Molecular markers of HSP90 gene related to cold tolerance in Penaeus vannamei and its application

Abstract

The invention discloses a molecular marker of a HSP90 gene of a white shrimp related to a cold-resistance trait, comprising a molecular marker A, a molecular marker B, a molecular marker C, a molecular marker D, a molecular marker E, a molecular marker F, a molecular marker G, a molecular marker H, a molecular marker I, a molecular marker J, a molecular marker K, a molecular marker L, a molecular marker M, a molecular marker N, a molecular marker O, a molecular marker P and a molecular marker Q located on a gene sequence of a heat shock protein HSP 90-alpha of the white shrimp. The molecular marker of the invention shows a significant correlation with the cold-resistance trait in white shrimp, has the characteristics of high accuracy and good breeding efficiency, can be used as a functional marker of the cold-resistance ability of white shrimp, and is used for quickly and accurately identifying and breeding white shrimp with a cold-resistance trait, so as to improve breeding efficiency and economic benefits.

Description

Technical Field

[0001] The invention belongs to the technical field of whiteleg shrimp breeding, and particularly relates to a whiteleg shrimp HSP90 gene molecular marker related to cold-resistance traits and an application thereof. Background Art

[0002] Whiteleg shrimp ( Litopenaeus vannamei ), scientific name Penaeus vannamei, quickly adapted to the domestic aquaculture environment after being introduced into my country. The breeding area and output have continued to rise in recent years, especially in coastal areas such as Guangdong, Guangxi, Shandong, Fujian, etc., where the breeding output is high. It is the shrimp species with the highest breeding output in my country. Under artificial breeding conditions, the water temperature adapted to the white shrimp is 16-38℃, and the most suitable growth temperature is 22-35℃. White shrimp belongs to tropical shrimps and has good adaptability. It can grow in water bodies of different salinities, including seawater, fresh water and brackish water. This makes its breeding not limited to coastal areas, but also provides the possibility of breeding in inland areas. In northern my country, due to the long cold season, the time suitable for breeding of white shrimp is short each year. In southern my country, many shrimp farmers use winter breeding strategies to capture the high market price during the Spring Festival, thereby maximizing economic benefits. At the same time, they also have to bear the risk of large-scale death of shrimps due to the sudden drop in water temperature caused by cold waves. Therefore, breeding whiteleg shrimp varieties that can adapt to lower water temperatures will help expand the breeding area, extend the breeding cycle, improve breeding efficiency and yield, and break through the limitations of whiteleg shrimp breeding in northern and southern my country.

[0003] Molecular marker-assisted breeding can help select new strains of white shrimp with specific traits such as cold resistance. With the development of molecular biology and genotyping technology, molecular marker technology based on trait-related functional genes plays an important role in aquatic genetic breeding. These technologies can accurately identify and select aquatic species with desired traits, such as cold resistance, growth rate, disease resistance, etc., thereby improving breeding efficiency and effectiveness. Through molecular marker-assisted selection (MAS), the development of new varieties can be accelerated to achieve sustainable development of the shrimp farming industry and maximize economic benefits.

[0004] Single Nucleotide Polymorphism (SNP) refers to the variation at a single nucleotide position in the genomic DNA sequence. SNPs usually refer to a nucleotide (adenine, cytosine, guanine or thymine, i.e. A, C, G or T) replaced by another nucleotide at a specific position. This variation is one of the most common genetic markers and exists in the genomes of animals, plants and other organisms. It has the advantages of large number, wide distribution, strong representativeness and good genetic stability. It is an important bridge connecting genetic information and biological phenotypes. With the development of high-throughput sequencing technology, the detection of SNPs has become faster and more cost-effective. It has gradually been applied to the construction of genetic maps of aquatic animals, QTL positioning and analysis of functional genes. However, there are few reports on the application of SNPs in the breeding of cold-resistant varieties of white shrimp.

[0005] At the same time, HSP90 (heat shock protein 90) is a class of proteins that are widely present in bacteria and humans. They play a vital role in the cell's response to various stress conditions, such as cold, infection, and disease. HSP90 is a highly conserved class of proteins in evolution. It accounts for about 1% to 2% of cytoplasmic proteins in a normal state without stress, and its content will be higher under stress conditions. HSP90 is involved in a variety of biological processes, including the correct folding of proteins, preventing the aggregation of misfolded proteins, and providing energy through ATP hydrolysis to promote the correct conformation of proteins. As a molecular chaperone, HSP90 is mainly involved in the maintenance of the normal structure of labile proteins under stress conditions, and plays a key role in helping cells protect and repair proteins damaged by environmental stress, but there is no report on its significant correlation with the cold resistance of white shrimp. Summary of the invention

[0006] In view of the above shortcomings, the present invention discloses a molecular marker of HSP90 gene related to the cold resistance trait of whiteleg shrimp, and obtains the gene molecular marker related to the cold resistance trait based on the heat shock protein HSP 90-alpha gene screening of whiteleg shrimp, and utilizes the gene molecular marker as a functional marker of the cold resistance ability of whiteleg shrimp, so as to select whiteleg shrimp varieties with cold resistance traits.

[0007] The present invention is achieved by adopting the following technical solutions:

[0008] A molecular marker of the HSP90 gene of white shrimp related to the cold-resistance trait, comprising any one or more of molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, molecular marker L, molecular marker M, molecular marker N, molecular marker O, molecular marker P and molecular marker Q;

[0009] The molecular marker A is located at the 2489 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2489 G>A, the base at this site is A or G, and the mutation type is A / A homozygous type or G / G homozygous type;

[0010] The molecular marker B is located at the 2573 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2573 G>C, the base at this site is C or G, and the mutation types are C / C homozygous, C / G heterozygous, and G / G homozygous;

[0011] The molecular marker C is located at the 2717 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2717 G>T, the base at this site is G or T, and the mutation types are G / G homozygous, G / T heterozygous, and T / T homozygous;

[0012] The molecular marker D is located at the 2945 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2945 A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;

[0013] The molecular marker E is located at the 2969 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2969 G>A, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;

[0014] The molecular marker F is located at the 2984 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2984 T>C, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous;

[0015] The molecular marker G is located at the 3032 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3032 A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;

[0016] The molecular marker H is located at the 3044 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3044 C>T, the base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, T / T homozygous;

[0017] The molecular marker I is located at the 3050 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3050 C>T, the base at this site is C or T, and the mutation type is C / C homozygous type or T / T homozygous type;

[0018] The molecular marker J is located at the 3053 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3053 G>C, the base at this site is C or G, and the mutation type is C / C homozygous type or G / G homozygous type;

[0019] The molecular marker K is located at the 3149 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3149 A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;

[0020] The molecular marker L is located at the 3185 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3185 G>A, the base at this site is A or G, and the mutation type is A / A homozygous type or G / G homozygous type;

[0021] The molecular marker M is located at the 3218 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3218 T>C, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous;

[0022] The molecular marker N is located at the 3227 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3227 A>T, the base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous;

[0023] The molecular marker O is located at the 3251 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3251 C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous;

[0024] The molecular marker P is located at the 3314 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3314 G>A, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;

[0025] The molecular marker Q is located at the 3323 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3323 C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous.

[0026] The nucleotide sequence described in Sequence 1 in the sequence listing is the nucleotide sequence of the heat shock protein HSP 90-alpha gene.

[0027] The application of the HSP90 gene molecular marker of whiteleg shrimp related to the cold-resistance trait is to use the HSP90 gene molecular marker of whiteleg shrimp for the selective breeding of whiteleg shrimp, specifically, first extracting the genomic DNA of the muscle tissue of the whiteleg shrimp to be tested, then using the obtained genomic DNA as a template DNA for PCR amplification to obtain an amplification product, purifying the amplification product and sequencing the product to determine the genotypes of the molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, molecular marker L, molecular marker M, molecular marker N, molecular marker O, molecular marker P and molecular marker Q;

[0028] When the genotype of molecular marker A is the AA genotype of the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker B is the CC or CG genotype of the inferior genotype, avoid selecting the individual as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker C is the GG genotype of the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker D is the AA genotype of the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker E is the GG genotype of the dominant genotype, the individual is selected as When the genotype of the molecular marker F is the CC or CT genotype of the inferior genotype, avoid selecting the individual as the reserve parent for white shrimp breeding; when the genotype of the molecular marker G is the AG or GG genotype of the inferior genotype, avoid selecting the individual as the reserve parent for white shrimp breeding; when the genotype of the molecular marker H is the CT or TT genotype of the inferior genotype, avoid selecting the individual as the reserve parent for white shrimp breeding; when the genotype of the molecular marker I is the TT genotype of the dominant genotype, select the individual as the reserve parent for white shrimp breeding; when the molecular marker J When the genotype of the molecular marker is the CC genotype of the dominant genotype, the individual is selected as the reserve parent for white shrimp variety breeding; when the genotype of the molecular marker K is the AG or GG genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding; when the genotype of the molecular marker L is the AA or AG genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding; when the genotype of the molecular marker M is the CC or CT genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding. species; when the genotype of the molecular marker N is the AA genotype of the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of the molecular marker O is the CT or TT genotype of the inferior genotype, avoid selecting the individual as the reserve parent for whiteleg shrimp variety breeding; when the genotype of the molecular marker P is the AA or AG genotype of the inferior genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of the molecular marker Q is the CT or TT genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding.

[0029] The present invention extracts DNA from the appendage muscle tissue of the white shrimp, which will not have much impact on the shrimp body. Breeding can be carried out by molecular assisted breeding, such as using gene knockout or gene editing methods to process molecular markers to obtain varieties.

[0030] During the PCR amplification process, the primer set used to detect the HSP90 gene molecular marker of the white shrimp includes a primer F and a primer R, the sequence of the primer F is gaagtctcagacgacgaggaagaag (sequence 2 in the sequence list), and the sequence of the primer R is cttgcacaggttctcgaacttggtc (sequence 3 in the sequence list).

[0031] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasterMix, 1 μL of 100 ng / μL template DNA, 2 μL of 10 μmol / L primer F, 2 μL of 10 μmol / L primer R, 20 μL of ddH 2 O.

[0032] The reaction procedure of the PCR amplification comprises the following steps:

[0033] S1, pre-denaturation at 94°C for 3 min;

[0034] S2, denaturation at 94°C for 30 s, annealing at 61°C for 30 s, and extension at 72°C for 45 s for 35 cycles;

[0035] S3. Extend at 72°C for 10 min.

[0036] Compared with the prior art, this technical solution has the following beneficial effects:

[0037] The present invention finds that HSP90 is significantly correlated with the cold resistance trait in Penaeus vannamei. Therefore, based on the analysis and screening of the heat shock protein HSP 90-alpha gene of Penaeus vannamei, a SNP molecular marker closely related to the cold resistance trait of Penaeus vannamei is obtained. The SNP molecular marker has the characteristics of high accuracy and suitability for breeding, and can be applied to the breeding of new cold-resistant varieties of Penaeus vannamei, and can be used to quickly and accurately identify and breed Penaeus vannamei with cold-resistant traits, which is beneficial to promoting the research and application of cold-resistant and stress-resistant aquaculture of Penaeus vannamei, and improving aquaculture efficiency and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1It is a partial fragment sequence of the product obtained by amplifying the heat shock protein HSP 90-alpha gene in the embodiment, wherein a represents the 90th to 96th positions, wherein the AA and GG peak graphs of the D.2489 G>A site are shown; b represents the 174th to 180th positions, wherein the CC, CG, and GG peak graphs of the D.2573 G>C site are shown; c represents the 318th to 324th positions, wherein the GG, GT, and TT peak graphs of the D.2717 G>T site are shown; d represents the 546th to 552nd positions, wherein the AA, AG, and GG peak graphs of the D.2945 A>G site are shown; e represents the 570th to 576th positions, wherein the AA, AG, and GG peak graphs of the D.2969 G>A site are shown; f represents the 585th to 591st positions, wherein the CC, CT, and TT peak graphs of the D.2984 T>C site are shown.

[0039] Figure 2 It is a partial fragment sequence of the product obtained by amplifying the heat shock protein HSP 90-alpha gene in the embodiment, wherein g represents the 633rd to 639th positions, wherein the AA, AG, and GG peak graphs of the D.3032 A>G site are displayed; h represents the 645th to 651st positions, wherein the CC, CT, and TT peak graphs of the D.3044 C>T site are displayed; i represents the 650th to 656th positions, wherein the CC and TT peak graphs of the D.3050 C>T site are displayed; j represents the 655th to 661st positions, wherein the CC and GG peak graphs of the D.3053G>C site are displayed; k represents the 750th to 756th positions, wherein the AA, AG, and GG peak graphs of the D.3149 A>G site are displayed; l represents the 786th to 792nd positions, wherein the AA and GG peak graphs of the D.3185 G>A site are displayed.

[0040] Figure 3 It is a partial fragment sequence of the product obtained by amplifying the heat shock protein HSP 90-alpha gene in the embodiment, wherein m represents the 819th to 825th positions, in which the CC, CT, and TT peak graphs of the D.3218 T>C site are displayed; n represents the 828th to 834th positions, in which the AA, AT, and TT peak graphs of the D.3227 A>T site are displayed; o represents the 852nd to 858th positions, in which the CC, CT, and TT peak graphs of the D.3251 C>T site are displayed; p represents the 915th to 821st positions, in which the AA, AG, and GG peak graphs of the D.3314 G>A site are displayed; q represents the 924th to 930th positions, in which the CC, CT, and TT peak graphs of the D.3323 C>T site are displayed. DETAILED DESCRIPTION

[0041] The present invention is further described by the following examples, but is not intended to be limiting of the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods commonly known to those skilled in the art.

[0042] Embodiment: The screening process of the molecular marker of the HSP90 gene of Penaeus vannamei related to the cold-resistance trait of the present invention is as follows:

[0043] (1) 120 whiteleg shrimps weighing about 3 grams were selected and temporarily cultured for 2 days. Then, a cold tolerance experiment was conducted at 9.5-10.5℃ as the stress condition. The 40 shrimps that died first were regarded as the low-temperature sensitive group, and the 40 shrimps that survived at the end were regarded as the low-temperature tolerance group.

[0044] (2) Five white shrimps were randomly selected from the low-temperature sensitive group and the low-temperature tolerant group, muscle tissue was extracted, and genomic DNA was extracted using the conventional phenol-imide extraction method. The obtained genomic DNA was stored at -20 °C for later use;

[0045] (3) Primers F and R were designed based on the nucleotide sequence of the heat shock protein HSP 90-alpha gene of white shrimp, and then the SNP sites located in the heat shock protein HSP 90-alpha gene were amplified and screened;

[0046] The sequence of the primer F is: gaagtctcagacgacgaggaagaag;

[0047] The sequence of the primer R is: cttgcacaggttctcgaacttggtc;

[0048] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasterMix, 1 μL of 100 ng / μL template DNA, 2 μL of 10 μmol / L primer F, 2 μL of 10 μmol / L primer R, 20 μL of ddH 2 O;

[0049] The reaction procedure of the PCR amplification comprises the following steps:

[0050] S1, pre-denaturation at 94°C for 3 min;

[0051] S2, denaturation at 94°C for 30 s, annealing at 61°C for 30 s, and extension at 72°C for 45 s for 35 cycles;

[0052] S3, extension at 72°C for 10 min;

[0053] (4) The PCR amplification product was purified and sequenced after 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak analysis, to screen out related SNPs sites; the sequence of the PCR amplification product of one sample is shown below:

[0054]

[0055] Among them, the 93rd bit is D.2489 G>A, the 177th bit is D.2573 G>C, the 321st bit is D.2717 G>T, the 549th bit is recorded as D.2945 A>G, the 573rd bit is D.2969 G>A, the 588th bit is D.2984 T>C, the 636th bit is D.3032 A>G, the 648th bit is D.3044 C>T, the 654th bit is recorded as D.3050 C>T, the 657th bit is D.3053 G>C, the 753rd bit is D.3149 A>G, the 789th bit is D.3185 G>A, the 822nd bit is D.3218 T>C, the 831st bit is recorded as D.3227 A>T, and the 855th bit is D.3251 C>T, the 918th position is D.3314 G>A, and the 927th position is D.3323 C>T;

[0056] (5) Based on the selected SNPs, the white shrimp in the sensitive group and the tolerant group were tested and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The results of chi-square analysis are shown in Tables 1 to 3.

[0057] According to the analysis in Table 1, the genotype polymorphism of each molecular marker locus has a significant effect on the cold resistance trait of white shrimp: the dominant individual of cold resistance trait of molecular marker A is AA genotype; the inferior individual of cold resistance trait of molecular marker B is CC and CG genotype; the dominant individual of cold resistance trait of molecular marker C is GG genotype; the dominant individual of cold resistance trait of molecular marker D is AA genotype; the dominant individual of cold resistance trait of molecular marker E is GG genotype; the inferior individual of cold resistance trait of molecular marker F is CC and CT genotype; the inferior individual of cold resistance trait of molecular marker G is AG and GG genotype; the inferior individual of cold resistance trait of molecular marker H is CT and TT genotype; the dominant individual of cold resistance trait of molecular marker I is TT genotype; molecular marker J The superior individual with cold-resistance trait of molecular marker is CC genotype; the inferior individual with cold-resistance trait of molecular marker K is AG and GG genotype; the inferior individual with cold-resistance trait of molecular marker L is AA and AG genotype; the inferior individual with cold-resistance trait of molecular marker M is CC and CT genotype; the superior individual with cold-resistance trait of molecular marker N is AA genotype; the inferior individual with cold-resistance trait of molecular marker O is CT and TT genotype; the superior individual with cold-resistance trait of molecular marker P is AA and AG genotype; the superior individual with cold-resistance trait of molecular marker Q is CT and TT genotype.

[0058] Table 1 Results of chi-square analysis of some sites

[0059]

[0060] Table 2 Results of chi-square analysis of some sites

[0061]

[0062] Table 3 Chi-square analysis results of some sites

[0063]

[0064] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. An application of a molecular marker of the HSP90 gene of Penaeus vannamei related to cold-resistance traits, characterized in that: The HSP90 gene molecular markers of white shrimp include molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, molecular marker L, molecular marker M, molecular marker N, molecular marker O, molecular marker P and molecular marker Q; The molecular marker A is located at the 2489 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2489G>A, the base at this site is A or G, and the mutation type is A / A homozygous type or G / G homozygous type; The molecular marker B is located at the 2573 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2573G>C, the base at this site is C or G, and the mutation types are C / C homozygous, C / G heterozygous, and G / G homozygous; The molecular marker C is located at the 2717 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2717G>T, the base at this site is G or T, and the mutation types are G / G homozygous, G / T heterozygous, and T / T homozygous; The molecular marker D is located at the 2945 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2945A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker E is located at the 2969 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2969G>A, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker F is located at the 2984 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.2984T>C, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker G is located at the 3032 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3032A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker H is located at the 3044 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3044C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker I is located at the 3050 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3050C>T, the base at this site is C or T, and the mutation type is C / C homozygous type or T / T homozygous type; The molecular marker J is located at the 3053 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3053G>C, the base at this site is C or G, and the mutation type is C / C homozygous type or G / G homozygous type; The molecular marker K is located at the 3149 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3149A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker L is located at the 3185 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3185G>A, the base at this site is A or G, and the mutation type is A / A homozygous type or G / G homozygous type; The molecular marker M is located at the 3218 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3218T>C, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker N is located at the 3227 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3227A>T, the base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous; The molecular marker O is located at the 3251 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3251C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker P is located at the 3314 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3314G>A, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker Q is located at the 3323 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.3323C>T, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The vannamei HSP90 gene molecular marker is used for selective breeding of vannamei shrimp, specifically, the genomic DNA of the muscle tissue of the vannamei shrimp to be tested is first extracted, and then the obtained genomic DNA is used as a template DNA for PCR amplification to obtain an amplification product, and the amplification product is purified and then sequenced to determine the genotypes of the site A, site B, site C, site D, site E, site F, site G, site H, site I, site J, site K, site L, site M, site N, site O, site P and site Q; When the genotype of site A is the dominant genotype of AA genotype, select the individual as a reserve parent for white shrimp variety breeding; when the genotype of site B is the inferior genotype of CC or CG genotype, avoid selecting the individual as a reserve parent for white shrimp variety breeding; when the genotype of site C is the dominant genotype of GG genotype, select the individual as a reserve parent for white shrimp variety breeding; when the genotype of site D is the dominant genotype of AA genotype, select the individual as a reserve parent for white shrimp variety breeding; when the genotype of site E is When the genotype of the locus is the dominant genotype of GG, the individual is selected as the reserve parent for white shrimp variety breeding; when the genotype of the locus F is the inferior genotype of CC or CT, avoid selecting the individual as the reserve parent for white shrimp variety breeding; when the genotype of the locus G is the inferior genotype of AG or GG, avoid selecting the individual as the reserve parent for white shrimp variety breeding; when the genotype of the locus H is the inferior genotype of CT or TT, avoid selecting the individual as the reserve parent for white shrimp variety breeding; when the genotype of the locus I is the dominant genotype of TT, select the individual as the reserve parent for white shrimp variety breeding; when the genotype of the locus J is the dominant genotype of TT, select the individual as the reserve parent for white shrimp variety breeding; When the genotype of the locus is the CC genotype of the dominant genotype, the individual is selected as the reserve parent for white shrimp variety breeding; when the genotype of the locus K is the AG or GG genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding; when the genotype of the locus L is the AA or AG genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding; when the genotype of the locus M is the CC or CT genotype of the inferior genotype, the individual is avoided from being selected as the reserve parent for white shrimp variety breeding. Breeding; when the genotype of site N is the dominant genotype of AA genotype, select the individual as the reserve parent for whiteleg shrimp variety breeding; when the genotype of site O is the inferior genotype of CT or TT genotype, avoid selecting the individual as the reserve parent for whiteleg shrimp variety breeding; when the genotype of site P is the inferior genotype of AA or AG genotype, select the individual as the reserve parent for whiteleg shrimp variety breeding; when the genotype of site Q is the CT or TT genotype, select the individual as the reserve parent for whiteleg shrimp variety breeding.

2. The use of the HSP90 gene molecular marker related to the cold-resistance trait of Penaeus vannamei according to claim 1, characterized in that: In the PCR amplification process, the primer set used to detect the HSP90 gene molecular marker of the white shrimp includes a primer F and a primer R, the sequence of the primer F is gaagtctcagacgacgaggaagaag, and the sequence of the primer R is cttgcacaggttctcgaacttggtc.

3. The use of the HSP90 gene molecular marker related to the cold-resistance trait of Penaeus vannamei according to claim 2, characterized in that: The PCR amplification system consisted of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.

4. The use of the HSP90 gene molecular marker related to the cold-resistance trait of Penaeus vannamei according to claim 1, characterized in that: The reaction procedure of the PCR amplification comprises the following steps: S1, pre-denaturation at 94°C for 3 min; S2, denaturation at 94°C for 30 s, annealing at 61°C for 30 s, and extension at 72°C for 45 s for 35 cycles; S3. Extend at 72°C for 10 min.

Images