African swine fever virus fluorescent PCR amplification reaction reagent, kit and detection method resistant to interference from multiple disinfectants

Abstract

The present invention provides a fluorescent PCR amplification reaction reagent, a kit and a detection method for African swine fever virus that are resistant to interference from multiple disinfectants. DTT, BSA, Brij35 and betaine anti-interference components are added to the fluorescent PCR amplification reaction reagent. The detection limit of the fluorescent PCR detection kit reaches 1 copies / μL, and there is no positive cross reaction with swine fever virus, epidemic diarrhea virus, blue ear disease virus, circovirus, and pseudorabies virus. Therefore, the fluorescent PCR detection kit has the advantages of strong specificity, high sensitivity, good result interpretation accuracy, and especially can avoid false negative interpretation. In addition, the fluorescent PCR detection kit can be used to detect African swine fever virus in pig blood, saliva, tissue grinding fluid, environmental swabs, and vehicle swabs, and can effectively resist the interference of unknown disinfectants in farms.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and relates to an African swine fever virus fluorescent PCR amplification reaction reagent, a kit and a detection method that are resistant to interference from multiple disinfectants. Background Art

[0002] African swine fever virus (ASFV) is contagious and highly pathogenic. The clinical symptoms of acute cases are mainly high fever, short course of disease, high mortality rate, extensive bleeding in internal organs, and dysfunction of the respiratory and mental systems.

[0003] At present, the prevention and control of ASFV still relies on early virus detection, especially virus detection of environmental samples and various transport vehicles. In actual work, farms will disinfect feed trucks, pig trucks, material trucks and the entire breeding environment to eliminate most viruses. Generally, 5% 84 disinfectant, 2% glutaraldehyde or 1% Wei Ke are used for disinfection. Among them, 5% 84 disinfectant is diluted at 1:20, 2% glutaraldehyde is diluted at 1:50 times, and 1% Wei Ke is diluted at 1:100 times. However, in the actual operation of the farm, the dilution is not strictly carried out according to the above ratio. Therefore, the actual disinfectant concentration used will be slightly greater than the preparation concentration, which will cause some disinfectants to remain in the environment or on the surface of the disinfected objects.

[0004] When using African swine fever virus fluorescent PCR detection technology to detect ASFV virus nucleic acid, it was found that some disinfectants remaining in the environment or on the surface of disinfected objects would be mixed into the samples, eventually leading to abnormal test results, such as a significant error in the Ct value of positive samples; in severe cases, false negatives would occur, resulting in missed detections. This detection error greatly increases the risk of ASFV transmission, making it more difficult to prevent and control the spread of African swine fever virus, resulting in economic losses and the inability to accurately detect ASFV. Summary of the invention

[0005] The purpose of the present invention is to provide an African swine fever virus fluorescent PCR amplification reaction reagent, a kit and a detection method that are resistant to interference from multiple disinfectants, so as to solve the problem that residual disinfectants in samples affect ASFV detection.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect, the present application provides an African swine fever virus fluorescent PCR amplification reaction reagent that is resistant to interference from multiple disinfectants. The fluorescent PCR amplification reaction reagent includes a disinfectant-interference-resistant 5×PCR buffer containing anti-interference components, wherein the anti-interference components include: DTT (English name: dithiothreitol; Chinese name: dithiothreitol), BSA (English name: Bovine albumin; Chinese name: bovine serum albumin), Brij35 and betaine.

[0008] DTT is a strong reducing agent that can neutralize the oxidative components in the buffer and protect the stability and activity of the enzyme. BSA can maintain the stability and activity of taq DNA polymerase in the PCR system, improve the efficiency of PCR, reduce protein degradation, and reduce the loss of enzyme protein caused by nonspecific adsorption. Brij35 is a non-ionic detergent used to separate substances with small differences and can increase the amplification of template genes. Betaine is a zwitterionic surfactant that can eliminate the secondary structure of primers and templates, reduce the impact of interfering substances in the buffer system on nucleic acids, and increase the specificity of base pairing during annealing.

[0009] The present invention compares the anti-interference effects of different types of disinfectants through experiments, and shows that among the combinations containing all anti-interference components, the fluorescent PCR amplification reaction reagent has the strongest anti-interference ability. At this time, all weak positive samples containing disinfectants can be detected, which can significantly improve the sample detection efficiency.

[0010] Furthermore, the anti-disinfectant interference 5×PCR buffer includes: Tris-HCL 100mM, KCl400mM, MgCl2•6H2O 7.5mM, TritonX-100 0.05%, DTT 5mM, BSA 0.5%, Brij35 1%, and betaine 3M at pH 9.0.

[0011] Furthermore, the fluorescent PCR amplification reaction reagent also includes dNTP Mixture, upstream primer ASFVF, downstream primer ASFVR, probe ASFVP, MgCl2, and DEPC (English name: Diethyl pyrocarbonate; Chinese name: diethyl pyrocarbonate) treated water.

[0012] Specifically, according to the concentration and volume, the fluorescent PCR amplification reaction reagent includes dNTP Mixture with a concentration of 2.5mmol / L and a volume of 2μL, upstream primer ASFVF with a concentration of 10μmol / L and a volume of 2.5μL, downstream primer ASFVR with a concentration of 10μmol / L and a volume of 2.5μL, probe ASFVP with a concentration of 10μmol / L and a volume of 0.3μL, MgCl2 with a concentration of 25mmol / L and a volume of 2μL, and DEPC-treated water with a concentration of 0.1% and a volume of 5.7μL. After the above reagents are mixed under low-temperature sterile conditions, they are sterilized by filtering with a 0.45μm filter membrane, divided into small tubes, and labeled.

[0013] In this application, the p72 gene sequences of 24 genotype reference strains of African swine fever virus and the prevalent strains in China were referenced to screen the conservative regions and design primer probes. Among them, the sequences of the upstream primer, downstream primer and probe are:

[0014] Upstream primer ASFVF: TCAAAGTTCTGCAGCTCTTACATAC;

[0015] Downstream primer ASFVR: TCTTGCTCTRGATACGTTAATATGRC;

[0016] Probe ASFVP: 5′-FAM-CACTGGGTTGGTATTCCTCCCGT-BHQ1-3′.

[0017] Furthermore, the probe ASFVP also includes a nucleotide sequence with 1 to 3 bases added to the 5' end or the 3' end.

[0018] In the second aspect, the present application provides an African swine fever virus fluorescent PCR detection kit that is resistant to interference from multiple disinfectants. The kit includes the above-mentioned fluorescent PCR amplification reaction reagent, Taq DNA polymerase, a negative control, and a positive control.

[0019] In the present application, Taq DNA polymerase is a product purchased from Promega, with a volume of 100 μL / tube and a concentration of 5 U / μL. Taq DNA polymerase is sterilely quantitatively packaged, labeled, and set aside.

[0020] In this application, the negative control is sterile DEPC-treated water with a concentration of 0.1%. DEPC-treated water is sterilely packaged, labeled, and set aside.

[0021] In the present application, the preparation method of the positive control includes: cloning the African swine fever virus P72 gene by conventional methods to construct a pMD20-T-P72 vector plasmid; determining the gene sequence of the pMD20-T-P72 vector plasmid. After the sequencing result is determined to be correct, transforming Escherichia coli Top10 competent cells, expanding the culture, extracting the plasmid, and diluting to obtain a positive control.

[0022] In the third aspect, the present application provides a detection method for an African swine fever virus fluorescent PCR detection kit that is resistant to interference from multiple disinfectants, comprising: adding 20 μL of fluorescent PCR amplification reaction reagent and 0.5 μL of Taq DNA polymerase into a reaction tube, adding 5.0 μL of the sample nucleic acid to be tested after mixing, and setting up a positive control tube and a negative control tube at the same time; tightly capping the tube, centrifuging instantly, and placing it in a fluorescent PCR detector for detection.

[0023] The reaction conditions for fluorescence PCR detection were: 95°C / 3min; 95°C / 15s, 60°C / 30s for a total of 45 cycles, and fluorescence collection was performed during the 60°C extension of each cycle in the second stage.

[0024] The present invention has the following beneficial effects:

[0025] 1) After adding the anti-interference component, the fluorescent PCR amplification reaction reagent in this application has the advantages of strong specificity and high sensitivity, and can effectively reduce the interference of disinfectants in the sample.

[0026] 2) After adding the anti-interference component, the kit in this application can effectively resist the interference of various disinfectants in the sample, improve the accuracy of result interpretation and prevent the occurrence of false negatives.

[0027] 3) The test kit in this application has strong specificity and has no positive cross reaction with classical swine fever virus, epidemic diarrhea virus, blue ear disease virus, circovirus, and pseudorabies virus, and has obvious specificity.

[0028] 4) The kit in this application is 10 4 ~10 -1 Fluorescence PCR detection was performed on African swine fever virus plasmid DNA template with 10 copies / μL. The results showed that the detection limit reached 1 copies / μL, which has a high sensitivity.

[0029] 5) The fluorescent PCR amplification reaction reagent or kit in this application is used to detect African swine fever virus in pig blood, saliva, tissue abrasive fluid, environmental swabs, and vehicle swabs. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a fluorescence PCR test result diagram of the test kit for sensitivity testing;

[0031] Figure 2 This is the fluorescence PCR test result diagram of the sensitivity test of the control group kit;

[0032] Figure 3 A fluorescence PCR test result diagram of a specific test performed by the kit provided in the embodiment of the present application;

[0033] Figure 4 This is the fluorescence PCR test result diagram of the test group and control group kits for anti-interference detection of 84 disinfectants with a concentration of 10%; the red line is the control group and the blue line is the test group;

[0034] Figure 5 This is the fluorescence PCR test result diagram of the test group and control group kits for anti-interference detection of 5% glutaraldehyde; the red line is the control group, and the blue line is the test group;

[0035] Figure 6 The fluorescence PCR test results of the test kits for the test group and the control group for the anti-interference test of Wei Ke with a dilution ratio of 1:50; the red line is the control group, and the blue line is the test group;

[0036] Figure 7 This is a fluorescence PCR test result diagram of the test kit for the anti-interference test of African swine fever positive sample 1 treated with different disinfectants;

[0037] Figure 8 This is a fluorescence PCR test result diagram of the test kit for the anti-interference test of African swine fever positive sample 2 treated with different disinfectants;

[0038] Fig. 9 This is a fluorescence PCR test result diagram of the test kit for the anti-interference test of African swine fever positive sample 3 treated with different disinfectants;

[0039] Fig.10 This is the fluorescence PCR test result graph of the anti-interference test of the test group and control group kits on the farm samples; among them, the red line is the test result of the test group on the farm environment sample 1, the blue line is the test result of the control group on the farm environment sample 1, the purple line is the test result of the test group on the farm environment sample 2, and the green line is the test result of the control group on the farm environment sample 2. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further explained and illustrated by means of specific embodiments below.

[0041] Example 1

[0042] The embodiment of the present application provides an African swine fever virus fluorescent PCR amplification reaction reagent that is resistant to interference from multiple disinfectants. The fluorescent PCR amplification reaction reagent includes: 5 μL of 5×PCR buffer that is resistant to interference from disinfectants, 2.5 mmol / L dNTP Mixture, 10 μmol / L upstream primer ASFVF, 2.5 μL downstream primer ASFVR, 10 μmol / L probe ASFVP, 0.3 μL MgCl2, 25 mmol / L MgCl2, and 0.1% DEPC-treated water, 5.7 μL.

[0043] Among them, the anti-disinfectant interference 5×PCR buffer includes: Tris-HCL 100mM, pH 9.0, KCl 400mM, MgCl2•6H2O 7.5mM, TritonX-100 0.05%, DTT 5mM, BSA 0.5%, Brij35 1%, and betaine 3M.

[0044] The sequences of the upstream primer, downstream primer and probe are:

[0045] Upstream primer ASFVF: TCAAAGTTCTGCAGCTCTTACATAC;

[0046] Downstream primer ASFVR: TCTTGCTCTRGATACGTTAATATGRC;

[0047] Probe ASFVP: 5′-FAM-CACTGGGTTGGTATTCCTCCCGT-BHQ1-3′.

[0048] Example 2

[0049] The embodiment of the present application provides an African swine fever virus fluorescent PCR amplification reaction reagent that is resistant to interference from multiple disinfectants. The PCR amplification reaction reagent is the same as that in Example 1, except that the probe ASFVP also includes a nucleotide sequence with 1-3 bases added to the 5' end or the 3' end.

[0050] Example 3

[0051] An embodiment of the present application provides an African swine fever virus fluorescent PCR detection kit that is resistant to interference from multiple disinfectants. The kit includes: fluorescent PCR amplification reaction reagents, Taq DNA polymerase, negative controls, and positive controls.

[0052] Specifically, the fluorescent PCR amplification reaction reagents include: 5 μL of anti-disinfectant interference 5×PCR buffer, 2.5 mmol / L dNTP Mixture, 10 μmol / L upstream primer ASFVF, 10 μmol / L downstream primer ASFVR, 10 μmol / L probe ASFVP, 0.3 μL probe ASFVP, 25 mmol / L MgCl2, 0.1% DEPC treated water, 5.7 μL.

[0053] Among them, the anti-disinfectant interference 5×PCR buffer includes: Tris-HCL 100mM, pH 9.0, KCl 400mM, MgCl2•6H2O 7.5mM, TritonX-100 0.05%, DTT 5mM, BSA 0.5%, Brij35 1%, and betaine 3M.

[0054] The sequences of the upstream primer, downstream primer and probe are:

[0055] Upstream primer ASFVF: TCAAAGTTCTGCAGCTCTTACATAC;

[0056] Downstream primer ASFVR: TCTTGCTCTRGATACGTTAATATGRC;

[0057] Probe ASFVP: 5′-FAM-CACTGGGTTGGTATTCCTCCCGT-BHQ1-3′.

[0058] Taq DNA polymerase was purchased from Promega, with a volume of 100 μL / tube and a concentration of 5 U / μL. Taq DNA polymerase was sterilely packaged in quantitative quantities, labeled, and set aside.

[0059] The negative control is sterile DEPC-treated water with a concentration of 0.1%. The DEPC-treated water is sterilely packaged, labeled, and set aside.

[0060] The preparation method of the positive control includes: cloning the African swine fever virus P72 gene by conventional methods to construct a pMD20-T-P72 vector plasmid; determining the gene sequence of the pMD20-T-P72 vector plasmid. After the sequencing result is determined to be correct, transforming Escherichia coli Top10 competent cells, expanding the culture, extracting the plasmid, and diluting to obtain a positive control.

[0061] Example 4

[0062] The present application provides a detection method of a fluorescent PCR detection kit for African swine fever virus that is resistant to interference from multiple disinfectants, comprising: adding 20 μL of the fluorescent PCR amplification reaction reagent in Example 1 and 0.5 μL of Taq DNA polymerase to a reaction tube, adding 5.0 μL of the sample nucleic acid to be detected after mixing, and setting up a positive control tube and a negative control tube at the same time; capping the tube tightly, centrifuging instantly, and placing it in a fluorescent PCR detector for detection. Among them, the reaction conditions of the fluorescent PCR detection are: 95℃ / 3 min; 95℃ / 15 s, 60℃ / 30 s for a total of 45 cycles, and the fluorescence collection is performed during the 60℃ extension of each cycle in the second stage.

[0063] In order to verify the sensitivity, specificity and anti-interference of the fluorescent PCR detection kit provided in the examples of the present application, the examples of the present application respectively used the kit prepared in Example 3 as the test group and the kit without adding the anti-interference component as the control group for experiments, wherein the preparation of the kit in the control group was the same as that of the kit in the test group, except that the anti-interference component was not added. The specific test contents are as follows:

[0064] (1) Sensitivity test of fluorescent PCR detection kit

[0065] The DNA content was 10 4 The positive control plasmid pMD20-T-P72 with a dilution ratio of 10, 100, 1000, 10000, and 100000 times was used as the sensitivity quality control sample. Among them, corresponding to the dilution ratio of the positive control plasmid pMD20-T-P72, the copy number of the sensitivity quality control sample is 10 3 , 10 2 , 10 1 , 10 0 , 10 -1 The test kit was used to perform fluorescence PCR amplification on the sensitive quality control samples to obtain the attached Figure 1 The control group kit was used to perform fluorescence PCR amplification detection on the sensitive quality control samples to obtain the attached Figure 2 .

[0066] By the attached Figure 1 , Attachment Figure 2 It can be seen that the detection results of the two kits in the experimental group and the control group for the sensitive quality control samples diluted 1:10, 1:100, 1:1000, and 1:10000 were all positive, and the detection results of the sensitive quality control samples diluted 1:100000 were all negative. This shows that the detection limit of the two kits in the experimental group and the control group can reach 1:10000, that is, the detection limit of the kit in the experimental group reaches 1 copies / μL, which has a high sensitivity.

[0067] (2) Specificity test of fluorescent PCR detection kit

[0068] The test kit was used to perform fluorescence PCR amplification on the nucleic acid of classical swine fever virus, epidemic diarrhea virus, blue ear disease virus, circovirus, and pseudorabies virus to obtain the attached Figure 3 .

[0069] By the attached Figure 3 It can be seen that the test kit in the test group had no positive cross reaction to the nucleic acid of classical swine fever virus, epidemic diarrhea virus, blue ear disease virus, circovirus, and pseudorabies virus. In addition, 60 samples that were clinically diagnosed and identified as ASFV negative, including saliva and blood, were tested, and the results were all negative, with a specificity of 100%.

[0070] (3) Anti-interference test of fluorescent PCR detection kit on positive standard

[0071] The test group and control group test kits were used to detect ASFV positive control substances containing different types of disinfectants, respectively, to verify the anti-interference effect of the test kit provided in the embodiment of the present application on different disinfectants.

[0072] Specifically, take the African swine fever positive plasmid and dilute it to 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 10 0 copies / μL 4 different concentrations for standby use. Prepare 3 disinfectants with different dilution ratios respectively, and their concentrations are all greater than the conventional use concentrations. Among them, the disinfectants are 84 disinfectant with a concentration of 10%, glutaraldehyde with a concentration of 5%, and Virkon with a dilution ratio of 1:50. Mix the disinfectants with 4 different concentrations of African swine fever positive plasmids in a 1:1 ratio, mix them evenly, and leave them for 30 minutes before performing nucleic acid extraction operations. Among them, the mixing ratios of the disinfectant and 4 different concentrations of African swine fever positive plasmids are shown in Table 1. The treated nucleic acids in Table 1 were subjected to fluorescent PCR amplification detection using the test group and control group kits, respectively, to obtain the attached Figure 4-6 .

[0073] Table 1: Mixing ratio of disinfectant and 4 different concentrations of African swine fever positive plasmids

[0074]

[0075] By the attached Figure 4-6It can be seen that the fluorescence PCR amplification curve of the test kit shown by the blue line is a standard S-shaped curve, and the ct value determination is not affected, which shows that the test kit can resist the interference of 84 disinfectant with a concentration of 10%, glutaraldehyde solution with a concentration of 5%, and Weiko disinfectant with a dilution ratio of 1:50. In other words, when the concentration of 84 disinfectant used in the farm is less than 10%, the concentration of glutaraldehyde disinfectant solution is less than 5%, and the concentration of Weiko disinfectant is less than 2%, the residual disinfectant will not interfere with the PCR reaction.

[0076] (4) Anti-interference test of fluorescent PCR detection kit for positive samples

[0077] Take 3 samples of African swine fever positive with different virus contents, use 10% 84 disinfectant, 5% glutaraldehyde, 2% Virbac disinfectant, and DEPC treated water to mix with the samples of African swine fever positive with different virus contents in a volume ratio of 1:1, mix evenly and place for 30 minutes, then perform nucleic acid extraction. Use the test group kit to perform fluorescence PCR amplification detection on the nucleic acids after the above treatments, and obtain the attached Figure 7-9 .

[0078] By the attached Figure 7-9 It can be seen that the fluorescent PCR amplification curve of the test kit of the experimental group showed a standard S-shape, and the ct value determination was not affected, which indicated that the test kit of the experimental group could resist the interference of 10% concentration of 84 disinfectant, 5% concentration of glutaraldehyde solution, and 1:50 dilution ratio of Weiko disinfectant.

[0079] (5) Anti-interference test of fluorescent PCR detection kit on farm samples

[0080] Since only one disinfectant is used in the farm and the disinfectant is changed at a certain frequency, multiple disinfectant residues may exist in the farm environment at the same time. In the embodiment of the present application, the test group and the control group kits were used to perform fluorescence PCR amplification detection on two different weak positive environmental samples of the farm, and the attached Fig.10 .

[0081] By the attached Fig.10 It can be seen that the test kit of the test group shown by the red line and the control kit shown by the blue line have basically the same test results for farm environmental sample 1, and both can detect the residual disinfectant in the weakly positive environmental sample of the farm. The test kit of the test group shown by the purple line can detect the residual disinfectant in farm environmental sample No. 2, but the control kit shown by the green line cannot detect it. In summary, the test kit can effectively resist the interference of unknown disinfectants in the farm.

[0082] Through the above test detection, it can be known that the detection limit of the fluorescent PCR detection kit provided in the embodiment of the present application reaches 1 copies / μL, and there is no positive cross reaction with swine fever virus, epidemic diarrhea virus, blue ear disease virus, circovirus, and pseudorabies virus. Therefore, the fluorescent PCR detection kit has the advantages of strong specificity, high sensitivity, high accuracy of result interpretation, and prevention of false negatives. In addition, the fluorescent PCR detection kit can be used to detect African swine fever virus in pig blood, saliva, tissue grinding fluid, environmental swabs, and vehicle swabs, and can effectively resist the interference of unknown disinfectants in farms.

[0083] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A fluorescent PCR amplification reaction reagent for African swine fever virus that is resistant to interference from multiple disinfectants, characterized in that: The invention comprises a 5×PCR buffer for preventing the interference of disinfectants and containing an anti-interference component, wherein the anti-interference component comprises: 5 mM DTT, 0.5% BSA, 1% Brij35 and 3 M betaine; The fluorescent PCR amplification reaction reagents also include dNTP Mixture with a concentration of 2.5 mmol / L and a volume of 2 μL, upstream primer ASFVF with a concentration of 10 μmol / L and a volume of 2.5 μL, downstream primer ASFVR with a concentration of 10 μmol / L and a volume of 2.5 μL, probe ASFVP with a concentration of 10 μmol / L and a volume of 0.3 μL, MgCl2 with a concentration of 25 mmol / L and a volume of 2 μL, and DEPC-treated water with a concentration of 0.1% and a volume of 5.7 μL; The sequences of the upstream primer, the downstream primer and the probe are: Upstream primer ASFVF: TCAAAGTTCTGCAGCTCTTACATAC; Downstream primer ASFVR: TCTTGCTCTRGATACGTTAATATGRC; Probe ASFVP: 5′-FAM-CACTGGGTTGGTATTCCTCCCGT-BHQ1-3′.

2. The African swine fever virus fluorescent PCR amplification reaction reagent resistant to interference from multiple disinfectants according to claim 1, characterized in that: The anti-disinfectant interference 5×PCR buffer comprises: 100mM Tris-HCL at pH 9.0, 400mM KCl, 7.5mM MgCl2•6H2O, 0.05% TritonX-100, 5mM DTT, 0.5% BSA, 1% Brij35, and 3M betaine.

3. The African swine fever virus fluorescent PCR amplification reaction reagent resistant to interference from multiple disinfectants according to claim 1, characterized in that: The probe ASFVP further comprises a nucleotide sequence with 1 to 3 bases added to the 5' end or the 3' end.

4. A fluorescent PCR detection kit for African swine fever virus resistant to interference from multiple disinfectants, characterized in that: include: The fluorescent PCR amplification reaction reagent, Taq DNA polymerase, negative control, and positive control according to any one of claims 1 to 3.

5. The African swine fever virus fluorescent PCR detection kit resistant to interference from multiple disinfectants according to claim 4, characterized in that: The negative control was sterile DEPC treated water with a concentration of 0.1%.

6. The African swine fever virus fluorescent PCR detection kit resistant to interference from multiple disinfectants according to claim 4, characterized in that: The preparation method of the positive control includes: constructing a pMD20-T-P72 vector plasmid by cloning the African swine fever virus P72 gene; after determining that the gene sequence of the pMD20-T-P72 vector plasmid is correct, transforming Escherichia coli Top10 competent cells, expanding the culture, extracting the plasmid, and obtaining a positive control after dilution.

Images