A fruit color regulation gene mdmybs1 and application thereof
By identifying and regulating the expression of the MdMYBS1 gene in apple fruits, the accumulation of carotenoids was controlled, solving the problems of apple fruit color and quality, realizing targeted selection breeding for fruit color, and shortening the breeding cycle.
Patent Information
- Application Number
- CN202410328098.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-21
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2044-03-21
AI Technical Summary
Existing technologies are insufficient to effectively regulate the carotenoid content of apple fruits, which affects fruit color and quality. Furthermore, apple breeding is limited by complex genetic backgrounds and long breeding cycles.
The gene MdMYBS1, which is related to carotenoid content in apple fruit, was identified by RNA-seq analysis. Overexpression and interference vectors were constructed, and transgenic technology was used to overexpress or inhibit the MdMYBS1 gene in apples and tomatoes to regulate the accumulation of carotenoids.
It significantly increased the carotenoid content in apple and tomato fruits, achieved color regulation of fruit color, solved the problem of fruit color regulation that is difficult to solve with existing technologies, shortened the breeding cycle and improved breeding efficiency.
Smart Images

Figure SMS_1 
Figure SMS_3 
Figure SMS_4
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, more particularly, it relates to a fruit color regulation gene MdMYBS1 and application thereof. BACKGROUND
[0002] Apple (Malus domestica Borkh.) is rich in nutrients and has high economic value, and is one of the important economic crops in the world. Strengthening the breeding and demonstration of new apple varieties, using transgenic and molecular biology methods to genetically improve the quality traits of apples, meeting the various needs of different regions, different markets and different groups of people for apples, and strengthening the globalization development of the apple industry are the inevitable trend of the future development of apple breeding. The complexity of the genetic background, the long childhood and the self-incompatibility of apples seriously restrict the genetic breeding and the breeding of new varieties of apples. Therefore, through the means of biotechnology, the related genes of each trait of apples are transferred into the apple genome, which is beneficial to directional selection breeding and shortening the breeding period.
[0003] Carotenoids are the main pigments of yellow, orange, red and other colors in horticultural fruits and vegetables, and have important influences on fresh product quality, juice processing quality and market consumption. In plants, carotenoids play a crucial role in plant growth and development, light protection and biological interactions, and are the precursors of abscisic acid (ABA), strigolactones and bioactive apo-carotenoids. In addition, carotenoids have high antioxidant activity and are beneficial antioxidants for health. With the improvement of people's quality of life, the demand for cultivating new varieties of plants rich in carotenoids through plant genetic engineering is becoming more and more urgent. Therefore, revealing the regulation mechanism of carotenoid-mediated fruit color in apple fruit has important significance for improving and improving fruit quality. SUMMARY
[0004] In view of the deficiencies in the prior art, the purpose of the present application is to provide a fruit color regulation gene MdMYBS1, which is closely related to the carotenoid content of apple fruit and can regulate carotenoid-mediated fruit color.
[0005] To achieve the above-mentioned purpose, the present application provides the following technical scheme: a fruit color regulation gene MdMYBS1, the nucleotide sequence of the MdMYBS1 gene is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0006] Further, the forward primer for cloning the gene MdMYBS1 is: ATGACTCGGAGGTGCTCGCAT; and the reverse primer is: CTAAACTGCATGGATAGGGCT.
[0007] Further, the method for obtaining the gene MdMYBS1 is: obtaining by correlation analysis of apple fruit carotene content and differential gene expression level through the RNA-seq method.
[0008] The application also provides application of the fruit color regulation gene MdMYBS1 in obtaining high carotene content apples, and the application is obtained by cloning the gene MdMYBS1, constructing an overexpression vector and an interference vector of MdMYBS1, and performing genetic transformation on apple fruit, callus or tissue culture seedlings.
[0009] The application also provides application of the fruit color regulation gene MdMYBS1 in obtaining high carotene content tomatoes, and the application is obtained by transforming tomatoes through the overexpression vector and transforming tomatoes through heterologous overexpression.
[0010] Further, the specific steps for constructing the gene MdMYBS1 overexpression vector are as follows:
[0011] (1) obtaining of the target fragment, specific primers are designed according to the sequence of the gene, and enzyme cutting sites are added at both ends of the primers, so that the PCR amplification reaction is carried out on the cloning vector as a template, and the MdMYBS1 coding region amplification product with the enzyme cutting site, i.e. the target fragment, is obtained;
[0012] (2) recovery of the target fragment, the PCR product fragment of the MdMYBS1 gene with the enzyme cutting site in the step (1) and the plant expression vector pRI101-flag are respectively cut, and the enzyme cutting products are respectively recovered, and then the recovered MdMYBS1 gene PCR product enzyme cutting fragment and the plant expression vector pRI101-flag enzyme cutting fragment are connected;
[0013] (3) connecting the target fragment in the step (1) to the overexpression vector pRI101-flag;
[0014] (4) transforming the connection product in the step (3) into the E. coli competent cell DH5a, and identifying the positive recombinants through colony PCR;
[0015] (5) transforming the expression vector constructed in the step (4) into the Agrobacterium competent cell EHA105, and obtaining the engineering bacteria EHA105 / pRI101-flag-MdMYBS1.
[0016] Further, the cloning vector in the step (1) is pEASY-blunt, and the enzyme cutting sites are Sal I and Kpn I.
[0017] Further, the gene MdMYBS1 promotes accumulation of carotenes by positively regulating the promoter activity of carotene synthesis genes MdPSY2-1 and MdLYCb, and produces the orange and yellow fruit trait.
[0018] In summary, the present application has the following beneficial effects:
[0019] The gene MdMYBS1 closely related to the content of carotenoids in apple fruits is obtained by RNA-seq sequencing analysis, the complete coding segment of the gene is cloned, the overexpression vector and interference vector are constructed, and by using the transgenic technology, it is found that the gene MdMYBS1 positively regulates the accumulation of carotenoids, is closely related to the yellow color mediated by carotenoids, and the expression of MdMYBS1 is inhibited, so that the content of carotenoids can be reduced, which reveals the regulation mode of the gene in the color of fruits mediated by carotenoids, and is beneficial to the directional selection breeding of the color regulation of fruits mediated by carotenoids; the present application firstly changes the content of carotenoids in apple fruits by plant genetic engineering technology, obtains a DNA fragment of the complete coding segment of the fruit yellow color related gene separated and cloned from apple fruits, and finally finds that the content of carotenoids is significantly increased after the overexpression of MdMYBS1 gene in apple callus, 'GL-3' apple seedlings and fruits, and MdMYBS1 positively regulates the accumulation of carotenoids by enhancing the expression of MdPSY2-1 and MdLCYb genes. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 It is a comparison chart of RNA-seq analysis of 'Red General' and 'Yanfu 3' fruits;
[0021] Figure 2 It is a correlation analysis chart of the relative expression amount of MdMYBS1 gene and the content of carotenoids;
[0022] Figure 3 It is a core domain analysis chart of MdMYBS1 amino acid sequence;
[0023] Figure 4 It is a comparison chart of transiently transformed apple 'Granny Smith';
[0024] Figure 5 It is a comparison chart of MdMYBS1 transformed apple callus;
[0025] Figure 6 It is a comparison chart of MdMYBS1 transformed GL-3 apple seedlings;
[0026] Figure 7 It is a column chart of the expression amount of MdMYBS1 gene in transiently transformed apple 'Granny Smith';
[0027] Figure 8 It is a column chart of the expression amount of MdMYBS1 gene in transgenic callus;
[0028] Figure 9 Figure 6 is a bar graph showing the expression level of MdMYBS1 gene in transgenic apple shoots;
[0029] Figure 10 Figure 7 is a bar graph showing the total carotenoid content in transiently transformed apple ‘Granny Smith’;
[0030] Figure 11 Figure 8 is a bar graph showing the total carotenoid content in transgenic callus;
[0031] Figure 12 Figure 9 is a bar graph showing the total carotenoid content in transgenic apple shoots;
[0032] Figure 13 Figure 10 is a comparison chart of transgenic tomato of MdMYBS1 heterologous transformation tomato;
[0033] Figure 14 Figure 11 is a bar graph showing the expression level of MdMYBS1 gene in transgenic tomato fruits;
[0034] Figure 15 Figure 12 is a bar graph showing the total carotenoid content in transgenic tomato fruits;
[0035] Figure 16 Figure 13 is a bar graph showing the expression level of MdPSY2-1 and MdLYCb genes in transiently transformed apple fruits ‘Granny Smith’;
[0036]
[0037] Figure 17 Figure 14 is a bar graph showing the expression level of MdPSY2-1 and MdLYCb genes in transgenic callus;
[0038] Figure 18 Figure 15 is a bar graph showing the expression level of MdPSY2-1 and MdLYCb genes in transgenic apple shoots;
[0039] Figure 19 Figure 16 is a chart showing the in vitro verification of MdMYBS1 interacting with the promoters of MdPSY2-1 and MdLYCb by Y1H;
[0040] Figure 20 Figure 17 is a chart showing the in vitro verification of MdMYBS1 binding to the promoters of MdPSY2-1 and MdLYCb by EMSA;
[0041] Figure 21 Figure 18 is a chart showing the in vivo verification of MdMYBS1 interacting with the promoter fragments of MdPSY2-1 and MdLYCb by ChIP-PCR;
[0042] Figure 22 Figure for in vivo verification of MdMYBS1 enhanced promoter activity of MdPSY2-1 and MdLYCb by LUC luciferase system;
[0043] Figure 23 Figure for functional mode of MdMYBS1 gene. DETAILED DESCRIPTION
[0044] The application will be further described below in conjunction with the examples.
[0045] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified. In the following examples, the quantitative tests are set up with three repeated experiments, and the results are averaged.
[0046] Example 1, identification of key genes related to total carotenoid content in apple by RNA-seq analysis
[0047] The fruits of apple ‘Red Chief’ and ‘Yanfu 3’ were sampled at 60 days, 30 days and 0 days before fruit ripening (DBFR), and the total carotenoid content of each fruit was determined:
[0048] 1. Extraction and determination of total carotenoid content in fruit, the steps are as follows:
[0049] (1) Prepare carotenoid extraction solution: acetone-n-hexane (1:1, by volume);
[0050] (2) Grind the apple pulp stored at -78℃ in a mortar pre-cooled with liquid nitrogen into powder, weigh 1 g of the ground apple pulp into a pre-cooled 10 mL centrifuge tube, set up three replicates for each sample, add acetone-n-hexane (1:1) extraction solution, and shake well;
[0051] (3) Place in a constant temperature shaker under dark conditions at 120 r / min for 1 h, ultrasonic extraction for 20 min, centrifuge at 12000 r / min for 10 min in a centrifuge, and collect the supernatant.
[0052] (4) Continue to add acetone-n-hexane (1:1) extraction solution to the remaining residue, repeat the above steps until the precipitate turns white, and combine the supernatants;
[0053] (5) Place the extraction solution in a rotary evaporator to evaporate and concentrate, obtain the extract, and dilute with acetone to 2 mL for determination;
[0054] (6) Determine the absorbance value at wavelength λ = 440 nm using a UV-2550 UV-visible spectrophotometer;
[0055] (7) Calculate the carotenoid content according to the following formula:
[0056] Carotenoid content (mg / g fresh weight) = A440 ÷ (ε × d) × V × 1000 ÷ W × F = 0.04 × A440 × F ÷ W.
[0057] Wherein: A440: absorbance at 440 nm; V: total volume of sample extract, 0.01 L; 1000: unit conversion factor 1 g = 1000 mg; ε: empirical extinction coefficient of carotenoids, 250 L / g / cm; d: cuvette optical path, 1 cm; F: dilution factor; W: sample mass, g.
[0058] The detection results show that the total carotenoid content in the fruits of ‘Red General’ 30 and 0 DBFR is significantly higher than that of ‘Yanfu 3’.
[0059] 2. Apple fruit RNA-seq sequencing
[0060] The fruits of apple ‘Red General’ and ‘Yanfu 3’ were sampled at 60 days, 30 days and 0 days (DBFR) before maturity, and the RNA sequencing work was completed by Beijing Baimaikesi Biological Technology Co., Ltd. on the Illumina Hiseq sequencer platform. Each sampling point sample was set with 3 biological replicates. The data was pretreated, and the data containing adapters and containing Ploy-N were removed, and the low-quality data was filtered out to obtain clean reads, and then the transcripts were assembled by referring to the apple genome Malus x domestica GDDH13v1.1 database (https: / / www.rosaceae.org / species / malus / malus_x_domestica). After assembly, GO (Gene Ontology) enrichment analysis was performed using GOseq R package software, and KEGG (Kyoto Encyclopedia of Genes and Genomes) signal pathway enrichment analysis was performed using KOBAS software. Gene expression abundance was measured by FPKM value (Fragments per kilobase of transcript per million fragments mapped).
[0061] II. Identification of key gene MdMYBS1 related to total carotenoid content in fruits by RNA-seq analysis
[0062] The RNA-seq data were analyzed, and the screening criteria for differentially expressed genes (DEGs) were set as follows: error rate (FDR) < 0.05 and expression variation ratio > 2.0. At the three time points of apple fruit development mentioned above, such as... Figure 1 As shown, a total of 2569 DEGs were identified, of which 446 DEGs were upregulated and 441 DEGs were downregulated. One MYB-related transcription factor, MdMYBS1, was identified from the 446 upregulated DEGs. Further RT-qPCR analysis showed that, compared with other MYB transcription factors, [the following was observed]: Figure 2 As shown, the transcriptional level of MdMYBS1 is more strongly correlated with the total carotenoid content, showing a significant positive correlation. Combined with genomic gene function annotation, this indicates that the gene MdMYBS1 is a key regulator of carotenoid biosynthesis in apple fruit.
[0063] Example 2: Cloning and Sequencing of Apple Gene MdMYBS1
[0064] I. Cloning methods for the MdMYBS1 gene
[0065] 1. Total RNA extraction from apple fruit
[0066] (1) Add 2% β-mercaptoethanol to 2×CTAB extract and preheat at 65℃;
[0067] (2) Quickly add the preheated CTAB extract to the 'Red General' apple pulp sample that has been ground into powder, vortex and mix for 1-2 min, then bathe in a 65℃ water bath for 20-30 min, shaking 2-3 times during the process.
[0068] (3) Add an equal volume of CI (chloroform:isoamyl alcohol = 24:1), shake well for 3-5 minutes;
[0069] (4) Centrifuge at 12000rpm for 15-20min at 4℃, take the supernatant, add an equal volume of CI, and shake well for 3-5min;
[0070] (5) Centrifuge at 12000rpm for 15-20min at 4℃, take the supernatant, add 1 / 3 volume of 10M LiCl and mix well, precipitate at 4℃ for 10-16h.
[0071] (6) Centrifuge at 12000 rpm for 20-30 min at 4℃, discard the supernatant, and wash the precipitate thoroughly with 75% ethanol; then centrifuge at 12000 rpm for 3-5 min at 4℃, discard the supernatant, and wash the precipitate again with 75% ethanol once.
[0072] (6) Remove supernatant, centrifuge briefly, and aspirate the liquid with a pipette. Blow dry in a fume hood for 5-10 min to evaporate the ethanol completely. Dissolve the RNA pellet with 42 uL DEPC water, and store at -70°C.
[0073] 2. Purification of RNA
[0074] (1) Add the solutions shown in Table 1 to a centrifuge tube:
[0075] Table 1
[0076]
[0077] (2) Digest at 37°C for 0.5-1 h;
[0078] (3) Add 550 uL DEPC water, mix gently, and then add 600 uL CI, and shake well for 3-5 min;
[0079] (4) Centrifuge at 12,000 rpm for 15-20 min at 4°C, remove the supernatant, and add 2 volumes of anhydrous ethanol. Precipitate at -70°C for 30 min-1 h;
[0080] (5) Centrifuge at 12,000 rpm for 20-30 min at 4°C, discard the supernatant, and wash the precipitate with 75% ethanol, repeating once;
[0081] (6) Remove supernatant, centrifuge briefly, and aspirate the liquid with a pipette. Blow dry in a fume hood for 5-10 min to evaporate the ethanol completely. Dissolve the RNA pellet with 42 uL DEPC water, and store at -70°C.
[0082] Store at -70°C in an ultra-low temperature freezer for later use.
[0083] 3. Synthesis of cDNA first strand
[0084] (1) Add the reagents shown in Table 2 below to a 0.2 mL centrifuge tube:
[0085] Table 2
[0086]
[0087]
[0088] (2) Incubate at 70°C for 10 min, and then place on ice for 2 min;
[0089] (3) Add the reagents shown in Table 3 below to the centrifuge tube in order:
[0090] Table 3
[0091]
[0092] cDNA synthesis was terminated by placing the tubes on ice after 1 h at 42°C and 5 min at 85°C.
[0093] 4. Verification of cDNA
[0094] The integrity of the cDNA was verified by PCR amplification of the housekeeping gene EF-1a.
[0095] EF-1a quantitative primer F: ATTCAAGTATGCCTGGGTGC;
[0096] EF-1a quantitative primer R: CAGTCAGCCTGTGATGTTCC.
[0097] (1) The PCR mixture system is as follows in Table 4:
[0098] Table 4
[0099]
[0100] (2) After mixing, the following reactions in Table 5 were performed in a PCR instrument:
[0101] Table 5
[0102]
[0103] (3) The PCR amplification products were detected by 1.5% agarose gel electrophoresis.
[0104] 5. Real-time fluorescent quantitative PCR (qPCR) for quantitative detection of gene expression
[0105] The fluorescent quantitative primers were designed using Primer 5.0. The reaction system is as follows in Table 6: The primers in the table are the quantitative detection primers of MdMYBS1.
[0106] MdMYBS1 quantitative primer F: ATCGCTCAGCCTTTCCCTTC;
[0107] MdMYBS1 quantitative primer R: TCTCGCTGTTCTGGTTGCTC.
[0108] Table 6
[0109]
[0110] EF-1a was used as a control gene, and the instrument was ABI 7500 quantitative PCR instrument (ABI 7500 Real-Time PCR System, ABI, USA). The quantitative primers are shown in the above table, and each sample was repeated three times.
[0111] 6. Cloning of genes
[0112] PCR reaction system as follows Table 7: the primer in the table below is the primer of cloning MdMYBS1 coding region (ORF) full length.
[0113] MdMYBS1 cloning primer F: CCGATGGCTATGCCTCTGA;
[0114] MdMYBS1 cloning primer R: ATTGCGAGCTATTCCACGCC.
[0115] Table 7
[0116]
[0117] PCR reaction system in PCR amplification instrument (Bio-Rad) starts PCR reaction. After the reaction, 1.0%-2.0% agarose gel electrophoresis is used to detect whether the amplified band is the target band. Then the correct band is cut and recovered.
[0118] 7, recovery and purification of PCR amplification product
[0119] PCR product is purified by gel recovery and purification kit (Beijing zhiyi gold biological limited company), and the specific operation steps are as follows:
[0120] (1) the cut gel block containing the target band is dissolved with 3 times the volume of gel dissolution buffer;
[0121] (2) the dissolved and cooled gel solution is transferred to the centrifugal adsorption column, and the waste liquid is centrifuged;
[0122] (4) add 650-700 μL WB rinse solution, centrifuge and discard the waste liquid, repeat once;
[0123] (5) empty column centrifugation 1-2 min, remove the rinse solution;
[0124] (7) add appropriate amount (30-50 μL) of elution buffer EB on the centrifugal adsorption column;
[0125] (8) centrifuge the adsorption column and obtain the PCR purification product.
[0126] 8, target gene ligation reaction
[0127] The target gene is connected to the cloning vector pEASY-blunt, and the reaction system is as follows Table 8:
[0128] Table 8
[0129]
[0130] After mixing, connect at 25°C for 10-30 min. The specific connection time is operated according to the instruction manual of Qiagen. The connection product is transformed into E. coli DH5α competent cells, and coated on the corresponding resistance screening medium, and incubated in a 37°C constant temperature incubator for 12-16 h. The single colony with positive PCR identification is selected for sequencing. Various sequence analysis is completed by Shanghai Shenguo Biotechnology Service Co., Ltd. The nucleotide sequence of the gene MdMYBS1 is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2; the full length of MdMYBS1 gene ORF is 987 bp, encoding 328 amino acids, containing a SANT / MYB DNA binding domain and a ZnF_C2HC domain, which is a typical R1-type MYB transcription factor, containing a typical R1-type region SHAQKYF, but not containing the EAR inhibitory structure LxLxL, see Figure 3 .
[0131] Example 3, Construction and application of MdMYBS1 overexpression vector and interference vector
[0132] I. Construction of MdMYBS1 overexpression vector and interference vector
[0133] 1. Construction of MdMYBS1 overexpression vector
[0134] (1) Obtaining of target fragment
[0135] According to the sequence of the gene MdMYBS1, specific primers were designed, and appropriate enzyme digestion sites were added at both ends of the primers:
[0136] MdMYBS1-ORF-F-Sal I: ACGCGTCGACATGACTCGGAGGTGCTCGC;
[0137] MdMYBS1-ORF-R-Kpn I: GGGGTACCAACTGCATGGATAGGGCTAC;
[0138] The cloned vector pEASY-MdMYBS1 was used as a template for PCR amplification reaction to obtain the MdMYBS1 coding region amplification product with enzyme digestion sites Sal I and Kpn I.
[0139] (2) Recovery of target fragment
[0140] The PCR product fragment of the MdMYBS1 gene with the enzyme cutting site in step (1) and the vector pRI101-flag were cut with Sal I and Kpn I, and the cutting products were recovered, respectively. Then the recovered PCR product fragment of the MdMYBS1 gene and the vector pRI101-flag were connected, and the E. coli competent cells were transformed.
[0141] (3) The target fragment in step (1) was connected to the overexpression vector pRI101-flag
[0142] The reaction system was as shown in Table 9:
[0143] Table 9
[0144]
[0145] 16℃ reaction overnight (16-24h).
[0146] (4) The connection product of step (3) was transformed into the E. coli competent cells DH5α, and the positive recombinants were identified by colony PCR.
[0147] (5) The expression vector constructed in step (4) was transformed into the Agrobacterium competent EHA105, and the engineering bacteria EHA105 / pRI101-flag-MdMYBS1 were obtained, which were used for transforming apple callus, transiently injecting apple fruit, transforming 'GL-3' tissue culture seedlings and heterologous transforming tomato.
[0148] 2. Construction of MdMYBS1 interference vector
[0149] The interference vectors used were pRI101-AN and pTRV2, and the forward fragment was 435 bp and the reverse fragment was 435 bp. The enzyme cutting sites selected for connecting pRI101-AN were Sal I / Sma I and EcoRI / BamHI, and the enzyme cutting sites selected for connecting pTRV2 were BamHI / EcoRI. The constructed vectors were transformed into the E. coli DH5α competent cells, the plasmids of the positive clone bacteria were extracted, the Agrobacterium EHA105 was transformed, and the engineering bacteria EHA105 / pRI101-AN-MdMYBS1 and EHA105 / pTRV2-MdMYBS1 were obtained, which were used for transforming apple callus and transiently injecting apple fruit.
[0150] II. Genetic transformation function analysis of MdMYBS1 gene
[0151] The overexpression vector and the interference vector of MdMYBS1 were constructed, and apple fruit, callus and tissue culture seedling leaves were used as the materials for genetic transformation.
[0152] For injection of apple fruits, apple fruits 'Granny Smith' were harvested one month before maturity, and the apple fruits were injected with Agrobacterium under vacuum, and the samples were collected 14 days after injection.
[0153] The callus was cultured in the dark at 25℃ on MS medium supplemented with 1.0 mg L-1 2,4-D and 1.0 mg L-1 6-BA, and subcultured every 2-3 weeks.
[0154] The apple 'GL-3' plantlets were cultured on the subculture medium, and subcultured every 28-35 days. The plantlets with good growth and uniformity were selected as the test materials. The culture room was maintained at 25℃, with a light intensity of 2000 lx and a light cycle of 16 h light and 8 h dark.
[0155] The obtained engineering bacteria EHA105 / pRI101-flag-MdMYBS1 (MdMYBS1-OVX), EHA105 / pRI101-AN-MdMYBS1 (MdMYBS1-RNAi) and EHA105 / pTRV2-MdMYBS1 (MdMYBS1-TRV) were injected into apple fruits 'Granny Smith', transformed apple callus and transformed apple 'GL-3' plantlets, with controls P101F (transformed empty vector pRI101-flag), P101R (transformed empty vector pRI101-AN) and TRV (transformed empty vector pTRV2), as shown in Figures 4-6 .
[0156] Referring to Figures 7-9 , the results showed that the expression level of MdMYBS1 gene in the transiently transformed fruits 'Granny Smith', transgenic callus and apple 'GL-3' plantlets overexpressing MdMYBS1 (MdMYBS1-OVX) was significantly higher than that of the control P101F, while the expression level in the transiently transformed fruits and transgenic callus with MdMYBS1 interference vector (MdMYBS1-RNAi and MdMYBS1-TRV) was lower than that of the controls P101R and TRV. Referring to Figures 10-12The total carotenoid content in transiently transgenic fruit 'Granny Smith', transgenic callus, and apple seedlings overexpressing MdMYBS1 (MdMYBS1-OVX) was significantly higher than that in the control P101F, while the total carotenoid content in transiently transgenic fruit (MdMYBS1-TRV) and transgenic callus (MdMYBS1-RNAi) with MdMYBS1 interference was significantly lower than that in the controls TRV and P101R. These results indicate that MdMYBS1 positively regulates carotenoid accumulation and is closely related to carotenoid-mediated yellow color; while inhibiting MdMYBS1 gene expression can reduce the carotenoid content in apples.
[0157] In addition, the engineered strain EHA105 / pRI101-flag-MdMYBS1 was transformed into tomato, and MdMYBS1 was heterologously overexpressed in tomato. Figure 13 As shown. Combined with Figures 14-15 The results showed that the expression level of the MdMYBS1 gene in transgenic tomatoes overexpressing MdMYBS1 (MdMYBS1-OVX) was significantly higher than that in the control P101F; the total carotenoid content in transgenic tomatoes overexpressing MdMYBS1 (MdMYBS1-OVX) was significantly higher than that in the control P101F.
[0158] The results above indicate that MdMYBS1 positively regulates the accumulation of carotenoids and is closely related to the carotenoid-mediated yellow color.
[0159] III. Pathway Analysis of MdMYBS1 Gene Regulation of Carotenoid-Mediated Fruit Color
[0160] Using the RNA-seq data from Example 1 and analyzing it, two carotenoid metabolism and synthesis genes, MdPSY2-1 and MdLCYb, were identified as significantly differentially expressed in fruits of 'Red General' and 'Yanfu 3' varieties at 60, 30, and 0 days before maturity. Combined with... Figures 16-18 qRT-PCR analysis confirmed a highly significant increase in the expression levels of MdPSY2-1 and MdLCYb in transiently transformed fruits, transgenic callus, and apple seedlings overexpressing MdMYBS1 (MdMYBS1-OVX), while the expression levels in transiently transformed fruits (MdMYBS1-TRV) and transgenic callus (MdMYBS1-RNAi) with MdMYBS1 interference were significantly decreased. This indicates that MdMYBS1 positively regulates carotenoid accumulation by enhancing the expression of MdPSY2-1 and MdLCYb genes.
[0161] IV. Interaction verification between MdMYBS1 and promoters such as MdPSY2-1 and MdLCYb
[0162] PlantCARE predicted that the promoter region of MdPSY2-1 and MdLCYb gene contains the core binding element of MdMYBS1: (HY)TATC(YD). Figures 19-22 MdMYBS1 interacts with the promoters of MdPSY2-1 and MdLCYb in vitro by yeast one-hybrid (Y1H) experiment; MdMYBS1 binds to the core element region (HY)TATC(YD) of the promoters of MdPSY2-1 and MdLCYb in vitro by EMSA experiment; MdMYBS1 interacts with the promoter fragments of MdPSY2-1 and MdLCYb in vivo by ChIP-PCR; and MdMYBS1 enhances the promoter activity of MdPSY2-1 and MdLCYb in vivo by LUC luciferase system.
[0163] The present application obtains the gene MdMYBS1 related to the content of apple fruit carotenoids by RNA-seq analysis, clones the complete coding segment of the gene, constructs overexpression vectors and interference vectors, and verifies that the gene MdMYBS1 positively regulates the accumulation of carotenoids and is closely related to the yellow color mediated by carotenoids by using transgenic technology; it is proved that the gene regulates the mode of yellow color mediated by carotenoids, that is, MdMYBS1 promotes the accumulation of carotenoids by positively regulating the promoter activity of MdPSY2-1 and MdLCYb, thereby regulating the formation of fruit color mediated by carotenoids; the present application is conducive to the directional selection breeding of yellow color of fruit, and in view of the characteristics of long childhood, complex genetic background and the like of apple, the present application will improve the efficiency of apple breeding, shorten the breeding period, and realize directional breeding.
[0164] The above is only an embodiment of the present application, and does not limit the present application in any form, and any person skilled in the art can make many possible changes and modifications to the technical solution of the present application without departing from the scope of the technical solution of the present application, and all of the above belong to the protection scope of the claims.
Claims
1. A gene regulating fruit color MdMYBS1 Its application in obtaining apples with increased carotenoid content is characterized by, By cloning genes MdMYBS1 , build MdMYBS1 The overexpression vector was used for genetic transformation using apple fruit, callus tissue, or tissue culture seedlings; MdMYBS1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence it encodes is shown in SEQ ID NO.
2.
2. A gene regulating fruit color MdMYBS1 Its application in obtaining tomatoes with increased carotenoid content is characterized by, The MdMYBS1 gene was obtained by heterologous overexpression transformation of tomatoes; the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence it encodes is shown in SEQ ID NO.2.