Azoreductase, its mutant and application

Abstract

The present invention isolated a strain Roseibium sp.H3510 that can degrade azo dyes from the marine environment, and excavated a new type of azoreductase Azo2326-wt from it, which was confirmed to have a wide substrate catalytic spectrum and can catalyze the decolorization of various azo dyes. In addition, the present invention carried out mutation evolution of azoreductase Azo2326-wt based on a rational design method, and obtained multiple azoreductase mutants with greatly improved enzyme catalytic activity and thermal stability, which greatly improved the application potential of the enzyme and provided a new solution for the bioenzymatic treatment of azo dye wastewater.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial enzymes, and in particular relates to azoreductase, mutants thereof and applications thereof. Background Art

[0002] In 2018, China's annual dye production reached 812,800 tons, accounting for about 70% of the world's production, making it the world's largest dye producer and consumer. Azo dyes are one of many types of organic synthetic dyes. Azo dyes have stable molecular structures, are not easy to fade, have short production cycles, large outputs, low prices, and a full spectrum of colors. They are the most widely used type of synthetic dyes in the world, accounting for 60%-70% of the dyes produced each year.

[0003] Due to its special chemical structure, azo dye wastewater has a deep color (after entering the water body, it can be detected by the naked eye even if the concentration is lower than 0.005 mg / L), is difficult to degrade, and contains a variety of organic pollutants with biological toxicity or "three-hazard" properties. Therefore, it is called one of the most difficult industrial wastewaters to treat. On the one hand, the dyes in the wastewater prevent natural light from projecting into the water body, affecting the photosynthesis of plants, algae and photosynthetic microorganisms in the water, thereby reducing the concentration of dissolved oxygen in the water, causing a large number of aquatic organisms to die, and ultimately causing the collapse of the water ecosystem; on the other hand, some azo dyes are toxic in themselves, and some dyes can be decomposed into toxic aromatic amines under certain conditions. Dyes and their degradation products can accumulate through the food chain, seriously threatening human life, health and life safety. Therefore, the decolorization, detoxification and degradation research of azo dyes is the focus of many scholars at home and abroad, and has great research significance.

[0004] The treatment methods of azo dye wastewater can be divided into physical method, chemical method and biological method. The physical method mainly uses adsorbents to separate dyes from wastewater, which cannot fundamentally remove azo dyes, and has the disadvantages of high operating energy consumption and high operating costs; the chemical method often uses strong acids, alkalis or strong oxidants when used, the reaction conditions are severe, and toxic by-products are produced. The biological method treats azo dye wastewater mainly by cultivating or enriching microorganisms, and using the oxidoreductase produced by the bacteria to degrade the azo compounds in the wastewater, so as to achieve the purpose of decolorizing the wastewater and degrading pollutants. At present, many microbial strains that can degrade azo dyes have been isolated and cultured, including bacteria, fungi, algae, etc., and there are also studies on improving the decolorization and degradation ability of strains for azo dyes with the help of genetic engineering technology. However, the degradation of azo dyes that relies on live bacteria is affected by the composition, temperature, salinity and other conditions of the wastewater. Even the highly adaptable Bacillus has the problem of low decolorization and degradation efficiency due to the inability of live bacteria to adapt to the wastewater environment. On the other hand, some azo dyes cannot enter the bacterial cells at all, and the enzyme and substrate are affected by spatial isolation, resulting in the inability to carry out the catalytic reaction. Therefore, the industrial application of the live bacteria degradation system of azo dyes is greatly limited. Studies in recent years have shown that microbial degradation of azo dyes mainly relies on the catalytic action of the oxidoreductases produced by themselves, among which laccase and azoreductase are more studied. These degradation enzymes can open the azo bonds that maintain the dyes, causing the dyes to lose their chromophores and achieve decolorization and degradation of the dyes. Compared with the biological treatment of live bacteria, the enzyme method can overcome the conditional limitations of strain culture and is more convenient and efficient. Summary of the invention

[0005] In view of the deficiencies in the prior art, the object of the present invention is to provide an azoreductase, a mutant thereof and applications thereof.

[0006] In a first aspect of the present invention, an azoreductase is provided.

[0007] In another preferred embodiment, the azoreductase is derived from the azo dye-degrading bacteria Roseibium sp. H3510, which was deposited in the General Microbiology Center of China Culture Collection Administration (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101) on January 17, 2024, with the deposit number CGMCC No. 29645.

[0008] In another preferred embodiment, the amino acid sequence of the azoreductase has more than 95% homology with the amino acid sequence shown in SEQ ID NO.1, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology, and has the ability to degrade azo dyes.

[0009] In another preferred embodiment, the amino acid sequence of the azoreductase is shown as SEQ ID NO.1.

[0010] In the second aspect of the present invention, a biomaterial related to the azoreductase described in the first aspect of the present invention is provided, wherein the biomaterial comprises at least one of the following 1)-5):

[0011] 1) A gene encoding the azoreductase according to the first aspect of the present invention;

[0012] 2) an expression cassette containing the coding gene described in 1);

[0013] 3) a recombinant vector containing the coding gene described in 1);

[0014] 4) A recombinant microorganism containing the coding gene described in 1);

[0015] 5) A recombinant microorganism containing the recombinant vector described in 3).

[0016] Further preferably, in said 1), the nucleotide sequence of the coding gene is as shown in SEQ ID NO.2;

[0017] More preferably, in 3), the recombinant vector uses pET28a vector as an expression vector.

[0018] More preferably, in 4) or 5), the recombinant microorganism is recombinant Escherichia coli BL21 (DE3).

[0019] In the third aspect of the present invention, there is provided use of the azoreductase according to the first aspect of the present invention in degrading azo dyes.

[0020] More preferably, the azo dyes include allura red, sunset yellow, methyl red, indigo carmine, lemon yellow, and azo fluorescent pink.

[0021] Further preferably, the azo dyes include allura red, sunset yellow and methyl red.

[0022] In a fourth aspect of the present invention, a mutant of the azoreductase according to the first aspect of the present invention is provided, which has higher enzyme activity and higher thermal stability than the wild type.

[0023] In another preferred embodiment, the mutant of the azoreductase is a derivative protein having a new amino acid sequence formed by replacing one or more of the amino acids at position 48 valine (V), position 61 glycine (G), position 116 isoleucine (I) or position 126 serine (S) of the amino acid sequence shown in SEQ ID No. 1 with other amino acids.

[0024] In another preferred embodiment, the mutant of the azoreductase has one or more of the following mutations based on the amino acid sequence shown in SEQ ID No. 1: V at position 48 mutates to L, G at position 61 mutates to E, K or Q, I at position 116 mutates to V, and S at position 126 mutates to G.

[0025] In another preferred embodiment, the amino acid sequence of the azoreductase mutant has more than 95% homology with the amino acid sequence shown in SEQ ID NO.3-SEQ ID NO.9, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology.

[0026] In another preferred embodiment, the amino acid sequence of the azoreductase mutant is selected from one of the sequences shown in SEQ ID NO.3 to SEQ ID NO.9.

[0027] In another preferred embodiment, the amino acid sequences of the azoreductase mutants are shown as SEQ ID NO.3 to SEQ ID NO.9 respectively.

[0028] In the fifth aspect of the present invention, a biological material related to the mutant of the azoreductase according to the fourth aspect of the present invention is provided, wherein the biological material comprises at least one of the following 1)-5):

[0029] 1) A gene encoding the mutant of the azoreductase according to the fourth aspect of the present invention;

[0030] 2) an expression cassette containing the coding gene described in 1);

[0031] 3) a recombinant vector containing the coding gene described in 1);

[0032] 4) A recombinant microorganism containing the coding gene described in 1);

[0033] 5) A recombinant microorganism containing the recombinant vector described in 3).

[0034] Further preferably, in 1), the nucleotide sequence of the encoding gene is a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO.10-SEQ ID NO.16, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology.

[0035] Further preferably, in 1), the nucleotide sequence of the coding gene is selected from one of the sequences shown in SEQ ID NO.10-SEQ ID NO.16;

[0036] Further preferably, in 1), the nucleotide sequence of the encoding gene is shown as SEQ ID NO.10-SEQ ID NO.16.

[0037] More preferably, in 3), the recombinant vector uses pET28a vector as an expression vector.

[0038] More preferably, in 4) or 5), the recombinant microorganism is recombinant Escherichia coli BL21 (DE3).

[0039] In the sixth aspect of the present invention, there is provided use of the mutant of the azoreductase according to the fourth aspect of the present invention in degrading azo dyes.

[0040] More preferably, the azo dyes include allura red, sunset yellow, methyl red, indigo carmine, lemon yellow, and azo fluorescent pink.

[0041] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0042] Compared with the prior art, the present invention has the following advantages and progress:

[0043] The present invention isolates a strain of Roseibium sp.H3510 that can degrade azo dyes from the marine environment. By comprehensively analyzing genomics and transcriptomics data, a new type of azoreductase Azo2326-wt is excavated, its specific sequence structure is parsed, and recombinant expression is performed on it, confirming that it has a wide substrate catalytic spectrum and can catalyze a variety of azo dyes. In addition, the temperature of azo dye wastewater is generally high, and there is a high demand for the heat resistance of the enzyme. Therefore, the present invention carries out mutation evolution of azoreductase by a method based on rational design, and obtains azoreductase mutants with greatly improved enzyme catalytic activity and thermal stability. Therefore, the present invention provides a set of new solutions for the bioenzymatic treatment of azo dye wastewater, with significant novelty, innovation and practicality, and by obtaining multiple mutants with high thermal stability, the application potential of the enzyme is greatly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0045] Figure 1:cloning of azo2326-wt. Lane: 1. azo2326-wt PCR product; M: DL2000 DNA maker;

[0046] Figure 2 :Double restriction enzyme digestion detection of azo2326 / 28a plasmid. Lane: 1. azo2326 / 28a; M: DL15000;

[0047] Figure 3 :SDS-PAGE analysis of recombinant azoreductase Azo2326-wt. Lanes: M. Page Ruler Prestained Protein Ladder; 1. Purified Azo2326-wt; 2. Recombinant bacterial whole cell protein; 3. Blank control E. coli BL21 (DE3) / pET28a whole cell protein;

[0048] Figure 4 :The effect of temperature on the activity of Azo2326-wt;

[0049] Figure 5 :The effect of temperature on the stability of Azo2326-wt;

[0050] Figure 6 : Azo dye degradation profile of Azo2326-wt;

[0051] Figure 7 : Relative enzyme activity of single point mutants;

[0052] Figure 8 : Effect of temperature on the stability of iterated mutants. DETAILED DESCRIPTION

[0053] The present invention provides an azoreductase Azo2326-wt, a mutant thereof and an application thereof. The present invention is specifically described below in conjunction with the embodiments to facilitate further understanding of the present invention by those skilled in the art. However, the embodiments described below are only part of the embodiments of the present invention and should not be regarded as any form of limitation to the present invention. It should be pointed out that adjustments and improvements made by those of ordinary skill in the art based on the concept of the present invention should be regarded as the scope of protection of the present invention. The specific technical operation steps and operators are not indicated in the embodiments, and are all carried out in accordance with the general technical conditions described in the literature of the field or the relevant product instructions.

[0054] Example 1 Preparation of Azo2326-wt gene

[0055] A strain Roseibium sp.H3510 that can degrade azo dyes was isolated and screened from the marine environment. The strain was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101) on January 17, 2024, with the deposit number CGMCC No. 29645. Through comprehensive analysis of genomic and transcriptomic data, a new type of azoreductase Azo2326-wt was discovered in the above strain. Based on the genome sequence, the gene sequence of Azo2326-wt was obtained. According to the size of the Azo2326-wt gene sequence and primer T m The corresponding amplification program was designed (Table 1) and PCR amplification was performed using a 25 μL system.

[0056] Wild-type azoreductase Azo2326-wt amino acid sequence:

[0057] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDVASGLPFVDEAWIGANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQIARARETFRYSENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.1).

[0058] Wild-type Azo2326-wt gene DNA sequence:

[0059] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATGTTGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCGGTGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGATCGCACGCGCCCGTGAAACATTCCGCTACTCTGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.2).

[0060] Primer sequences for amplifying the wild-type azoreductase gene azo2326-wt:

[0061] F2326: AACTTTAAGAAGGAGATATACCATGGGCATGACGACCTCTR2326: TCTCAGTGGTGGTGGTGGTGGTG.

[0062] Table 1 PCR reaction process

[0063]

[0064] Table 2 PCR reaction system

[0065]

[0066] The genomic DNA of Roseibium sp. H3510 was extracted as a template, and PCR amplification was performed using primers F2326 and R2326. The amplified product was detected by 1% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, the detected band was about 618 bp, which was consistent with the theoretical size. The target band was recovered and purified by gel recovery to obtain the gene fragment of azoreductase Azo2326-wt.

[0067] Example 2 Construction and transformation of azoreductase Azo2326-wt expression vector

[0068] After Example 1, the expression vector pET28a was double-digested with restriction endonucleases NcoI and XhoI, and the double-digested products were recovered using a column gel recovery kit. According to the ligation system in Table 3, the target gene and the linearized vector were ligated.

[0069] Table 3 Target gene and vector connection system

[0070]

[0071] After the reaction system was incubated at 50°C for 15 min, the transformation was performed. The specific operation was as follows:

[0072] (1) Take 5 μL of the reaction sample from the previous step and add it to 50-100 μL of E. coli BL21 (DE3) competent cells (note that the volume of the DNA sample added should not exceed 1 / 10 of the competent volume), mix gently, and place the mixture on ice for 30 min.

[0073] (2) Heat shock the cells in a 42°C water bath for 90 seconds, then quickly return them to an ice bath and let them stand for 3 to 5 minutes.

[0074] (3) Add 500 μL of LB medium without antibiotics, mix gently, and culture at 37°C with shaking for 1 h.

[0075] (4) Centrifuge the bacterial solution at 5000 rpm for 1 min to precipitate the bacteria. Aspirate most of the culture solution, leaving about 50-100 μL of the culture solution, and resuspend the bacteria. Then evenly spread all of it on an LB plate containing Kana resistance and culture it in a 37°C incubator overnight.

[0076] (5) Pick the clones grown on the plate and extract the plasmid. Perform double enzyme digestion with NcoI and XhoI for verification. The double enzyme digestion system is shown in Table 4. The double enzyme digestion electrophoresis is shown in Figure 2.

[0077] Table 4 Double enzyme digestion reaction system

[0078]

[0079] The samples that were positive for double enzyme digestion were sent for sequencing verification. The sequencing results were consistent with the gene sequence in the genome, proving that the genetic engineering strain E. coli BL21 (DE3) / pET28a-azo2326-wt was successfully constructed.

[0080] Example 3 Heterologous inducible expression of azoreductase Azo2326-wt

[0081] The successfully constructed genetically engineered strain E. coli BL21 (DE3) / pET28a-azo2326-wt was inoculated into 5 mL of LB medium containing Kana and cultured overnight at 37 ° C, 220 rpm. As seed liquid, it was inoculated into 200 mL of LB medium containing Kana and cultured at 37 ° C, 220 rpm with shaking until OD 600 When the p-value reaches about 0.6, add 200 μL IPTG (0.5 M) and induce expression at 12°C for 20-24 h.

[0082] Take the induced culture and centrifuge it at 4500rpm for 20min, and discard the supernatant. Add 15mL of lysis buffer (pH 7.0) to the precipitate and oscillate it to fully suspend it. Place it on ice for ultrasonic disruption (power 260W, total disruption time 25min, working time 2s, interval time 4s). After ultrasonic disruption, centrifuge at 4℃ for 40min (8000rpm), and the resulting supernatant is the Azo2326-wt crude enzyme solution. Use nickel column His Trap TM HP-5mL was used for purification of the recombinant enzyme Azo2326-wt.

[0083] The enzyme solution was added with 5×SDS loading buffer, mixed, boiled for 10 min, and then centrifuged at 12000 rpm for 10 min. The supernatant was subjected to SDS-PAGE protein electrophoresis with 5% concentrating gel and 12% separating gel, stained with Coomassie Brilliant Blue R-250 for 2 h, and decolorized with decolorizing solution for 3 h, changing the decolorizing solution once in the middle, and observing the results.

[0084] The induced expression of the genetically engineered strain E. coli BL21 (DE3) / pET28a-azo2326-wt and the blank control E. coli BL21 (DE3) / pET28a was detected by SDS-PAGE. Figure 3 As shown in the figure, compared with the blank control group, after induction, the genetically engineered strain azo2326 / 28a / BL21(DE3) had an overexpressed protein band in the supernatant after ultrasonic disruption. The overexpressed protein size was about 21kD, which was consistent with the expected size, indicating that the azoreductase gene azo2326-wt was successfully overexpressed in E. coli and was soluble. The results of SDS-PAGE showed that the purified recombinant protein Azo2326-wt reached electrophoretic purity ( Figure 3 , lane 1).

[0085] Example 4 Catalytic activity and thermal stability of azoreductase Azo2326-wt

[0086] (1) Enzyme activity determination

[0087] In a 1.5mL centrifuge tube, add 100μL of allura red stock solution, 10μL of FMN stock solution, 20μL of enzyme solution, and 770μL of PB buffer. Finally, add 100μL of NADH stock solution to start the reaction. The total volume of the final system is 1mL, and the reaction is kept at 30℃. The change in the absorbance value (Abs) at a wavelength of 500nm within 2min is detected. The catalytic activity of the enzyme is reflected by the Δabs.

[0088] (2) Determination of the optimal temperature of the enzyme

[0089] In a 2mL EP tube, 298μL of PB buffer (concentration 50mM), 2μL (final concentration 2μM) of FMN solution, 30μL (final concentration 200μM) of allura red solution, 30μL of enzyme solution (concentration 0.029mg / mL), and finally 40μL (final concentration 1mM) of NADH solution were added in sequence. The mixture was placed in an electric thermostatic water bath at 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, 65℃, and 70℃ for 8min, and then boiled for 10min to terminate the reaction. The OD value at 500nm was measured using an ELISA instrument (Table 5). The relative enzyme activity was calculated according to the method in Example 4(1) to determine the optimal temperature for the enzymatic reaction. The substrate can be decolorized at 10-60℃, with 45℃ being the most suitable reaction temperature. When the temperature is higher than 60℃, the enzyme activity is almost lost (Table 5, Figure 4 ).

[0090] Table 5 Effect of azoreductase on dye decolorization at different temperatures

[0091]

[0092]

[0093] (3) Study on temperature stability

[0094] After the enzyme solution was kept in a constant temperature water bath at 45°C, 50°C, and 55°C for 0min, 10min, 20min, 30min, 40min, 50min, 60min, 2h, 3h, and 4h, 30μL of the enzyme was added to the reaction system in 1.7.2.1 above, and the reaction was carried out for 8min. The reaction was terminated by boiling for 10min. The change of OD value at 500nm was measured by using a microplate reader to determine the temperature tolerance of the enzymatic reaction. After being kept at 45°C for 6h, the remaining enzyme activity was still about 50%; after being kept at 50°C for 40min, the remaining enzyme activity was about 50%; after being kept at 55°C for 60min, the enzyme activity was lost ( Figure 5 ). Therefore, Azo2326-wt showed strong stability at 45℃.

[0095] (4) Azo dye degradation spectrum of Azo2326-wt

[0096] Nine azo dyes commonly used in industry were selected as substrates, the substrate breadth of the enzyme was determined and the optimal reaction substrate was determined. The substrate concentration was unified (2mM), the reaction was carried out at the optimal temperature for 8min, and the reaction was terminated by boiling for 10min. The OD value at the corresponding wavelength was measured using an enzyme reader to determine the degradation spectrum of the azo dyes.

[0097] Different azo dyes have certain differences in structure. Azoreductases show different enzymatic reaction specificities for different substrates. The results of the substrate specificity study of Azo2326-wt show that the enzyme has a significant degradation effect on allura red, sunset yellow, and methyl red; it also has a certain degradation effect on indigo carmine, lemon yellow, and azo fluorescent pink; but it cannot degrade new carmine and amaranth ( Figure 6 ).

[0098] Example 5 Rational design of mutation sites and construction of mutants

[0099] (1) The PoPMuSiC-2.1 web server predicts the thermodynamic stability change between a specific mutant and the wild-type enzyme. ΔΔG < 0 indicates that the mutant is more stable than the wild-type enzyme. The HotMuSiC web server predicts the thermodynamic stability change between a specific mutant and the wild-type enzyme based on the protein structure and the melting temperature T of the wild-type protein. m to predict the change in melting temperature ΔTm during point mutation (Pucci et al. 2016). m >0 indicates that the mutant is more stable than the wild-type enzyme. PoPMuSiC and HOTMuSiC were used to assist in the design of thermal stability control of mutant proteins, select mutation sites, and design upstream and downstream primers.

[0100] (2) The protein family of azoreductase rAzo2326 was analyzed using the Pfam online server (https: / / pfam-legacy.xfam.org / ). The 240 seed sequences and rAzo2326 sequences were aligned using MEGA 10.0 software and the Muscle alignment method. The alignment results were visualized on the WebLogo website (https: / / weblogo.threeplusone.com / ). The mutation sites were selected based on sequence consistency and upstream and downstream primers were designed.

[0101] (3) Screening and construction of iterative mutants

[0102] The single point mutants screened by rational design, the sites with improved thermal stability are shown in Table 5, and primers were designed for PCR amplification and mutation, and experimental verification was performed. The single point mutation method is as follows:

[0103] The recombinant plasmid pET28a-azo2326-wt was used as a template, and the upstream and downstream primers of different mutants (Table 8) were used for amplification using the PCR reaction system (Table 5) and the PCR reaction process (Table 6). The amplified products were detected by agarose gel electrophoresis.

[0104] Table 5 PCR reaction system

[0105]

[0106] Table 6 PCR reaction process

[0107]

[0108]

[0109] The obtained PCR product was digested with restriction enzyme Dpn I, the system was shown in Table 7, incubated at 37°C for 1 h, and the digested product was transformed into Escherichia coli BL21 (DE3) competent cells, and clones were picked for colony PCR verification and sequencing verification.

[0110] Table 7 Dpn I restriction enzyme system

[0111]

[0112] Table 8 Primer related information

[0113]

[0114]

[0115]

[0116]

[0117]

[0118] (4) Study on the decolorization activity of mutants on azo dyes

[0119] The enzyme activities of the mutant recombinase and the wild recombinase were compared to evaluate the effect of mutation on enzyme activity. The results showed that the enzyme activities of S126G, V48L, G61E, G61K, G61Q, and I116V were significantly higher than those of the wild type ( Figure 7 ); the enzyme activities of the remaining variants were lower than that of the wild type. The above 7 single-point mutations were iterated to verify the activities of the mutants after iteration.

[0120] The activities of the iteratively mutated recombinant enzymes were compared with those of the wild enzymes to evaluate the relative activities of the mutant enzymes. The results showed (Table 9) that the enzyme activities of the M2, M3, M4, M5, M6, M9, M14, M15, M16, M20, M22, M24, and M25 mutants were higher than those of the wild-type rAzo2326; while the enzyme activities of the M1, M7, M8, M10, M11, M12, M13, M17, M18, M19, M21, and M23 mutants were lower than those of the wild-type rAzo2326. Among them, the enzyme activity of M6 is higher than that of G61K and I116V; the enzyme activity of M9 is higher than that of G61Q and I116V; the enzyme activity of M14 is higher than that of S126G, G61Q and I116V; the enzyme activity of M15 is higher than that of S126G, G61K and I116V; the enzyme activity of M20 is much higher than that of V48L, G61Q and I116V, and the activity is 2.94 times that of the wild enzyme. Therefore, the mutant M20 of azoreductase with high catalytic activity is obtained by the present invention.

[0121] Azoreductase mutant M20 amino acid sequence:

[0122] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDLASGLPFVDEAWIQANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYSENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.3).

[0123] Azoreductase mutant M20 gene DNA sequence:

[0124] (SEQ ID NO.10).

[0125] Table 9 Comparison of azo dye decolorization ability of azo2326-wt and its mutants

[0126]

[0127]

[0128] (5) Characterization of temperature stability of mutants

[0129] Comparison of the effect of temperature on the enzyme of the iterative mutant and the wild type, the results are as follows Figure 8As shown in (a): After the enzymes were kept at 50°C for 40 min, the activities of the mutant enzymes M4, M3, M6, M9, M2, and M5 were all maintained above 70%, while the activity of the wild enzyme Azo2326-wt was reduced to about 50%; after keeping warm for 120 min, the activities of M4, M3, M2, and M5 were still maintained above 60%, the activities of M6 and M9 were below 50%, and the activity of the wild enzyme was about 30%; after keeping warm for 180 min, the activities of M4, M3, and M2 were still maintained above 60%, the activity of M5 was about 50%, and the enzyme activities of M6 and the wild enzyme were almost lost.

[0130] like Figure 8 As shown in (b): After the enzymes were kept at 50℃ for 180 minutes, the activities of M15, M16, and M22 were all maintained above 50%, while the activity of the wild enzyme was almost lost; after keeping at 50℃ for 480 minutes, the activities of M15, M16, and M22 were all maintained above 40%. Figure 8 As shown in (c): After the enzymes were kept at 50°C for 480 min, the activities of M14, M20, M24, and M25 were all maintained above 80%, while the wild enzyme had already basically lost its enzyme activity after 180 min of keeping warm.

[0131] Azoreductase mutant M14 amino acid sequence:

[0132] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDVASGLPFVDEAWIQANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYGENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.4).

[0133] Azoreductase mutant M14 gene DNA sequence:

[0134] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATGTTGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCCAGGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGGTGGCACGCGCCCGTGAAACATTCCGCTACGGCGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.11).

[0135] Amino acid sequence of azoreductase mutant M24:

[0136] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDLASGLPFVDEAWIKANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYGENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.5).

[0137] DNA sequence of azoreductase mutant M24 gene:

[0138] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATCTGGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCAAAGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGGTGGCACGCGCCCGTGAAACATTCCGCTACGGCGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.12).

[0139] Amino acid sequence of azoreductase mutant M25:

[0140] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDLASGLPFVDEAWIQANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYGENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.6).

[0141] DNA sequence of azoreductase mutant M25 gene:

[0142] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATCTGGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCCAGGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGGTGGCACGCGCCCGTGAAACATTCCGCTACGGCGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.13).

[0143] Amino acid sequence of azoreductase mutant M15:

[0144] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDVASGLPFVDEAWIKANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYGENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.7).

[0145] DNA sequence of azoreductase mutant M15 gene:

[0146] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATGTTGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCAAAGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGGTGGCACGCGCCCGTGAAACATTCCGCTACGGCGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.14).

[0147] Amino acid sequence of azoreductase mutant M16:

[0148] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDVASGLPFVDEAWIEANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYGENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.8).

[0149] DNA sequence of azoreductase mutant M16 gene:

[0150] ATGATGACGACCTCTGGTAAAACAATTTTGAAAGTCGATGCTTCCGCGCGGCGCGATGGGTCAATGACCCGCGATCTCTCTGCTGAATTGGTCGAGCGCCTGGTTGACGCGGCTGCGGGTTCCAATGTGATCAGCCGGGATGTTGCGTCAGGGCTGCCTTTCGTTGACGAAGCCTGGATCGAAGCGAATATGACTGATCCGTCTGAGCGTTCTGCTGAACAGAATGCCGTATTGGAGCTGTCTGATACGCTCATCAGCGAAGTCAAATCCGCTGACGTTCTCGTCATCTCCGTACCGATCTATAATTTCGGCATTCCTGCTTCGCTGAAGGCGTGGATCGACCAGGTGGCACGCGCCCGTGAAACATTCCGCTACGGCGAAAATGGGCCGGTCGGTTTGCTGGAGGGCAAGAAAGCCTATCTTGTTTTCGCTTCTGGCGGTGTTCCTGTCGGCTCTGACTACGATCTGGCGACCAGCTATATGCACCATGTGCTTGGCTTCATTGGCATCACAGATGTAACGGTTGTTGCTGCGGACCAGCTTATGATGGTGGATGTGGCAGAAAAGCGTGCCGCTCTGTCAAAAGAGATCAGCGAGCTGGTGAGCAAGGCAGCCTGA(SEQ ID NO.15).

[0151] Amino acid sequence of azoreductase mutant M22:

[0152] MMTTSGKTILKVDASARRDGSMTRDLSAELVERLVDAAAGSNVISRDLASGLPFVDEAWIKANMTDPSERSAEQNAVLELSDTLISEVKSADVLVISVPIYNFGIPASLKAWIDQVARARETFRYSENGPVGLLEGKKAYLVFASGGVPVGSDYDLATSYMHHVLGFIGITDVTVVAADQLMMVDVAEKRAALSKEISELVSKAA(SEQ ID NO.9).

[0153] DNA sequence of azoreductase mutant M22 gene:

[0154] (SEQ ID NO.16).

[0155] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. For those skilled in the art, any modification and change made to the above embodiment according to the technical essence of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A mutant of an azoreductase, characterized in that The amino acid sequence of the azoreductase mutant is selected from one of the sequences shown in SEQ ID NO.3 to SEQ ID NO.

9.

2. A biological material related to the mutant of the azoreductase according to claim 1, wherein the biological material comprises at least one of the following 1) to 5): 1) A gene encoding the mutant of the azoreductase according to claim 1; 2) an expression cassette containing the coding gene described in 1); 3) a recombinant vector containing the coding gene described in 1); 4) A recombinant microorganism containing the coding gene described in 1); 5) A recombinant microorganism containing the recombinant vector described in 3).

3. The biomaterial according to claim 2, characterized in that The nucleotide sequence encoding the gene in 1) is a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID NO.10 to SEQ ID NO.

16.

4. The biomaterial according to claim 2, characterized in that The nucleotide sequence encoding the gene in 1) is selected from one of the sequences shown in SEQ ID NO.10-SEQ ID NO.

16.

5. Use of the mutant of azoreductase according to claim 1 in degrading azo dyes, characterized in that: The azo dye is allura red.

Images