6. Use of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 1 in the preparation of one or more antimicrobial drugs that inhibit and / or kill Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella enteritidis.

7. Use of the Bacillus subtilis-derived antimicrobial peptide NDYT-8 according to claim 1 in the preparation of a food preservative that inhibits and / or kills one or more of Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella enteritidis.

Images