Penaiedae, Penaeus vannamei, gene molecular marker of cytokinesis factor 3 and application thereof

By developing molecular markers for the cytokinin 3 gene of Litopenaeus vannamei, screening for SNP sites associated with resistance to Vibrio parahaemolyticus, and determining genotypes using PCR amplification and sequencing technologies, efficient breeding of Litopenaeus vannamei was achieved, resulting in disease-resistant varieties and solving the problem of Vibrio parahaemolyticus disease prevention and control in Litopenaeus vannamei aquaculture.

CN118256632BActive Publication Date: 2026-02-06GUANGXI ACADEMY OF FISHERY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410670145.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-28
Publication Date
2026-02-06
Estimated Expiration
2044-05-28

AI Technical Summary

Technical Problem

The lack of effective methods for preventing and controlling Vibrio parahaemolyticus disease in Litopenaeus vannamei has led to huge economic losses in the aquaculture industry, and the application of immune-related gene SNP molecular markers in shrimp is limited.

Method used

Molecular markers for the cytokinin 3 gene of Litopenaeus vannamei were developed. By screening for SNP molecular markers associated with resistance to Vibrio parahaemolyticus, genotypes were determined using PCR amplification and sequencing technologies. Individuals with dominant genotypes were selected for breeding, and disease-resistant varieties were obtained by gene editing or knockout methods.

Benefits of technology

This study has enabled efficient breeding of Litopenaeus vannamei, obtained stable resistance to Vibrio parahaemolyticus, improved breeding efficiency and accuracy, and provided a foundation for disease resistance in Litopenaeus vannamei aquaculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118256632B_ABST
    Figure CN118256632B_ABST
Patent Text Reader

Abstract

The application discloses a penaeus vannamei cytoplasmic division factor 3 gene molecular marker, which comprises molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F and molecular marker G located on the dedicator of cytokinesis protein 3 gene sequence of the penaeus vannamei; the application uses the molecular marker as a functional marker of the penaeus vannamei Vibrio parahaemolyticus resistance character, improves the disease resistance breeding of the penaeus vannamei, and specifically comprises the following steps: extracting the genomic DNA of muscle tissue of the penaeus vannamei to be tested, taking the genomic DNA as template DNA to perform PCR amplification and purification of the PCR amplification product, then performing sequencing on the obtained product, determining the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F and the molecular marker G, and selecting the individuals with dominant genotypes to breed the penaeus vannamei, thereby promoting the research and application of the disease resistance breeding of the penaeus vannamei.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of Litopenaeus vannamei breeding, and particularly relates to a Litopenaeus vannamei cytokinesis factor 3 gene molecular marker and application thereof. BACKGROUND

[0002] With the rapid development of high-density and intensive culture of Litopenaeus vannamei (also known as white shrimp) and the deterioration of marine ecological environment, shrimp farming often faces the threat of diseases such as bacteria, viruses and parasites, which seriously hinders the healthy development of shrimp farming. Especially the bacterial disease caused by Vibrio parahaemolyticus has caused great economic losses to shrimp farming. In order to prevent the outbreak of Vibrio parahaemolyticus disease, various measures including Chinese herbal medicine, probiotics, and antibacterial peptides have been used, unfortunately, so far there is still no effective prevention and control method. Therefore, a practical strategy to cope with the bacterial disease caused by Vibrio parahaemolyticus is to breed a Litopenaeus vannamei variety with resistance to Vibrio parahaemolyticus infection.

[0003] Cytokinesis factor 3 (dedicator of cytokinesis protein 3, DOCK3) is a member of the guanine nucleotide exchange factor family, which can affect downstream related signaling pathways by activating small G proteins, and is closely related to the occurrence and development of diseases such as muscular dystrophy, pulmonary fibrosis, epilepsy and tumor. Recent studies have found that DOCK3 also plays an important role in protecting retinal ganglion cells from neurotoxin and oxidative stress damage, but there is no report on the correlation between DOCK3 and the resistance of shrimp to Vibrio parahaemolyticus.

[0004] Single nucleotide polymorphism (SNP) is the most common type of genetic variation, and with the rapid development of DNA sequencing technology, single nucleotide polymorphism is increasingly used in association analysis between genetic variation and biological traits of crustaceans to accelerate the breeding process. In recent years, SNPs in many immune-related genes have been confirmed to be related to the resistance of hosts to pathogen infection. For example, the SNP site A / T in the MITF gene of Mactra veneriformis showed that individuals carrying AA genotype and allele A were more resistant to Vibrio parahaemolyticus infection in the association analysis of Vibrio parahaemolyticus resistance traits. After the attack of Taura syndrome virus (TSV), five SNPs were found in the Hsp70 gene of Litopenaeus vannamei, and the genotype frequency of 892 C / T SNP was significantly different between TSV-resistant and susceptible shrimps. In the AP-1 gene of Tegillarca granosa, 18 SNPs were found, of which 6 were significantly related to Vibrio harveyi resistance. However, there are few reports on the development of SNP molecular markers of immune-related genes in Litopenaeus vannamei and their association analysis with Vibrio parahaemolyticus resistance traits. SUMMARY

[0005] In view of the above problems, the application discloses a penaeus vannamei cytokinesis protein 3 gene molecular marker, which is screened based on a dedicator of cytokinesis protein 3 gene of the penaeus vannamei, and is related to an SNP molecular marker of an anti-vice-hemolytic vibrio character, so that the SNP molecular marker is used for breeding of the penaeus vannamei, and a new variety of the penaeus vannamei with excellent anti-vice-hemolytic vibrio capability is obtained.

[0006] The application is implemented by adopting the following technical scheme:

[0007] The penaeus vannamei cytokinesis protein 3 gene molecular marker comprises any one or more of a molecular marker A, a molecular marker B, a molecular marker C, a molecular marker D, a molecular marker E, a molecular marker F and a molecular marker G.

[0008] The molecular marker A is located at a 14552 bp site of a nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14552 T>A, a base of the site is A or T, and a mutation type is A / T heterozygote or T / T homozygote.

[0009] The molecular marker B is located at a 14572 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14572 A>G, a base of the site is A or G, and a mutation type is A / A homozygote, A / G heterozygote or G / G homozygote.

[0010] The molecular marker C is located at a 14592 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14592 A>T, a base of the site is A or T, and a mutation type is A / A homozygote or A / T heterozygote.

[0011] The molecular marker D is located at a 14688 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14688 G>A, a base of the site is A or G, and a mutation type is A / A homozygote, A / G heterozygote or G / G homozygote.

[0012] The molecular marker E is located at a 14697 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14697 G>A, a base of the site is A or G, and a mutation type is A / G heterozygote or G / G homozygote.

[0013] The molecular marker F is located at a 14704 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, is recorded as D.14704 G>A, a base of the site is A or G, and a mutation type is A / G heterozygote or G / G homozygote.

[0014] The molecular marker G is located at the 14720 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, and is denoted as D.14720 G>T, the base at the site is G or T, and the mutation type is G / G homozygote, G / T heterozygote, T / T homozygote.

[0015] The nucleotide sequence described in sequence 1 in the sequence listing is the nucleotide sequence of the dedicator of cytokinesis protein 3 gene, and the dedicator of cytokinesis protein 3 gene is the gene numbered as LOC113808196 shown in the GenBank database of NCBI.

[0016] The application of the Penaeus vannamei cytoplasmic division factor 3 gene molecular marker is to use the gene molecular marker for selective breeding of Penaeus vannamei, specifically, genomic DNA of muscle tissue of Penaeus vannamei to be tested is extracted, and then the genomic DNA is used as template DNA for PCR amplification and purification of PCR amplification products, and then the obtained PCR amplification products are sequenced to determine the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F and the molecular marker G.

[0017] When the genotype of the molecular marker A is the dominant genotype TT genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; when the genotype of the molecular marker B is the dominant genotype AA genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; when the genotype of the molecular marker C is the dominant genotype AT genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; when the genotype of the molecular marker D is the dominant genotype GG genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; when the genotype of the molecular marker E is the dominant genotype AG genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; when the genotype of the molecular marker F is the dominant genotype AG genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding; and when the genotype of the molecular marker G is the dominant genotype GG genotype, the individual is selected as a reserve parent for Penaeus vannamei breeding.

[0018] The present application extracts DNA from the appendage muscle tissue of Penaeus vannamei, which does not have too much impact on the body of the shrimp. Breeding can be carried out by using the method of molecular assisted breeding, for example, using the method of gene knockout or gene editing to process the varieties obtained after the molecular marker.

[0019] The primer set for detecting the Penaeus vannamei cytoplasmic division factor 3 gene molecular marker in the PCR amplification process comprises a primer F and a primer R, the sequence of the primer F is GTCTCTATAATTAGCCTTCTTGAAGACAG (sequence 2 in the sequence table), and the sequence of the primer R is ATACCTGAGAAGCTTGGATGT (sequence 3 in the sequence table).

[0020] The PCR amplification system is composed of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

[0021] The reaction program of the PCR amplification comprises the following steps:

[0022] S1, pre-denaturation at 95℃ for 5 min;

[0023] S2, denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, and 34 cycles;

[0024] S3, extension at 72℃ for 5 min.

[0025] Compared with the prior art, the technical solution has the following beneficial effects:

[0026] The application provides a SNP molecular marker closely related to the Vibrio parahaemolyticus resistance of Penaeus vannamei, which can be applied to breeding of new varieties of Penaeus vannamei resistant to Vibrio parahaemolyticus, and is conducive to promoting research and application of Penaeus vannamei disease-resistant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is a partial fragment sequence of the product obtained by amplifying the dedicator of cytokinesis protein 3 gene in the examples, a represents the 151st to 155th positions, wherein the AT, TT peak value graph of the D. 14552 T>A site is shown; b represents the 171st to 175th positions, wherein the AA, AG, GG peak value graph of the D. 14572 A>G site is shown; and c represents the 191st to 195th positions, wherein the AA, AT peak value graph of the D. 14592 A>T site is shown.

[0028] Figure 2 is a partial fragment sequence of the product amplified from the dedicator of cytokinesis protein 3 gene in the example, d represents the 287th to 291st positions, wherein the AA, AG, GG peak figure of the D. 14688 G>A site is shown; e represents the 296th to 300th positions, wherein the AG, GG peak figure of the D. 14697 G>A site is shown; f represents the 303rd to 307th positions, wherein the AG, GG peak figure of the D. 14704 G>A site is shown; g represents the 319th to 323rd positions, wherein the GG, GT, TT peak figure of the D. 14552 G>A site is shown. DETAILED DESCRIPTION

[0029] The present application is further illustrated by the following examples, but not as a limitation to the present application. The specific experimental conditions and methods not specified in the following examples, and the technical means adopted are generally conventional means well known to those skilled in the art.

[0030] Example: The screening process of the Penaeus vannamei cytoplasmic division factor 3 gene molecular marker described in the present application is as follows:

[0031] (1) 245 Penaeus vannamei with a body weight of about 20 grams were selected and temporarily raised for 5 days, then 100 μL of Vibrio parahaemolyticus with a concentration of 7 x 10 6 cfu / mL was injected into the Penaeus vannamei individuals; in order to exclude the death caused by injection factors, the death individuals were recorded after 6 hours of challenge, and 60 Penaeus vannamei that died first and 60 Penaeus vannamei that still survived after 96 hours were selected as samples of the Penaeus vannamei Vibrio parahaemolyticus sensitive group and the Penaeus vannamei Vibrio parahaemolyticus tolerant group, respectively;

[0032] (2) 5 Penaeus vannamei were randomly selected from the sensitive group and the tolerant group, respectively, the muscle tissue was extracted, and the conventional phenol imitation extraction method was used to extract the genomic DNA, and the obtained genomic DNA was stored at -20 °C for standby;

[0033] (3) The primer F and the primer R were designed according to the dedicator of cytokinesis protein 3 gene sequence of Penaeus vannamei, then the SNP site located in the dedicator of cytokinesis protein 3 gene was amplified and screened;

[0034] The sequence of the primer F is: GTCTCTATAATTAGCCTTCTTGAAGACAG.

[0035] The sequence of the primer R is: ATACCTGAGAAGCTTGGATGT.

[0036] The PCR amplification system consists of the following components: 2.0 μL of 10x Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, 2.0 μL of template DNA;

[0037] The reaction procedure of the PCR amplification includes the following steps:

[0038] S1, pre-denaturation at 95°C for 5 min;

[0039] S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for 34 cycles;

[0040] S3, extension at 72°C for 5 min;

[0041] (4) After the PCR amplification product is detected by 1% agarose gel electrophoresis, purification and sequencing, the sequencing results are analyzed by using DNAstar software, including nucleotide sequence alignment and peak graph analysis, and relevant SNPs sites are screened out; the sequence of the PCR amplification product of one sample is as follows:

[0042] GTCTCTATAATTAGCCTTCTTGAAGACAGTAAGTTCGAGCATTTTAAGCCAGTAATGGATGCTTACATCACTGGCCACTTTGCTGCTGCACTTGTATACAAGTAAGTGTCTTGTTATGAATTTAACAGCCCATTTTATTGCATTGGTTAATATATTTATGCATTGTTTTATAATGTATGCTAAAGGCACAAAAATAATGCGTAGTTTTATAATGTAGGTCAAAGGCACTAATTAAGACAAAATAAAATCTTGGTTAAAGATGATCCTTACATATTTTTTTTTCAACTAGTCTTTATAGATTAAAGAAAAAGTTGTCTTTTGCATTTTCACCAGGGGCCTTATCAGTTGTGTGAAGCACCTGTCGGACCTCTGCCCTCAGACCGAGAAGCAGGAACCAATTATGAAATGTTTTCGTTCGCTGGAATATATCTTCAAATTCATCATCCAGTCTCGGCTTCTGTTTGCGAGAGCCACAGGGGGACAGAATGAAGATTCCTTTAGAGTTGATGTGGATAGTTTATTTGAATCTTTTGCTCATATGCTCAATATGCATCTGGACAACATCCAAGCTTCTCAGGTAT;

[0043] wherein the 153th position is D. 14552 T>A, the 173th position is D. 14572 A>G, the 193th position is D. 14592 A>T, the 289th position is D. 14688 G>A, the 298th position is D. 14697 G>A, the 305th position is D. 14704 G>A, the 321th position is D. 14720 G>T;

[0044] (5) According to the screened SNPs sites, the sensitive group and the resistant group of the Penaeus vannamei are detected and genotyped according to the above method, respectively. The samples of different SNP sites in the sensitive group and the resistant group are counted, the genotype frequency and the allele frequency are calculated, and the independence test is carried out by chi-square analysis. The specific results are shown in Table 1.

[0045] According to the analysis of Table 1, the genotype polymorphism of each molecular marker site has a very significant influence on the anti-Vibrio parahaemolyticus trait of Penaeus vannamei: the dominant type of molecular marker A is TT genotype, the dominant type of molecular marker B is AA genotype, the dominant type of molecular marker C is AT genotype, the dominant type of molecular marker D is GG genotype, the dominant type of molecular marker E is AG genotype, the dominant type of molecular marker F is AG genotype, and the dominant type of molecular marker G is GG genotype.

[0046] Table 1: Chi-square analysis results of the sites

[0047]

[0048] In addition, it should be understood that, although the present specification is described in terms of embodiments, not every embodiment contains only one independent technical solution, and the description of the specification is only for the sake of clarity, and those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that those skilled in the art can understand.

Claims

1. An application of a molecular marker for the gene of cytokinin 3, a cytokinin-active factor in Litopenaeus vannamei, characterized in that: The molecular markers for the Litopenaeus vannamei cytokinin 3 gene include molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, and molecular marker G; The molecular marker A is located at the 14552 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14552 T>A. The base at this site is either A or T, and the mutation type is A / T heterozygous or T / T homozygous. The molecular marker B is located at the 14572 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14572 A>G. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous. The molecular marker C is located at the 14592 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14592 A>T. The base at this site is A or T, and the mutation type is A / A homozygous or A / T heterozygous. The molecular marker D is located at the 14688 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14688 G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous. The molecular marker E is located at the 14697 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14697 G>A. The base at this site is either A or G, and the mutation type is A / G heterozygous or G / G homozygous. The molecular marker F is located at the 14704 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14704 G>A. The base at this site is A or G, and the mutation type is A / G heterozygous or G / G homozygous. The molecular marker G is located at the 14720 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.14720 G>T. The base at this site is G or T, and the mutation type is G / G homozygous, G / T heterozygous, or T / T homozygous. The application involves using the Litopenaeus vannamei cytokinin 3 gene molecular marker for selective breeding of Litopenaeus vannamei with resistance to Vibrio parahaemolyticus. Specifically, genomic DNA is first extracted from the muscle tissue of the Litopenaeus vannamei to be tested, then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained PCR amplification products are then sequenced to determine the genotypes of molecular markers A, B, C, D, E, F, and G. When the genotype of molecular marker A is the dominant TT genotype, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is the dominant AA genotype, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is the dominant AT genotype, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker D is the dominant GG genotype... The individual was selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker E was the dominant AG genotype, the individual was selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker F was the dominant AG genotype, the individual was selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker G was the dominant GG genotype, the individual was selected as a backup parent for breeding Litopenaeus vannamei.

2. The application of the molecular marker for cytokinin 3 gene in Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primer set used to detect the molecular marker of the cytokinin 3 gene of Litopenaeus vannamei includes primer F and primer R. The sequence of primer F is GTCTCTATAATTAGCCTTCTTGAAGACAG, and the sequence of primer R is ATACCTGAGAAGCTTGGATGT.

3. The application of the molecular marker for the cytokinin 3 gene in Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification system consists of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTPs, 0.2 μL of Taq DNA polymerase at a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

4. The application of the molecular marker for cytokinin 3 gene in Litopenaeus vannamei according to claim 1, characterized in that: The PCR amplification reaction procedure includes the following steps: S1. Pre-denaturate at 95℃ for 5 min; S2. Perform 34 cycles of denaturation at 95℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. S3, extend at 72℃ for 5 minutes.

Citation Information

Patent Citations

  • SNP marker related to vibrio parahaemolyticus infection resistance character of litopenaeus vannamei and application of SNP marker

    CN114540509A

  • SNP (Single Nucleotide Polymorphism) marker related to disease resistance character of litopenaeus vannamei, detection primer and application of SNP marker

    CN114540511A