A SNP site tightly linked to the major effect QTL of pumpkin stem length, a molecular marker, a primer pair and their application

Abstract

The invention discloses a SNP site, a molecular marker, a primer pair and an application thereof which are tightly linked to a major effect QTL of pumpkin stalk length, and belongs to the field of plant molecular genetic breeding. The SNP site is located at 2718950bp of pumpkin chromosome 11, and its polymorphism is G / C. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.4, and there is a G / C base mutation at the 24bp of the nucleotide sequence. The primer pair includes an upstream primer F1 whose nucleotide sequence is shown in SEQ ID NO.1, an upstream primer F2 whose nucleotide sequence is shown in SEQ ID NO.2, and a downstream primer R whose nucleotide sequence is shown in SEQ ID NO.3. The molecular marker provided by the invention can perform genotype identification on pumpkin, and accurately and efficiently screen out pumpkin varieties with short or long stalks through genotypes.

Description

Technical Field

[0001] The invention relates to the field of plant molecular genetic breeding, and in particular to a SNP site tightly linked to a major effect QTL of pumpkin stem length, a molecular marker, a primer pair and applications thereof. Background Art

[0002] Pumpkin (Cucurbita moschata Duch) is an important economic crop that can be used as both a vegetable and a grain and can be processed into high value-added products. The length from the top of the pumpkin fruit cavity to the stem can represent the length of the pumpkin's stalk, which is an important commodity trait of pumpkin. It not only directly affects the size and shape of the fruit, but also affects the commodity quality and yield of the fruit. The uniformity of pumpkins without stalks is better than that of pumpkins with stalks.

[0003] The changes in pumpkin stalk length and fruit shape are affected by multiple factors. It is a complex process regulated by multiple quantitative trait genetic loci, hormones and environmental factors. Many important genes and QTLs regulating fruit length have been reported in some horticultural crops. However, so far, genetic analysis and gene positioning studies on fruit length have been focused on model plants such as tomatoes and cucumbers, while the genes regulating pumpkin stalk length and fruit shape are still unclear, resulting in a lack of molecular markers that are closely linked to the pumpkin stalk length trait and have strong operability to assist pumpkin quality breeding. Therefore, in terms of pumpkin molecular marker-assisted selection of pumpkin breeding, it is still necessary to further determine the target genes regulating pumpkin stalk length and develop stable and high-throughput molecular markers. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP site, a molecular marker, a primer pair and an application thereof that are tightly linked to the main effect QTL of pumpkin stem length, so as to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention is highly tightly linked to the pumpkin stem length, and the SNP typing is obtained by using the KASP technology, so that the pumpkin stem length trait can be accurately and efficiently identified. At the same time, the molecular marker can be used for pumpkin molecular marker-assisted selection breeding, which can accelerate the breeding process of pumpkin excellent varieties.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The invention provides application of a SNP site in identifying varieties of pumpkin stalk lengths. The SNP site is located at 2718950 bp of pumpkin chromosome 11, and its polymorphism is G / C.

[0007] The present invention also provides a SNP molecular marker tightly linked to the main effect QTL of pumpkin stem length, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.4, and there is a G / C base mutation at the 24 bp of the nucleotide sequence.

[0008] The present invention also provides a KASP primer set for detecting the SNP molecular marker, wherein the KASP primer set comprises an upstream primer F1 having a nucleotide sequence as shown in SEQ ID NO.1, an upstream primer F2 having a nucleotide sequence as shown in SEQ ID NO.2, and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.3.

[0009] The present invention also provides a detection reagent or a detection kit for the SNP molecular marker, comprising the KASP primer set.

[0010] The present invention also provides the use of the KASP primer set or the detection reagent or the detection kit in identifying varieties of pumpkin stalk lengths.

[0011] The present invention also provides a method for identifying varieties of pumpkin stem lengths, comprising:

[0012] Using the genomic DNA of the pumpkin sample to be tested as a template, using the KASP primer set to perform PCR amplification on the template, and performing genotyping identification according to the amplification results;

[0013] If the identified genotype is CC, the pumpkin to be tested is a variety with a long handle. If the identified genotype is GG, the pumpkin to be tested is a variety with a short handle or no handle.

[0014] Furthermore, the reaction system of the PCR amplification is: DNA template 10-100 ng, 2×PARMS Master mix 5 μL, upstream primer F1 0.15 μL, upstream primer F2 0.15 μL, downstream primer R 0.4 μL, H2O supplemented to 10 μL;

[0015] The reaction program of the PCR amplification is: 94°C hot start activation for 15 min; 94°C denaturation for 20 s, 65-57°C gradient annealing / extension for 60 s, 0.8°C decrease per cycle, 10 cycles; 94°C denaturation for 20 s, 57°C annealing / extension for 60 s, 32 cycles.

[0016] The present invention also provides the use of the KASP primer set or the detection reagent or detection kit in any of the following:

[0017] Screen or predict the length of pumpkin stems;

[0018] Improve pumpkin germplasm;

[0019] Molecular marker-assisted breeding of pumpkin varieties with different stem lengths.

[0020] The present invention discloses the following technical effects:

[0021] The present invention uses 268 pumpkin materials collected in the laboratory as natural population materials, uses high-throughput sequencing technology, conducts genome-wide association analysis on pumpkin stalk length traits, develops SNP sites and molecular markers that are closely linked to pumpkin fruit stalk length, finds a SNP site that is closely linked to the pumpkin stalk length major effect QTL at 2718950bp on pumpkin chromosome 11, and develops a molecular marker based on the SNP site. The SNP site and molecular marker can be used to establish an auxiliary selection breeding system for stalkless or short-stalked pumpkin fruits, and accelerate the breeding process of excellent pumpkin germplasm.

[0022] The present invention discloses for the first time a molecular marker which is closely linked to the length of the pumpkin stalk. The molecular marker can be used to identify the genotype of the pumpkin, and the pumpkin varieties with short stalks or long stalks can be accurately and efficiently screened out through the genotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 This is a diagram of the length of the pumpkin stems in some GWAS pumpkin populations, where A is a cross-sectional diagram of the appearance of individuals with extreme differences between long and short pumpkin stems, and B is a data diagram of the length of the pumpkin stems in some GWAS pumpkin populations;

[0025] Figure 2 This is the whole-base genome association analysis diagram of pumpkin handle length trait, where A is the Manhattan diagram, and the genetic marker effect value, that is, the whole genome P value after the F test, is sorted by the physical position on the chromosome. The horizontal axis is the genome coordinate, and the vertical axis is -log 10 P, the smaller the P value, the stronger the correlation, which is shown by the larger vertical coordinate. B is the Quantile-Quantile diagram of the correlation analysis;

[0026] Figure 3 This is the KASP marker genotyping diagram of SNP sites in 44 natural populations with distant genetic backgrounds and extreme differences in melon stem length. Individuals with no stem or short stem are clustered close to the X-axis (homozygous GG genotype, blue dots), and individuals with extremely long stems are clustered close to the Y-axis (homozygous CC genotype, green dots). DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] Example 1 Obtaining SNP Molecular Markers Tightly Linked to the Major Effect QTL of Cucurbita Cucurbita Cucurbita Root Length

[0033] 1. GWAS germplasm resource information

[0034] 1.1 Materials and reagents

[0035] The natural population of Chinese pumpkin used in the present invention has 268 materials in total, 214 of which are from China and 54 are from abroad.

[0036] 1.2 Variation range of melon length in GWAS population

[0037] After harvesting, the ripe pumpkin fruit is cut along the cross section and the length from the top of the fruit cavity to the stem is measured to represent the length of the stem. The stem length ranges from 0cm to 30cm ( Figure 1 ).

[0038] 2. Genome-wide association analysis of pumpkin stem length

[0039] 2.1 Gene DNA extraction

[0040] The genomic DNA of 268 natural populations was extracted using the cetyltrimethylammoniumbromide (CTAB) method. The extraction quality and DNA concentration were detected by 2% agarose gel electrophoresis, and the concentration was diluted to 50-100 ng / μL for later use.

[0041] 2.2 Analysis of resequencing data

[0042] Based on the second-generation resequencing platform Illumina Hi-Seq, the GWAS population was built and resequenced. After DNA quality inspection, library construction, machine sequencing and filtering, a total of 1452.15Gb of clean reads data was obtained, with an average of 5.37GB per sample. The average sequencing depth of the genome reached: 16.58×, the maximum sequencing depth was: 30.6, and the minimum depth was: 9.28. Comparing with the Chinese pumpkin reference genome, the average coverage of all sample alignments was calculated to be: 96.38%, the minimum coverage was: 68.78%, and the maximum coverage was: 99.37%. After filtering, 1,157,313 high-quality SNP sites were obtained. And the average density of SNPs on chromosomes is 0.2Kb / SNP. The resequencing data shows that the depth and quality of the data can meet the needs of subsequent research.

[0043] 2.3 Genome-wide association analysis of pumpkin stem length

[0044] GEMMA analysis software was used to perform association analysis on related traits using a mixed linear model (MLM). Potential candidate SNPs were screened out based on the significance of the association (P-value). The P-value of the SNP associated with the length of the melon was obtained by running the analysis. The -log 10 (P) ≥ 10 is a closely associated SNP, and the length of the melon is significantly associated with a segment of chromosome 11. The -log 10 (P) = 11.73 ( Figure 2The SNP site is located at 2718950bp on chromosome 11 of the pumpkin genome (Cucurbita moschata (Rifu) Genome, http: / / cucurbitgenomics.org / organism / 9), and its polymorphism is G / C, with a short or no handle being G and a long handle being C.

[0045] Example 2 KASP technology is used for genotyping of pumpkin stem length

[0046] The present invention designs a specific primer pair for amplifying the SNP site in Example 1, including two allele forward primers with different terminal bases and a reverse primer, and the 5' ends of the two forward primers are respectively connected with different detection adapter sequences; the nucleotide sequence of the specific primer pair is shown in SEQ ID NO.1-3;

[0047] The forward primer sequence consists of three parts: universal adapter sequence, common amplification primer sequence and typing site sequence, as shown below:

[0048] Upstream primer F1: 5'-GAAGGTGACCAAGTTCATGCTCCGACAAGAACCAATATTAATTC G-3', SEQ ID NO. 1, wherein the bold italic part is the FAM tag sequence;

[0049] Upstream primer F2: 5′-GAAGGTCGGAGTCAACGGATTCCGACAAGAACCAATATTAATTC C-3′, SEQ ID NO. 2, the bold italic part is the HEX tag sequence;

[0050] Downstream primer R: 5′-TCGATCAATTTCATCAATGATTTTC-3′, SEQ ID NO.3.

[0051] The pumpkin genomic DNA to be tested is used as a template, and the above-mentioned specific primer set and KASP technology are used to perform genotyping on the length of the pumpkin stem.

[0052] The reaction system was: DNA (10-100 ng), 2×PARMS Master mix (5 μL), primer mix (0.7 μL) [F1 (0.15 μL), F2 (0.15 μL), R (0.4 μL)], H2O (N / A), Total reaction volume (10 μL).

[0053] Reaction program: 94°C hot start activation for 15 min; 94°C (20 sec), 65-57°C (60 sec), 0.8°C decrease per cycle, 10 cycles; 94°C (20 sec), 57°C (60 sec), 32 cycles.

[0054] After the reaction, the fluorescence signal was read by TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal and present it in the form of a chart. According to different colors, the genotype results were output. The chart is divided into X and Y axes. Each data point represents an independent DNA sample, and samples with the same genotype are clustered together. Those close to the X and Y axes are homozygous genotypes (blue dots FAM, green dots HEX), and those close to the diagonal position are heterozygous genotypes (red dots FAMHEX). The genotype of short-handled or no-handled materials is G, which is close to the X axis (blue dots FAM), and the genotype of long-handled materials is C, which is close to the Y axis (green dots HEX).

[0055] Among them, the PCR product fragment sequence is: CCGACAAGAACCAATATTAATTCNTGGAAATTAGACAAG GAAATAAGAAAATCATTGATGAAATTGATCGA (SEQ ID NO.4); wherein, the 24th base position of the sequence is a SNP site, and the polymorphism at this position is G / C.

[0056] 44 materials with extreme differences in stem length were selected from 268 natural populations. The lengths are shown in Table 1, including 24 long-stemmed materials and 20 short-stemmed or stemless materials. To verify the detection accuracy of the molecular markers screened by the present invention, the KASP marker was used to genotype this population. The genotyping results are shown in Tables 1 and Figure 3 As shown: individuals with short handles and no handles are clustered near the X-axis (homozygous GG, blue dots), and individuals with extremely long handles are clustered near the Y-axis (homozygous CC, green dots), proving that the SNP marker is closely linked to the trait.

[0057] Table 144 pumpkin stem length and SNP marker corresponding genotypes

[0058]

[0059]

[0060] In summary, the present invention uses 268 pumpkin materials collected in the laboratory as natural population materials, uses high-throughput sequencing technology, conducts genome-wide association analysis on pumpkin stalk length traits, and develops SNP sites and molecular markers that are closely linked to fruit length. The SNP sites and molecular markers can be used to establish an auxiliary selection breeding system for stalkless or short-stalked pumpkin fruits, and accelerate the breeding process of excellent pumpkin germplasm. It can be seen that the SNP sites, molecular markers, KASP primer sets for amplifying the molecular markers, and reagents or kits for detecting the molecular markers provided by the present invention can be used to predict pumpkin stalk length, improve pumpkin germplasm resources, and pumpkin breeding.

[0061] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of SNP loci in identifying varieties of pumpkin stem length, characterized in that: The SNP site is located at 2718950bp of pumpkin chromosome 11, and its polymorphism is G / C.

2. A SNP molecular marker tightly linked to the main effect QTL of pumpkin stem length, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.4, and there is a G / C base mutation at the 24 bp of the nucleotide sequence.

3. A KASP primer set for detecting the SNP molecular marker according to claim 2, characterized in that: The KASP primer set includes an upstream primer F1 having a nucleotide sequence as shown in SEQ ID NO.1, an upstream primer F2 having a nucleotide sequence as shown in SEQ ID NO.2, and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.

3.

4. A detection reagent or detection kit for SNP molecular markers according to claim 2, characterized in that: Comprising the KASP primer set according to claim 3.

5. Use of the KASP primer set according to claim 3 or the detection reagent or detection kit according to claim 4 in identifying varieties of pumpkin with different stem lengths.

6. A method for identifying the variety of pumpkin stem length, characterized in that: include: Using the genomic DNA of the pumpkin sample to be tested as a template, using the KASP primer set described in claim 3 to perform PCR amplification on the template, and performing genotyping identification according to the amplification result; If the identified genotype is CC, the pumpkin to be tested is a variety with a long handle. If the identified genotype is GG, the pumpkin to be tested is a variety with a short handle or no handle.

7. The method according to claim 6, characterized in that The reaction system of the PCR amplification is: DNA template 10-100 ng, 2×PARMS Master mix 5 μL, upstream primer F1 0.15 μL, upstream primer F2 0.15 μL, downstream primer R 0.4 μL, H2O supplemented to 10 μL; The reaction program of the PCR amplification is: 94°C hot start activation for 15 min; 94°C denaturation for 20 s, 65-57°C gradient annealing / extension for 60 s, 0.8°C decrease per cycle, 10 cycles; 94°C denaturation for 20 s, 57°C annealing / extension for 60 s, 32 cycles.

8. Use of the KASP primer set according to claim 3 or the detection reagent or detection kit according to claim 4 in screening or predicting varieties of pumpkin stem length.

9. Use of the KASP primer set according to claim 3 or the detection reagent or detection kit according to claim 4 in molecular marker-assisted breeding of pumpkin varieties with different stem lengths.

Images