A method to improve Wx mp Method for determining the content of amylose in semi-glutinous japonica rice

Abstract

The present invention provides a method for improving Wx mp The method for determining the content of amylose in semi-glutinous japonica rice is related to the field of bioengineering technology. The CRISPR / Cas9 gene editing technology is used to modify the content of amylose in semi-glutinous japonica rice. mp The two target sequences uORF4 and uORF6 of the gene were site-specifically edited, and sgRNA1 and sgRNA2 were designed for the two sequences respectively. The sequence of sgRNA1 was AAAAAATGGATTATATTTCC, which was used to knock out uORF4, and the sequence of sgRNA2 was TAAGTCCTTATAAGCACATA, which was used to knock out uORF6. mp The gene-specific sequences uORF4 and uORF6 were site-specifically edited at two loci. Mutations in uORF4 and uORF6 could increase the amylose content in rice, providing genetic resources and technical ideas for improving rice quality.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, specifically a method for increasing Wx mp Method for determining the amylose content of semi-glutinous japonica rice. Background Art

[0002] Rice is the main food crop in my country. With the improvement of people's living standards, the demand is gradually changing from "eating enough" to "eating well", and consumers have higher and higher requirements for the taste quality of rice. The taste quality of rice is most affected by the content of amylose in rice. The taste quality of rice can be improved by increasing or decreasing the content of amylose. Therefore, the content of amylose has become an important physical and chemical indicator to guide breeders to improve rice varieties.

[0003] The amylose content of rice is mainly controlled by Wx. The genotypes of Wx in indica rice, japonica rice and glutinous rice are Wx a 、Wx b and wx. Wx a The amylose content of rice in the background is generally greater than 20%, Wx b The amylose content of rice with a Wx background is generally between 14% and 20%, while the amylose content of rice with a Wx background is generally less than 2%. Generally speaking, the lower the amylose content of rice, the better the taste quality, so breeders have long been committed to reducing the amylose content of rice. However, some rice varieties contain rare Wx genotypes, such as Wx mp , a point mutation occurred in its fourth exon (G at position 473 mutated to A), resulting in reduced activity of the encoded protein, reduced amylose content (generally less than 10%), and slightly poor appearance quality. By slightly increasing the amylose content in these varieties, their appearance quality may be improved. Studies have shown that editing the uORF region of the gene can improve the translation efficiency of the gene, thereby achieving high expression, and it has been found that the Wx gene contains multiple uORF segments. Previous studies have mostly focused on editing the coding region and promoter region of the Wx gene. mp There are no reports on editing target sites in the uORF region of genes.

[0004] There have been many studies on the function and application of rice Wx gene. There are multiple natural allele variations of this gene, including the common Wx a , Wx b , wx, and the less common Wx mp , Wx mw 、Wx lvetc. However, these types of mutations still cannot meet the needs of breeding, and creating new Wx locus mutations is very important for improving rice quality. Gene editing has shown great potential in gene research, gene therapy and genetic improvement because of its ability to efficiently perform site-specific genome editing and directed creation of mutations. Traditional rice variety improvement methods are time-consuming and prone to changes in other traits. CRISPR / Cas9 gene editing technology-mediated variety improvement and germplasm creation overcome this shortcoming and can achieve rapid and accurate directed improvement of specific traits. Targeted improvement of various traits such as rice quality, fertility, disease resistance and resistance to abiotic stress has been achieved in rice. Summary of the invention

[0005] In view of the above prior art, the present invention proposes a method for improving Wx mp The method for increasing the amylose content of semi-glutinous japonica rice was developed. The CRISPR / Cas9 gene editing technology was used to perform site-specific editing on the specific sequence of the rice Wx gene. The gene mutation can increase the amylose content of rice, providing genetic resources and technical ideas for rice quality improvement research.

[0006] The present invention provides a method for improving Wx mp The method for determining the content of amylose in semi-glutinous japonica rice comprises sgRNA1 and sgRNA2, wherein the sgRNA1 is AAAAAATGGATTATATTTCC, and the sgRNA2 is TAAGTCCTTATAAGCACATA; the sgRNA1 and sgRNA2 are respectively mp The two sequences uORF4 and uORF6 were designed as target sequences, the uORF4 sequence was ATGGATTATATTTCCTGGGCTAAAAGAATTGTTGATTTGGCACAATTAAATTCAGTGTCAAGGTTTTGTGCAAGAATTCAGTGTGAAGGAATAGATTCTCTTCAAAACAATTTAATCATTCATCTGATCTGCTCAAAGCTCTGTGCATCTCCGGGTGCAACGGCCAGGATATTTATTGTGCAGTAA, and the uORF6 sequence was ATGGCATTGTAA.

[0007] The present invention also provides a recombinant vector comprising the sgRNA, wherein the basic plasmid of the recombinant vector comprises CRISPR / Cas9-U6a-sgRNA1 and CRISPR / Cas9-U6a-sgRNA2.

[0008] The present invention also provides the sgRNA or the recombinant vector in increasing Wx mpApplication of semi-glutinous japonica rice in the study of amylose content.

[0009] The present invention also provides the sgRNA or the recombinant vector for editing semi-glutinous japonica rice Wx mp Application of genes uORF4 and uORF6.

[0010] Preferably, the editing comprises making the semi-glutinous japonica rice Wx mp One or more bases are deleted and / or inserted and / or substituted in uORF4 and uORF6 of the gene.

[0011] Preferably, the semi-glutinous japonica rice is Wx mp Type semi-glutinous japonica rice.

[0012] In the specific creation of the present invention, by constructing Wx mp Gene editing vector, the U6a linker sequence containing sgRNA is introduced into the recipient rice through the editing vector to obtain Wx mp Gene-edited rice with mutations in the uORF4 or uORF6 target sites of the gene; the amylose content of the gene-edited rice was significantly increased compared with the recipient rice.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] 1. The present invention uses CRISPR / Cas9 technology to successfully edit the uORF4 and uORF6 sites of semi-glutinous japonica rice, and cultivates new rice germplasm with significantly improved amylose content, confirming that Wx mp The contribution of genes to the amylose content of rice will have great application value in the field of rice molecular breeding. Traditional rice amylose directed improvement breeding is mainly carried out through hybridization and backcrossing, but due to factors such as unstable offspring separation, long cycle and linkage drag of unfavorable genes, it is difficult to cultivate excellent varieties with stable inheritance and fine-tuned amylose content. Therefore, CRISPR / Cas9 technology is being widely used in rice trait improvement and new germplasm creation due to its advantages such as simple operation, high editing efficiency and low cost.

[0015] 2. Different from the existing reports on gene editing in terms of target sequence and target selection, the present invention uses Wx mp The gene uORF4 and uORF6 segments were edited to ensure gene editing efficiency without changing Wx mp The coding region of the gene, and by editing Wx mp The uORF segment of the gene improves its translation efficiency, that is, increases Wx mpThe accumulation of protein without changing the genotype of its coding region can achieve the purpose of finely regulating the content of amylose. Therefore, the CRISPR / Cas9 vector constructed by the present invention has important significance and advantages in finely increasing the content of amylose in semi-glutinous japonica rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the rice Wx in the embodiment of the present invention mp Schematic diagram of gene structure and sgRNA location.

[0017] Figure 2 For the rice Wx in the embodiment of the present invention mp Schematic diagram of the pYLCRISPR / Cas9-Wx vector for single-target gene editing.

[0018] Figure 3 Wx in the embodiment of the present invention mp Schematic diagram of the mutation method used to edit rice.

[0019] Figure 4 Wx in the embodiment of the present invention mp Schematic diagram of the amylose content of gene-edited rice. DETAILED DESCRIPTION

[0020] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0021] Example 1: Target design and gene editing vector construction: The genetic transformation receptor material selected in this example is the semi-glutinous japonica rice variety Nanjing 9108. According to the prediction on the NCBI website, the rice Wx gene is located on chromosome 6 of rice. mp The uORF4 and uORF6 sequences of the gene were the same as those of Nipponbare and no mutation occurred. sgRNAs were designed in uORF4 and uORF6 of the Wx gene, and a 20bp conservative specific sequence was designed for each target site. Target site 1 (sgRNA1) was located at Wx mp The nucleotides of the gene are located at -529 to -510 bp, and target 2 (sgRNA2) is located at -298 to -279 bp. The target location and sgRNA are as follows Figure 1 shown.

[0022] According to the requirements of the U6a vector, the U6a-sgRNA1-F / R linker and the U6a-sgRNA2-F / R linker were synthesized respectively. After preparing the oligo dimer, the sgRNA1 and the OsU6a plasmid vector were connected, and the sgRNA2 and the OsU6a plasmid vector were connected. After two rounds of PCR amplification, the primer sequences used for PCR amplification include:

[0023] UF: CTCCGTTTTACCTGTGGAATCG,

[0024] sgRNA1(2)-R:CGGAGGAAAATTCCATCCAC,

[0025] B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGGCAGCAAAGG,

[0026] B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC,

[0027] B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG,

[0028] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC)

[0029] The DNA fragments of U6a-sgRNA1 and U6a-sgRNA2 were obtained and then connected to the CRISPR / Cas9 expression vector. The specific method was referred to the operation steps of (Ma et al, Molecular Plant, 2015, 8(8): 1274-1284). Finally, the editing vector pYLCRISPR / Cas9-Wx was successfully constructed. Figure 2 shown.

[0030] Example 2: Wx mp Identification of gene-edited transgenic rice and analysis of editing efficiency: Using the rice transgenic method mediated by Agrobacterium EHA105, the gene editing vector pYLCRISPR / Cas9-Wx plasmid was transformed into the callus tissue of Nanjing 9108. Through hygromycin screening, 20 independent T0 transformed strains were differentiated.

[0031] The genetic transformation process is as follows: Agrobacterium EHA105 containing pYLCRISPR / Cas9-Wx plasmid infects mature embryo callus of japonica rice recipient variety Nanjing 9108, and cultured in the dark at 26°C on the co-culture medium for 3 days. The washed callus is transferred to the selection medium containing hygromycin for resistance screening. The selected resistant callus is transferred to the pre-differentiation medium for 14 days, and then transferred to the differentiation medium for light culture. When the seedlings grow to 3 cm, they are transferred to the rooting medium to induce adventitious roots. When the seedlings grow to 10 cm in height, the seedlings are taken out, the attached solid culture medium is washed with sterile water, and they are moved to the soil and cultivated in the greenhouse. After the plants are strong, samples are taken for leaf DNA extraction.

[0032] With Nanjing 9108 as the control, PCR detection was performed using primers hygromycin marker (Hyg-F: GCTTTTCAGCTTCGATGTAGGAG, Hyg-R: CTACACAGCCATCGGTCCAGA) and nuclease marker (Cas9-F: GATCCTTACTTTCCGTATTCCTTACTACG, Cas9-R: ATACCCTCCTCAATCCTCTTCATG), and those that could amplify specific bands were positive transgenic plants. After identification, a total of 15 positive transgenic plants were screened, with a positive rate of 75.0%. The target site adjacent sequences of the positive transformed plants were amplified and sequenced by PCR using primers Wxseq-F / R (Wxseq-F: TTCAACTCTCGTTAAATCATGTCTCT, Wxseq-R: GGAGAATTGAAGTTTATTACAATTTGG). It was detected that 13 of the positive transformed plants had mutations, and the gene editing efficiency was 86.6%. However, no homozygous edited lines were identified in the T0 transgenic plants, and all the editing sites were heterozygous.

[0033] Example 3: Wx without genetically modified ingredients mp Screening of homozygous edited lines: The gene-edited T0 plants can remove the transgenic tag hygromycin resistance gene and nuclease gene through self-exchange in the offspring, thereby obtaining safer edited plants without transgenic tags. Therefore, in order to obtain homozygous edited lines without transgenic components, the gene-edited T0 plants in Example 2 were planted to the T1 generation.

[0034] Leaf DNA of Nanjing 9108 and T1 plants were extracted respectively. With Nanjing 9108 as the control, molecular identification of transgenic components was performed using Hyg-F / R and Cas9-F / R markers. A series of T1 plants without transgenic components were screened out for each line. Then, through sequencing analysis of target-adjacent sequences of plants without transgenic components, homozygous lines with base deletions were screened out, such as Figure 3 As shown, the mutation types of the T1 target sites are consistent with those of the T0 strain, indicating that the gene editing sites can be stably inherited between different generations.

[0035] Example 4: Analysis of amylose content in gene-edited homozygous plants: Using Nanjing 9108 as a control, the Wx obtained in Example 3 was investigated. mp The grains of the homozygous edited plants were ground and the amylose content was determined. Statistical analysis showed that the difference in amylose content between Nanjing 9108 and the two edited plants reached a very significant level, with an increase of 1%-1.5%. Figure 4 Therefore, the Wx obtained in this embodiment is mpCompared with the Nanjing 9108 variety, the gene-edited rice has significantly increased amylose content, which is of great value in the field of rice genetic breeding.

[0036] The above are only implementation modes of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent structure made using the contents of the present invention specification, directly or indirectly used in other related technical fields, is also within the patent protection scope of the present invention.

Claims

1. A method to improve Wx mp The method for determining the amylose content of semi-glutinous japonica rice is characterized in that: The sgRNA1 and sgRNA2 are included, wherein the sgRNA1 is AAAAAATGGATTATATTTCC, and the sgRNA2 is TAAGTCCTTATAAGCACATA; the sgRNA1 and sgRNA2 are respectively mp The two sequences uORF4 and uORF6 of the invention were designed as target sequences, wherein the uORF4 sequence was ATGGATTATATTTCCTGGGCTAAAAGAATTGTTGATTTGGCACAATTAAATTCAGTGTCAAGGTTTTGTGCAAGAATTCAGTGTGAAGGAATAGATTCTCTTCAAAACAATTTAATCATTCATCTGATCTGCTCAAAGCTCTGTGCATCTCCGGGTGCAACGGCCAGGATATTTATTGTGCAGTAA, and the uORF6 sequence was ATGGCATTGTAA; the sgRNA1 and sgRNA2 were used to edit the semi-glutinous japonica rice Wx mp uORF4 and uORF6 of the genes.

2. The sgRNA1 and sgRNA2 of claim 1 are effective in increasing Wx mp Application of semi-glutinous japonica rice in the study of amylose content.

Images