G-quadruplex-based nucleic acid molecules and their applications

Abstract

The present invention discloses a G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine, and the G-quadruplex-based nucleic acid molecule comprises a DNA sequence shown in Formula I or a variant thereof. The present invention also provides the use of the G-quadruplex-based nucleic acid molecule for detecting epiberberine or extracting epiberberine. The present invention also provides a method for extracting epiberberine using the G-quadruplex-based nucleic acid molecule. The G-quadruplex-based nucleic acid molecule provided by the present invention has a higher binding affinity for epiberberine. The method for extracting epiberberine provided by the present invention can achieve efficient extraction of epiberberine only by regulating the ionic environment of an aqueous solution, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a nucleic acid molecule based on a G-quadruplex. The present invention also relates to an application of the nucleic acid molecule based on the G-quadruplex, and also relates to a method for extracting epiberberine from coptis chinensis using the nucleic acid molecule based on the G-quadruplex. Background Art

[0002] Coptis chinensis is a commonly used traditional Chinese medicine. The Chinese Pharmacopoeia lists Coptis chinensis Franch., Coptis deltoidea CYCheng et Hsiao or Coptis teeta Wall., all plants of the Ranunculaceae family, as the dried rhizome. Coptis chinensis Franch. is bitter in taste and cold in nature. It has the functions of purging fire, detoxifying, clearing heat and drying dampness. Pharmacological studies in recent years have shown that Coptis chinensis has significant therapeutic effects in anti-cancer, anti-bacterial and anti-inflammatory, antihypertensive, and heat-clearing and detoxifying. The main active small molecules in Coptis chinensis are a class of alkaloid molecules, including berberine, epiberberine, coptis pine, jatrorrhizine, bamatin, etc. Although berberine has the highest content and has been proven to have certain biological therapeutic activity, other alkaloids such as epiberberine have also been proven to be low-toxic candidate drugs with anti-cancer and bactericidal activities in recent years. Since the chemical properties and chemical structures of alkaloid molecules in Coptis chinensis are extremely similar, it is of great significance to efficiently separate and purify the small molecules of alkaloids in Coptis chinensis.

[0003] In the prior art, liquid chromatography is usually used to separate alkaloid molecules in crude extracts of Coptis chinensis. For example, Liu Zhaoliang et al. [Preparation of fat-soluble alkaloids in Coptis chinensis by high-speed countercurrent chromatography, Journal of Traditional Chinese Medicine, 2010, No. 11] used n-hexane-ethyl acetate-methanol-water (3:7:5:5; 1.5:5:1.5:5) and n-hexane-ethyl acetate-methanol-0.2 mol / L hydrochloric acid (1:3.5:2.5:4.5), with the upper phase as the stationary phase and the lower phase as the mobile phase. Phase, high-speed countercurrent chromatography was used to separate the fat-soluble alkaloids in Coptis chinensis. Four high-purity fat-soluble alkaloids, Cheilan-thifoline (purity: 76.1%), Thalictrifoline (purity: 83.1%), Tetrahydropalmatine (purity: 85.5%), and Canadine (purity: 78.5%), were obtained from the crude ethyl acetate extract of Coptis chinensis. Chu Jianjun et al., Separation of alkaloids from traditional Chinese medicine by preparative high-speed countercurrent chromatography, Journal of Zhejiang University of Technology, Issue 1, 2006. Using chloroform: methanol: 0.1 mol / L dilute hydrochloric acid = 2:1:1 as the solvent system, palmatine, berberine, epiberberine, and coptisine were separated from Coptis chinensis by high-speed countercurrent chromatography.

[0004] In the prior art, the technical solution for separating and purifying alkaloids in Coptis chinensis using liquid chromatography can also be as follows: Mobile phase A is generally water containing 0.1% trifluoroacetic acid or 0.2% phosphorous acid, and mobile phase B is generally acetonitrile or methanol containing an acid. The column temperature range is between 30°C and 45°C, and the commonly used detection wavelength is 270 nm or 337 nm. Gradient elution is generally used, and the flow rate is generally 0.8 mL / min, 1 mL / min, and 1.5 mL / min.

[0005] Obviously, these methods all require repeated adsorption-desorption distribution processes, which then result in significant differences in the moving speed, causing different retention times when flowing out of the chromatographic column. Through this difference, various alkaloid components in Coptis chinensis are separated and extracted. Therefore, the disadvantages of using liquid chromatography to separate and purify epiberberine in Coptis chinensis are obvious. For example, it has a strong dependence on the instrument platform and chromatographic column material, generally requiring a reverse chromatographic column; a good high-performance liquid chromatography instrument platform; the chemical reagents used are not environmentally friendly, such as trifluoroacetic acid, methanol, acetonitrile, etc.; the separation and extraction cost is relatively high, such as having high requirements for the purity of the mobile phase solvent and a large amount used each time; and the sample loading amount for each purification is limited, thus restricting the overall working efficiency.

[0006] Therefore, there is a current need for a method for preparing epiberberine that is highly efficient, simple to operate, and environmentally friendly. Summary of the Invention

[0007] Therefore, based on the prior art, the object of the present invention is to provide a G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine, and a method for extracting epiberberine using the G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine.

[0008] Compared with the prior art, the method of the present invention is environmentally friendly, simple to operate, and can effectively extract alkaloid molecules in Coptis chinensis, especially epiberberine.

[0009] The object of the present invention is achieved by the following technical solutions:

[0010] The first aspect of the present invention provides a G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine, and the G-quadruplex-based nucleic acid molecule comprises a DNA sequence shown in Formula I or a variant thereof:

[0011] 5’-(TTAGGG) n TTA-3’

[0012] Formula I

[0013] Wherein, the n is an integer ≥ 4, preferably independently selected from integers of 4 to 12, and preferably n is 4 or n is 8.

[0014] In a preferred embodiment, when n is 4 - 7, the G - quadruplex - based nucleic acid molecule further comprises additional nucleic acid to form a hairpin structure or a complementary double - stranded structure at the 5' end.

[0015] Preferably, when n is 4, the G - quadruplex - based nucleic acid molecule further comprises additional nucleic acid to form a hairpin structure or a complementary double - stranded structure at the 5' end.

[0016] Preferably, the additional nucleic acid is selected from the following DNA sequences:

[0017] 5'-CCTGGCTTCGGCCAGG - 3'(SEQ ID NO:8),

[0018] 5'-ACCTGGCTTCGGCCAGG - 3'(SEQ ID NO:9).

[0019] Preferably, in the (TTAGGG) n repeat unit, the unit for connecting the additional nucleic acid contains a T→A mutation, for example, TTAGGG for connecting the additional unit is changed to TAAGGG.

[0020] In a preferred embodiment, when n is 8, the G - quadruplex - based nucleic acid molecule is:

[0021] 5'-(TTAGGG)4 - L-(TTAGGG)4TTA - 3'

[0022] wherein, the L is a linker, for example, the L is one, two or three deoxyribonucleotides, such as T, TT or TTA.

[0023] In a preferred embodiment, the G - quadruplex - based nucleic acid molecule comprises a DNA sequence shown in any one of SEQ ID NO:1 - 7, or a sequence that has high homology with the DNA sequence shown in any one of SEQ ID NO:1 - 7 and can specifically bind to berberine; or the G - quadruplex - based nucleic acid molecule comprises a sequence derived from the DNA sequence shown in any one of SEQ ID NO:1 - 7 and can specifically bind to berberine.

[0024] SEQ ID NO:1

[0025] SEQ ID NO:25’-ACCTGGCTTCGGCCAGGTTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q4-ds-A)

[0026] SEQ ID NO:3

[0027] SEQ ID NO:4

[0028] SEQ ID NO:5 5’-TTAGGGTTAGGGTTAGGGTTAGGG T TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-T)

[0029] SEQ ID NO:6 5’-TTAGGGTTAGGGTTAGGGTTAGGG TT TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-TT)

[0030] SEQ ID NO:7 5’-TTAGGGTTAGGGTTAGGGTTAGGG TTA TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-TTA).

[0031] In a preferred embodiment, the G-quadruplex-based nucleic acid molecule comprises a DNA sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 5.

[0032] Specifically, the applicant found that the binding affinity between berberine and the G-quadruplex-based nucleic acid molecule is in the μM level, while the binding affinity between the G-quadruplex-based nucleic acid molecule provided in the present invention and berberine can reach the nM level. Among them, for certain specific G-quadruplex-based nucleic acid molecules, the affinity with berberine reaches 8 ± 2 nM, showing a relatively high affinity.

[0033] As a preferred embodiment of the present invention, the sequence of the G-quadruplex-based nucleic acid molecule may further comprise base modification.

[0034] Among them, the base modification enables the G-quadruplex-based nucleic acid molecule to have higher affinity compared with before modification.

[0035] As a preferred embodiment of the present invention, the base modification is thiolation modification, phosphorylation modification, methylation modification, amination modification, mercaptan modification, selenium substitution for oxygen modification or isotope-linked modification.

[0036] As a preferred embodiment of the present invention, the nucleotide sequence of the G-quadruplex-based nucleic acid molecule contains a marker.

[0037] As a preferred embodiment of the present invention, the marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxin marker, a nano-luminescent material marker, a small peptide marker, an siRNA marker or an enzyme marker.

[0038] The second aspect of the present invention provides a kit comprising the above-mentioned G-quadruplex-based nucleic acid molecule capable of specifically binding epiberberine.

[0039] The third aspect of the present invention provides the use of the above-mentioned G-quadruplex-based nucleic acid molecule capable of specifically binding epiberberine.

[0040] As a preferred embodiment of the present invention, the use is for detecting epiberberine.

[0041] As a preferred embodiment of the present invention, the use is for extracting epiberberine from Coptis chinensis.

[0042] The fourth aspect of the present invention provides a method for extracting epiberberine from Coptis chinensis, the method comprising the step of using the above-mentioned G-quadruplex-based nucleic acid molecule capable of specifically binding epiberberine.

[0043] In a preferred embodiment, the method is a magnetic bead method, a chromatographic column method or an ultrafiltration method.

[0044] In a preferred embodiment, the method is a magnetic bead method and comprises the following steps:

[0045] 1) Obtain a crude extract of Coptis chinensis;

[0046] 2) Contact the G-quadruplex-based nucleic acid molecule of the present invention with magnetic beads so that the G-quadruplex-based nucleic acid molecule is immobilized on the magnetic beads;

[0047] 3) In an environment containing potassium ions, contact the magnetic beads obtained in step 2 with the crude extract of Coptis chinensis obtained in step 1 and incubate.

[0048] 4) Transfer the magnetic beads in step 3) to an environment without potassium ions, take the supernatant to obtain a purified epiberberine solution.

[0049] The method is a chromatographic column method and includes the following steps:

[0050] 1) Obtain a crude extract of Coptis chinensis.

[0051] 2) Contact the G-quadruplex-based nucleic acid molecule of the present invention with a solid-phase affinity packing material, so that the G-quadruplex-based nucleic acid molecule is covalently fixed to the solid-phase affinity packing material.

[0052] 3) Pack the solid-phase affinity packing material into an affinity chromatography column.

[0053] 4) In an environment containing potassium ions, contact the affinity chromatography column obtained in step 3) with the crude extract of Coptis chinensis in step 1) and incubate.

[0054] 5) Use a solution without potassium ions as an eluent for elution to obtain a purified epiberberine solution; or

[0055] The method is an ultrafiltration method and includes the following steps:

[0056] 1) Obtain a crude extract of Coptis chinensis.

[0057] 2) In an environment containing potassium ions, contact the G-quadruplex-based nucleic acid molecule of the present invention with the crude extract of Coptis chinensis in step 1) and incubate.

[0058] 3) Centrifugally ultrafilter using an ultrafiltration membrane with a molecular weight cut-off of not less than 2000 Da and retain the unpermeated substance.

[0059] 4) Centrifugally elute the unpermeated substance in step 3) with a solution without potassium ions as an eluent to obtain a purified epiberberine solution.

[0060] Preferably, the method further includes the steps of concentrating and crystallizing the obtained epiberberine solution to obtain epiberberine crystals.

[0061] Preferably, the method further includes the step of removing sodium ions using an ion exchange resin method.

[0062] Preferably, in step 1), the crude extract of Coptis chinensis can be an aqueous solution of its crude extract of Coptis chinensis, where the concentration of the aqueous solution can be 0.01 - 100 mg / mL. For example, the concentration (mg / mL) can be 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10 or higher, such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0 or higher, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or higher, or any value therebetween, etc.

[0063] Preferably, the potassium ion-containing environment is an inorganic salt solution containing potassium ions, such as a KCl solution.

[0064] Preferably, the concentration of the potassium ions is 1 - 500 mM, more preferably 1 - 200 mM, and further preferably 10 - 100 mM. For example, the concentration (mM) can be 20, 30, 40, 50, 60, 70, 80, 90, etc.

[0065] Preferably, the potassium ion-free environment is pure water, a sodium ion-containing environment or a hydrochloric acid solution; more preferably, the sodium ion-containing environment is an inorganic salt solution containing sodium ions, such as NaCl. Preferably, the concentration of the sodium ions is 1 - 200 mM, more preferably 100 - 200 mM. For example, the concentration (mM) can be 110, 120, 130, 140, 150, 160, 170, 180, 190, etc.

[0066] In the present application, the inventors found that specific G-quadruplex-based nucleic acid molecules can bind to epiberberine with high specificity, and the binding strength is several times that of berberine, such as five times, ten times or higher. Therefore, specific G-quadruplex-based nucleic acid molecules can be used to separate epiberberine from various alkaloids. Further, the specific G-quadruplex-based nucleic acid molecules of the present invention can strongly bind to epiberberine in a potassium ion environment, while dissociate from epiberberine in a sodium ion environment. At the same time, G-quadruplex-based nucleic acid molecules can be covalently coupled to magnetic beads. In summary, the method of the present invention is based on the high-specific binding of specific G-quadruplex-based nucleic acid molecules to epiberberine, the covalent coupling of magnetic beads and nucleic acid molecules, and the binding and dissociation of epiberberine in different ion environments, achieving the high-efficiency separation and purification of epiberberine from Coptis chinensis extract, and having unexpected technical effects.

[0067] Compared with the prior art, the present invention has the following advantages:

[0068] The present invention provides a G-quadruplex-based nucleic acid molecule that can specifically bind to epiberberine.

[0069] Based on the tight binding of the G-quadruplex-based nucleic acid molecule provided by the present invention to magnetic beads, it can also have a strong binding force with epiberberine. Therefore, by regulating the ionic environment of the aqueous solution, the efficient binding and dissociation regulation of the G-quadruplex-based nucleic acid molecule of the present invention and epiberberine can be achieved, and epiberberine can be effectively extracted from Coptis chinensis.

[0070] Compared with the traditional liquid chromatography separation and purification, the method for extracting epiberberine from Coptis chinensis of the present invention does not involve the use of organic reagents, is more environmentally friendly; avoids the use of expensive high-performance liquid chromatography instrument platforms; further, the present invention can achieve the efficient extraction of epiberberine only by regulating the ionic environment of the aqueous solution, and has broad application prospects.

[0071] The present invention is illustrated by the accompanying drawings and examples. These examples are not limitations of the present invention. Brief Description of the Drawings

[0072] In order to more clearly illustrate the technical solutions of the present invention, the technical solutions of the present invention will be described in detail below with reference to the drawings:

[0073] Figure 1 Shown are the sequences of the G-quadruplex-based nucleic acid molecule and the control molecule according to an embodiment of the present invention.

[0074] Figure 2 Shown is the dissociation constant K measured by fluorescence titration according to an embodiment of the present invention. D ; The results show that the designed DNA Q4-ds-A has the strongest binding effect with it, and K D can reach about 8 nM;

[0075] a Refers to the K value of the binding of DNA and epiberberine in a potassium ion environment. D Value;

[0076] b Refers to the K value of the binding of DNA and berberine in a potassium ion environment. D Value;

[0077] c Refers to the K value of the binding of DNA and epiberberine in a sodium ion environment. D Value.

[0078] Figure 3 Shown are the fluorescence titration curves of different DNA titrating epiberberine according to an embodiment of the present invention, showing different dissociation constants, that is, different binding forces.

[0079] Figure 4Shown as another embodiment of the present invention, the cell confocal experiment reflects that the designed Q4-ds-A has a stronger binding force with berberrubine than Q4, thus reflecting a greater degree of co-localization with berberrubine at the cellular level (cytoplasm).

[0080] Figure 5 Shown as another embodiment of the present invention, a flowchart for efficiently purifying berberrubine from the crude extract of Coptis chinensis using the magnetic bead method; (A) Schematic diagram of the principle of magnetic bead extraction and HPLC signal of berberrubine; (B) Schematic diagrams of the crude extract of Coptis chinensis in solid and solution states, and chemical structural formulas of five main alkaloid molecules therein; (C) Comparison of HPLC signals before and after extracting alkaloid small molecules from the crude extract of Coptis chinensis using this magnetic bead method; (D) By modifying the DNA sequence, 58% of berberrubine was successfully extracted from the crude extract of Coptis chinensis using the conjugate of DNA Q4-ds-A and magnetic beads. Detailed implementation manners

[0081] The following specific test examples are used to illustrate the technical solutions of the present invention, but the protection scope of the present invention is not limited thereto.

[0082] The content described in the test examples of this specification is only a list of implementation forms of the inventive concept. The protection scope of the present invention should not be regarded as limited to the specific forms stated in the test examples. The protection scope of the present invention also extends to equivalent technical means that those skilled in the art can think of based on the inventive concept of the present invention. Although the following embodiments of the present invention have been described, the present invention is not limited to the above specific embodiments and application fields. The following specific embodiments are only illustrative and guiding, rather than restrictive. Those of ordinary skill in the art can also make many forms under the inspiration of this specification and without departing from the scope protected by the claims of the present invention, and these all fall within the scope of protection of the present invention.

[0083] Definitions:

[0084] Berberrubine

[0085] Berberrubine is an important pharmacological component in Coptis chinensis. Modern pharmacological studies have shown that berberrubine has a wide range of pharmacological activities such as anti-hyperlipidemia, hypoglycemic, anti-inflammatory, anti-Alzheimer's, antioxidant, cytochrome enzyme inhibition, and aldose reductase inhibition. Its chemical structural formula is shown in Figure 5 B.

[0086] G-quadruplex, which can be used interchangeably with G-quartet.

[0087] G-quadruplex, namely guanine-quadruplex (G-quadrμplex, G-quadruplex) is a special secondary structure of DNA. Many guanine (G)-rich regions in the human genome have the ability to form this structure, including the guanine repeat sequences at the telomere ends, as well as the promoter regions of various genes, such as c-kit, c-myc, c-myb, bcl-2, PDGF, kRAS, VEGF, Rb, and insulin genes, etc. Human telomeric DNA is a double-stranded region at the chromosome ends composed of the DNA repeat sequence TTAGGG, and its end is a single-stranded overhang rich in G bases containing 100-200 nt (nucleotides). Although most of them tend to form monomeric G-tetrads, there are still a few that tend to form more complex diploid or polyploid G-quadruplex structures connected by the TTA base sequence. Moreover, the formation of polyploid G-quadruplexes only appears in human telomeric DNA and the r(GGGGCC)n RNA repeat sequences related to amyotrophic lateral sclerosis (ALS).

[0088] Materials:

[0089] The DNA sequences were synthesized by Suzhou Beixin Biotechnology Co., Ltd.;

[0090] The crude extract of Coptis chinensis was purchased from Yifang Pharmaceutical (Guangzhou) Co., Ltd.;

[0091] The reagents used in the experiments were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0092] Example 1: Sequence Screening and Preparation of G-Quadruplex-Based Nucleic Acid Molecules (G-Quadruplexes)

[0093] The exemplary sequences of this application are shown in SEQ ID NO: 1-7;

[0094] SEQ ID NO:1

[0095] SEQ ID NO:2 5’-ACCTGGCTTCGGCCAGGTTAGGGTTAGGGTTAGGGTTAGGGTTA-3’ (Q4-ds-A)

[0096] SEQ ID NO:3

[0097] SEQ ID NO:4

[0098] SEQ ID NO:5 5’-TTAGGGTTAGGGTTAGGGTTAGGG T TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-T)

[0099] SEQ ID NO:6 5’-TTAGGGTTAGGGTTAGGGTTAGGG TT TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-TT)

[0100] SEQ ID NO:7 5’-TTAGGGTTAGGGTTAGGGTTAGGG TTA TTAGGGTTAGGGTTAGGGTTAGGGTTA-3’(Q8-TTA).

[0101] On this basis, the applicant also synthesized the following sequences:

[0102] Q1: TTAGGGTTA

[0103] Q2: TTAGGGTTAGGGTTA (SEQ ID NO:10)

[0104] Q3: TTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:11)

[0105] Q4: TTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:12)

[0106] Q5: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:13)

[0107] Q6: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:14)

[0108] Q7: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:15)

[0109] Q8: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:16)

[0110] Q12: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:17)

[0111] Q4-d(U2)-d(U13): TUAGGGTTAGGGUTAGGGTTAGGGTTA (SEQ ID NO:18, where thymine is replaced by uracil at the second and thirteenth positions)

[0112] Q4-3CTTCGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:19)

[0113] (Q4-ds-TAA)TAACCTGGCTTCGGCCAGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:20)

[0114] (Q4-ds-AA)AACCTGGCTTCGGCCAGGTTAGGGTTAGGGTTAGGGTTAGGGTTA (SEQ ID NO:21)

[0115] Q4-ds-A-d(U2)-d(U13): ACCTGGCTTCGGCCAGGTUAGGGTTAGGGUTAGGGTTAGGGTTA (SEQID NO:22, where thymine is replaced by uracil at the second and thirteenth positions)

[0116] Pu27: TGGGGAGGGTGGGGAGGGTGGGGAAGG (SEQ ID NO:23)

[0117] The above sequences were synthesized by Suzhou Beixin Biotechnology Co., Ltd.; all contain modified thiol groups for binding to epoxy groups on magnetic beads.

[0118] Example 2: Binding Strength Measurement

[0119] The specific steps for measuring the binding affinity using fluorescence titration in this example: The fluorescence emission spectra were measured by a fluorescence spectrometer - Varian Cary. All fluorescence tests included 10 nM epiberberine and different concentrations of G - quadruplex DNA, and the concentrations of the G - quadruplex DNA used were 0 μM, 0.001 μM, 0.002 μM, 0.005 μM, 0.01 μM, 0.02 μM, 0.05 μM, 0.1 μM, 0.2 μM, 0.5 μM, 1 μM, 2 μM, 5 μM, and 10 μM respectively.

[0120] The buffer solution system used included 100 mM NaCl or 100 mM KCl, 0.5 mM EDTA, and 20 mM HEPES (pH 7.5).

[0121] Before the test, the test samples were slowly cooled from 95 °C to room temperature, then DNA was added and shaken for about 10 minutes, left at room temperature for one hour, and stored at 4 °C for overnight incubation.

[0122] The excitation wavelength set was 377 nm, the scanning range was from 450 nm to 700 nm (at room temperature), and the position of the emission peak was around 540 nm.

[0123] Through the formula: (K D ): Y = Y0+(B / (2R0))(R0 + X + K D -((R0 + X + K D ) 2 -4R0X)^(1 / 2)), the value of K D can be fitted by origin software, where Y0 is the fluorescence intensity without adding DNA, R0 is the concentration of epiberberine, which is 0.01 μM here, and B is the difference between the fluorescence intensity at the highest titration concentration and Y0.

[0124] Figure 2 is the dissociation constant K D measured by fluorescence titration; the results show that the designed DNA Q4 - ds - A has the strongest binding effect with it, and K D can reach about 8 nM;

[0125] a refers to the value of K D when DNA binds to epiberberine in a potassium ion environment;

[0126] b refers to the value of K D when DNA binds to berberine in a potassium ion environment;

[0127] c refers to the value of K when DNA binds to epiberberine in a sodium ion environmentD Numerical value.

[0128] Figure 3 It shows that the fluorescence titration curves of different DNA titrations of berberine exhibit different dissociation constants, that is, different binding forces. The results show that the designed DNA Q4-ds-A has the strongest binding effect with it, and K D can reach about 8 nM.

[0129] The applicant also adjusted the concentration of KCl in the used KCl buffer, which were 50 mM, 100 mM, and 200 mM respectively.

[0130] The applicant found that when using KCl as the potassium ion environment, different potassium ion concentrations would affect the binding effect between G-quadruplex DNA and berberine. Generally speaking, the lower the potassium ion concentration, the stronger the binding force. However, when the potassium ion concentration is too low, the folding of DNA will not be as expected. Therefore, using potassium ions with a concentration of 50 mM to 100 mM can obtain better results. Among them, the binding force of 50 mM potassium ions is better than that of 100 mM potassium ions, but when the potassium ion concentration is 200 mM, the binding force is weaker than that of 50 mM to 100 mM potassium ions. Therefore, when the KCl concentration is 50 mM to 100 mM, especially 50 mM, it has the best EPI binding effect.

[0131] Example 3: Cell Confocal Experiment

[0132] Confocal fluorescence imaging assays.

[0133] After treating HEK293T cells with 0.25% trypsin, they were counted by a cell counter and seeded into a sterile 96-well cell culture plate at a standard of 1×10 5 cells / well, and cultured in a 37 °C incubator containing 5% CO2. After they grew into a monolayer, the culture medium was discarded, and 10 μM berberine, 1 μM Cy5-labeled DNA (Q4-ds-A, Q4, and Pu27), and 1 μM Hoechst (nuclear stain) were added to each well and incubated for 12, 24, and 48 hours.

[0134] The cell membrane and nucleus were stained with fluorescent dyes. After rinsing with phosphate buffer, a laser confocal microscope was used to analyze the uptake of berberine by cells, the subcellular distribution, and the co-localization of the three types of fluorescent molecules.

[0135] The wavelengths for exciting the fluorescence of berberine, Hoechst, and Cy5 are 488 nm, 405 nm, and 640 nm respectively.

[0136] Figure 4 Results of confocal microscopy of cells. A-D: Co-localization of Cy5 Q4, berberine, and Hoechst; E-H: Co-localization of Cy5 Q4-ds-A, berberine, and Hoechst; I-L: Co-localization of Cy5 Pu27, berberine, and Hoechst; M: Manders' co-localization analysis of the co-localization degree of different DNAs with berberine.

[0137] From Figure 4 It can be seen that the designed Q4-ds-A has a stronger binding force with berberine than Q4 and another DNA Pu27 (5’-TGGGGAGGGTGGGGAGGGTGGGGAAGG-3’), thus reflecting a greater co-localization degree with berberine at the cellular level.

[0138] Example 4: Extraction of Berberine by Magnetic Bead Method

[0139] The crude extract of Coptis chinensis was provided by Yifang Pharmaceutical Co., Ltd.

[0140] All the DNAs used in the magnetic bead experiment were provided by Suzhou Beixin Biotechnology Co., Ltd.

[0141] All the reagents used were provided by Sangon Biotech (Shanghai) Co., Ltd.

[0142] The shaker model used was (multi-purpose shaker QB210, kylin-Bell labinstrument).

[0143] The method described is the magnetic bead method and includes the following steps:

[0144] 1. Binding of magnetic beads to nucleic acids:

[0145] Using the covalent binding between the epoxy groups on the nanomagnetic beads (10 mg / mL aqueous solution) and the thiol groups on the customized DNA, through preliminary experiments, it can be obtained that for 1 μM (400 μL) DNA (DNA concentration is 1 μM, total volume is 400 μL), 10 μL of magnetic beads (from the stock solution) are required to reach the saturated binding state.

[0146] 2. Optimal conditions for DNA binding / dissociation with berberine:

[0147] Fluorescence experiments showed that in a buffer system of 50 mM KCl and shaking at room temperature for 2 hours, the binding of the DNA used with berberine EPI was the strongest.

[0148] While in a buffer system of 200 mM NaCl and shaking at room temperature for more than 10 hours, it was most easily dissociated.

[0149] 3. Extraction of EPI from pure berberine aqueous solution:

[0150] As confirmed by HPLC, 85% of berberine can be successfully extracted in a 1 mL reaction system (1 μM DNA, 0.5 μM berberine, adding 25 μL magnetic beads).

[0151] 4. Ability to extract berberine from crude extract of Coptis chinensis:

[0152] Add 100 μ μL magnetic beads and maintain a 10 μ M DNA solution (total volume is 1 mL) into a 3 mL round-bottom centrifuge tube, shake on a shaker at room temperature for 3 hours, fix with a magnetic stand and pipette out the supernatant, add phosphate saline with 6% BSA (bovine serum albumin) and shake on a shaker for half an hour, fix the magnetic beads with a magnetic stand and pipette out the supernatant.

[0153] Then add a buffer solution of 50 mM KCl (0.5 mM EDTA, 20 mM Tris, pH 7.5) and shake on a shaker at room temperature for half an hour, fix the magnetic beads with a magnetic stand and pipette out the supernatant, and add this buffer solution and the crude extract of Coptis chinensis again (maintaining a total volume of 1 mL, the density of the crude extract of Coptis chinensis is 0.05 mg / mL).

[0154] Shake on a shaker at room temperature for 2 hours, fix the magnetic beads with a magnetic stand and pipette out the supernatant, add a buffer solution of 200 mM NaCl (0.5 mM EDTA, 20 mM Tris, pH 7.5) and shake on a shaker for 10 hours, and finally use HPLC to detect the content of the extracted berberine.

[0155] The HPLC model used is Agilent 1260 equipped with a C18 separation column, using a mixed phase of phase A and phase B as the mobile phase, A: HPLC-grade water containing 0.1% TFA; B: HPLC-grade acetonitrile.

[0156] The analytical gradient used is: 0 - 2 min: 90% A + 10% B; 2 - 6 min: 80% A + 20% B; 6 - 10 min: 70% A + 30% B; 10 - 14 min: 60% A + 40% B; 14 - 18 min: 50% A + 50% B; 18 - 20 min: 5% A + 95% B; 20.1 min: 90% A + 10% B; 20.1 - 22 min: 90% A + 10% B.

[0157] Results: Approximately 58% of epiberberine was extracted from the aqueous solution (1 mL, 100 μL magnetic beads, 10 μM DNA) of the crude extract of Coptis chinensis (0.05 mg / mL) (the total amount of epiberberine was counted as 100%).

[0158] Among them, Figure 5 (A) shows a schematic diagram of the extraction principle by the magnetic bead method and the HPLC signal of epiberberine.

[0159] Using this method, 85% of epiberberine can be extracted from the pure epiberberine solution (the total amount of epiberberine was counted as 100%).

[0160] (B) Schematic diagrams of the crude extract of Coptis chinensis in solid and solution states, and the chemical structural formulas of five main alkaloid molecules therein (BER: Berberine; PAL: Palmatine; COP: Coptisine; EPI: Epiberberine; COL: Columbamine). (C) Comparison of HPLC signals before and after extracting alkaloid small molecules from the crude extract of Coptis chinensis using this magnetic bead method. (D) By modifying the DNA sequence, 58% of epiberberine was successfully extracted from the crude extract of Coptis chinensis using the conjugate of DNA Q4-ds-A and magnetic beads.

[0161] The above embodiments are exemplary and should not be construed as limitations on the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention. For those of ordinary skill in the technical field, without departing from the method of the present invention, several improvements and supplements can also be made, and these improvements and supplements should also be regarded as within the protection scope of the present invention.

Claims

1. A G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine, characterized in that, The G-quadruplex-based nucleic acid molecule is a DNA sequence shown in Formula I: 5’-(TTAGGG) n TTA-3’ Formula I wherein n is an integer independently selected from 4, 6, and 7; and when n is 4, the G-quadruplex-based nucleic acid molecule further comprises an additional nucleic acid to form a hairpin structure or a complementary double-stranded structure at the 5'-end; wherein the additional nucleic acid is selected from the following DNA sequences: 5'-CCTGGCTTCGGCCAGG-3', 5'-ACCTGGCTTCGGCCAGG-3', 5'-AACCTGGCTTCGGCCAGG-3'; or The G-quadruplex-based nucleic acid molecule is: 5'-(TTAGGG)4-L-(TTAGGG)4TTA-3' wherein L is T, TT, or TTA.

2. A G-quadruplex-based nucleic acid molecule that specifically binds to epiberberine, characterized in that, The G-quadruplex-based nucleic acid molecule is a DNA sequence shown in any one of SEQ ID NO:1, 2, 3, 4, 5, 6, and 7.

3. A kit, which comprises the G-quadruplex-based nucleic acid molecule according to claim 1 or 2.

4. Use of the G-quadruplex-based nucleic acid molecule according to claim 1 or 2 for detecting berberine or extracting berberine from Coptis chinensis.

5. A method for extracting epiberberine from Coptis chinensis, characterized in that, The method comprises the step of using the G-quadruplex-based nucleic acid molecule according to claim 1 or 2.

6. The method according to claim 5, wherein, The method is a magnetic bead method, a chromatography column method, or an ultrafiltration method.

7. The method according to claim 6, wherein, The magnetic bead method comprises the following steps: 1) Obtain a crude extract of Coptis chinensis; 2) Contact the G-quadruplex-based nucleic acid molecule according to claim 1 or 2 with magnetic beads, so that the G-quadruplex-based nucleic acid molecule is immobilized on the magnetic beads; 3) In an environment containing potassium ions, contact the magnetic beads obtained in step 2) with the crude extract of Coptis chinensis in step 1) and incubate; wherein the concentration of the potassium ions is 50-200 mM; 4) Transfer the magnetic beads in step 3) to an environment without potassium ions, take the supernatant, and obtain a purified berberine solution.

8. The method according to claim 6, wherein, The chromatography column method comprises the following steps: 1) Obtain a crude extract of Coptis chinensis; 2) Contact the G-quadruplex-based nucleic acid molecule according to claim 1 or 2 with a solid-phase affinity filler, so that the G-quadruplex-based nucleic acid molecule is covalently immobilized on the solid-phase affinity filler; 3) Pack the solid-phase affinity filler into an affinity chromatography column; 4) In an environment containing potassium ions, contact the affinity chromatography column obtained in step 3) with the crude extract of Coptis chinensis in step 1) and incubate; wherein the concentration of the potassium ions is 50-200 mM; 5) Use a solution without potassium ions as an eluent for elution to obtain a purified berberine solution.

9. According to the method of claim 6, wherein the ultrafiltration method comprises the following steps: 1) Obtain a crude extract of Coptis chinensis; 2) In an environment containing potassium ions, contact the G-quadruplex-based nucleic acid molecule according to claim 1 or 2 with the crude extract of Coptis chinensis in step 1) and incubate; wherein the concentration of the potassium ions is 50-200 mM; 3) Centrifugally ultrafilter using an ultrafiltration membrane with a molecular weight cut-off of not less than 2000 Da, and retain the undissolved substances; 4) Centrifuge and elute the unpermeated substance in step 3) with a potassium ion-free solution as the eluent to obtain a purified berberine solution.

10. The method according to any one of claims 7 to 9, wherein, The method further includes the steps of concentrating and crystallizing the obtained berberine solution to obtain berberine crystals.

11. The method according to any one of claims 7 to 9, wherein The crude extract of Coptis chinensis is an aqueous solution of the crude extract of Coptis chinensis, with a concentration of 0.01 - 100 mg / mL.

12. The method according to any one of claims 7 to 9, wherein, The potassium ion-containing environment is an inorganic salt solution containing potassium ions.

13. The method according to claim 12, wherein The inorganic salt is KCl.

14. The method according to claim 12, wherein, The concentration of the potassium ions is 50 - 100 mM.

15. The method according to claim 12, wherein, The concentration of the potassium ions is 50 mM.

16. The method according to claim 7, wherein, The potassium ion-free environment is a potassium ion-free solution.

17. The method according to any one of claims 8, 9 or 16, wherein The potassium ion-free solution is pure water, a sodium ion-containing environment or a hydrochloric acid solution.

18. The method according to claim 17, wherein, The sodium ion-containing environment is an inorganic salt solution containing sodium ions.

19. The method according to claim 18, wherein, The inorganic salt is NaCl.

20. The method according to claim 17, wherein The concentration of the sodium ions is 1 - 500 mM.

21. The method according to claim 17, wherein, The concentration of the sodium ions is 200 mM.

Images