Citrus csap2-16 gene and application thereof in promoting fruit ripening

By cloning the CsAP2-16 gene from sweet orange and introducing it into tomatoes and kumquats, the problem of uneven fruit ripening in citrus fruits was solved, and the fruit ripening period was significantly advanced, providing genetic resources for citrus breeding.

CN118308374BActive Publication Date: 2025-11-28HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410579631.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-10
Publication Date
2025-11-28
Estimated Expiration
2044-05-10

AI Technical Summary

Technical Problem

The uneven ripening period of citrus fruits leads to an imbalance in market supply, affecting planting efficiency. Existing breeding methods are inefficient and difficult to effectively regulate the ripening period of fruits.

Method used

The CsAP2-16 gene was isolated and cloned from sweet orange, and then introduced into tomatoes and kumquats using Agrobacterium-mediated genetic transformation to achieve overexpression of the CsAP2-16 gene and promote fruit ripening.

Benefits of technology

Overexpression of the CsAP2-16 gene significantly promoted fruit ripening, advancing the color breaking of tomato fruit by 15 days and accelerating the ripening process of kumquat fruit, providing genetic resources for molecular design breeding of citrus ripening period.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004833493090000011
    Figure HDA0004833493090000011
  • Figure HDA0004833493090000012
    Figure HDA0004833493090000012
Patent Text Reader

Abstract

The application discloses a citrus transcription factor gene and application thereof in promoting fruit ripening CsAP2-16 . The gene belongs to an AP2 / ERF family member, the CDS sequence of which is shown as SEQ ID NO. 1, the CDS sequence length is 1290 bp, 429 amino acids are encoded, and the amino acid encoded is shown as SEQ ID NO. 2. A primer is designed to amplify the gene from Fengjie navel orange CsAP2-16 . The gene is introduced into Mic-Tom tomato and golden orange by using an agrobacterium-mediated genetic transformation method, and the obtained transgenic plants are verified by phenotype observation statistics and gene expression analysis, and it is shown that the cloned gene has the function of significantly promoting citrus fruit ripening. CsAP2- 16 The application provides a new gene resource for molecular design breeding of fruit ripening.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a gene related to citrus fruit ripening isolated and cloned from sweet orange (Citrus sinensis Osbeck) Citrus sinensis CsAP2-16 The present application also relates to the application of the gene in promoting fruit ripening, and to a transgenic plant obtained by introducing the gene into a plant, which has a fruit ripening earlier than that of a wild type. BACKGROUND

[0002] Citrus is a kind of evergreen fruit tree (except for Citrus aurantium) in Aurantioideae of Rutaceae, which contains 33 genera and more than 200 species, and is one of the most important fruit tree crops in the world. 90% of citrus in China is used for fresh consumption. At present, the ripening period of citrus in China mainly concentrates from November to February of the next year, and there are still relatively few early-ripening and late-ripening high-quality citrus varieties, which is still far from the balanced supply of fresh fruits throughout the year. This unbalanced market supply still cannot meet the demand of consumers for fresh fruits, especially during the period of concentrated marketing of citrus, and the problem of difficulty in selling fruits still occurs from time to time, which easily causes structural overproduction in the market and greatly affects the planting benefits of citrus. Therefore, it is of great significance to analyze the mechanism of regulation of citrus fruit ripening and to excavate the genes for regulating ripening period, so as to promote the breeding of new varieties of different ripening periods of citrus and the improvement of the ripening structure of the citrus industry.

[0003] Fruit ripening is a complex process, mainly reflected in the changes in color, texture, aroma, sugar-acid ratio, hormone level, etc. Fruit ripening is a process regulated by a large number of factors, in addition to environmental factors such as temperature, light, and water, the core is still the internal gene regulatory network. With the development of sequencing technology and bioinformatics, the genomes of a large number of important crops have been gradually deciphered, and the mechanism of transcription factors has also gradually increased. As an important gene expression regulatory element, transcription factors play a crucial role in regulating all factors of fruit ripening. In the process of fruit ripening, various transcription factors are found to participate in the regulation process, and different transcription factors have different expression amounts and different regulation directions in different development and ripening periods of fruits. Studies have shown that CsMYB77 by inhibiting the expression of downstream genes SINAT4 to regulate abscisic acid (ABA) signal, while activating the expression of downstream genes PIN5 to regulate auxin signal, thereby delaying fruit ripening (Zhang et al., 2023); CrNAC036 and CrMYB68 by regulating the expression of CrNCED5 to synergistically inhibit the biosynthesis of ABA in citrus fruits, thereby controlling fruit ripening (Zhu et al., 2020); in the study of the ripening mechanism of Carica papaya, it was found that​CpMYB1 and CpMYB2 It may play a role in the process of fruit softening and carotenoid accumulation in papaya by regulating cell wall degradation and carotenoid biosynthesis-related genes (Fu et al., 2020); in tomato, the promoter activity of SlbHLH95 is regulated in vivo by RIN , and inhibition of SlbHLH95 can reduce the sensitivity of fruits to ethylene, reduce the accumulation of carotenoids, reduce the content of glutathione, and inhibit the expression of fruit ripening-related genes and glutathione metabolism-related genes (Zhang et al., 2020).

[0004] The AP2 / ERF family is one of the largest families of transcription factors in plants, and plays an important role in the growth and development of plants. AP2 / ERF transcription factors have a binding domain composed of about 60 amino acids, which can directly bind to the promoter of target genes (Okamuro et al., 1997). In Arabidopsis, the AP2 / ERF family is preliminarily divided into four subfamilies: dehydration response element binding proteins (DREB), ethylene response element binding proteins (ERF), AP2, and RAV (Feng et al., 2005). All members of the AP2 / ERF family contain at least one DNA binding domain, called the AP2 domain (Magnani et al., 2004). AP2 / ERF transcription factors play an important role in fruit ripening. In persimmon, DkERF8 and DkERF18 promote the conversion of persimmon fruit acid-soluble pectin to water-soluble pectin and ethylene release, increase fruit softening speed, and promote fruit ripening (He Yiheng 2020); in tomato, SIERF6 inhibit the synthesis of carotenoids and ethylene, revealing the role of SIERF6 in the process of fruit ripening (Lee et al., 2012); in apple, MdERF3 have a negative impact on ethylene biosynthesis and fruit ripening by inhibiting the transcription of MdACS1 (Li et al., 2016).

[0005] Due to the long childhood of citrus, the efficiency of conventional breeding methods is low, so using molecular techniques to improve the ripening period of citrus has become an important breeding method. Through the analysis of the expression pattern of the AP2 / ERF family in Fengjie '72-1' navel orange, the CsAP2-16 gene was screened. On this basis, the vector of CsAP2-16 was constructed and genetically transformed to verify the function of CsAP2-16 in the process of fruit ripening, which has important research significance and application value for analyzing the molecular mechanism of regulating citrus fruit ripening and the development of citrus industry. SUMMARY

[0006] The application aims to provide a citrus fruit ripening related gene CsAP2-16 , the CDS sequence of which is shown as SEQ ID NO. 1, and the primers for amplifying the cDNA sequence are shown as SEQ ID NO. 3 and 4. CsAP2-16 The gene encodes 429 amino acids, and the amino acid sequence is shown as SEQ ID NO. 2.

[0007] Another object of the application is to provide the application of the citrus fruit ripening related gene CsAP2-16 in promoting fruit ripening, the above gene is transformed into tomatoes and kumquats by means of Agrobacterium-mediated genetic transformation, and the transgenic plants obtained are verified by phenotype observation statistics and gene expression analysis, and it is shown that CsAP2-16 the fruit breakage of the gene overexpression tomato strain and the kumquat strain is obviously earlier than that of the wild type, the average time of fruit breakage of the T2 generation overexpression tomato strain is 28 days, which is 15 days earlier than that of the wild type, and it is shown that the gene identified in the application has the function of promoting fruit ripening. CsAP2-16

[0008] Compared with the prior art, the application has the following technical effects and advantages:

[0009] The application uses gene cloning technology to separate and clone the citrus fruit ripening gene CsAP2-16 from Fengjie navel oranges, the gene is transformed into tomatoes and kumquats by means of Agrobacterium-mediated genetic transformation, and it is identified that the gene has the function of significantly promoting fruit ripening, thereby providing excellent gene resources for citrus ripening molecular design breeding. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 It is a flowchart for cloning, separation and function verification of the citrus fruit ripening gene CsAP2-16 in the application.

[0011] Figure 2 It is a subcellular localization result of the citrus fruit ripening gene CsAP2-16 in the embodiment 2 of the application.

[0012] Figure 3 It is a gene transcription activation activity identification result in the embodiment 3 of the application. CsAP2-16

[0013] Figure 4 It is a gene genetic transformation Mic-Tom tomato and regeneration process diagram in the embodiment 4 of the application. CsAP2-16

[0014] Figure 5 It is a DNA positive identification gel map of the tomato transgenic positive seedling in the embodiment 4 of the application.​​​

[0015] Figure 6 Gene quantitative detection results of tomato transgenic positive seedlings in Example 4 of the present application CsAP2-16 Gene quantitative detection results of tomato transgenic positive seedlings in Example 4 of the present application

[0016] Figure 7 Color change of tomato fruits and fruit breakage days of the fruits of the tomato plants overexpressing the gene in Example 4 of the present application CsAP2-16 Color change of tomato fruits and fruit breakage days of the fruits of the tomato plants overexpressing the gene in Example 4 of the present application

[0017] Figure 8 Expression amount of the gene in the transformed fruits of the Citrus grandis in Example 5 of the present application CsAP2-16 Expression amount of the gene in the transformed fruits of the Citrus grandis in Example 5 of the present application CsAP2-16 Expression amount of the gene in the transformed fruits of the Citrus grandis in Example 5 of the present application CsAP2-16 Expression amount of the gene in the transformed fruits of the Citrus grandis in Example 5 of the present application

[0018] Figure 9 Phenotype observation of the Citrus grandis after transient transformation and carotenoid and chlorophyll contents of the fruits of the transiently transformed Citrus grandis and the control group in Example 5 of the present application CsAP2-16 Phenotype observation of the Citrus grandis after transient transformation and carotenoid and chlorophyll contents of the fruits of the transiently transformed Citrus grandis and the control group in Example 5 of the present application DETAILED DESCRIPTION

[0019] The technical solutions of the present application are further explained and described in detail in combination with the examples below: the examples are implemented on the premise of the technical solutions of the present application, and based on the following description and examples, the basic features of the present application can be determined by the person skilled in the art, and various changes and modifications can be made to the present application without departing from the spirit and scope of the present application, so as to make the present application applicable to various purposes and conditions.

[0020] Example 1: Cloning of the full-length cDNA of the citrus fruit development and maturation gene CsAP2-16 CsAP2-16 Cloning of the full-length cDNA of the citrus fruit development and maturation gene CsAP2-16

[0021] The CDS sequence of the gene was obtained from the sweet orange genome database (http: / / citrus.hzau.edu.cn / orange / ), and primers were designed in the 5' non-coding region and the 3' non-coding region of the sequence, wherein the forward primer was CsAP2-16F1: 5'-AAAAAGCAGGCTCCATGATGGCGTCTTCTTCATCG-3', and the reverse primer was CsAP2-16-R1: 5'-AGAAAGCTGGGTTTCACTCCTCTGGCCGAAAG-3'. Then, the wild-type Fengjie navel orange cDNA was used as a template, and a high-fidelity enzyme was used for amplification reaction, and the kit was Phanta Max Super-Fidelity DNA Polymerase.

[0022] Take wild type Fengjie navel orange leaves frozen at -80℃, use Novozyme RNA reagent FastPure Plant Total RNA Isolation kit to extract RNA, and the specific RNA extraction method is as follows:

[0023] 1) Take an appropriate amount of plant tissue ground with liquid nitrogen and immediately add 600 μl Buffer EL or 600 μl Buffer PSL, vortex vigorously for 30 sec to mix the sample and lysis solution evenly, centrifuge at 12,000 rpm (13,400 × g) for 5 min, and immediately proceed to the next step;

[0024] 2) Take about 500 μl of supernatant to FastPure gDNA-Filter Columns III (FastPure gDNA-Filter Columns III has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 sec, discard the FastPure gDNA-Filter Columns III, and collect the filtrate;

[0025] 3) Add 0.5 times the volume of anhydrous ethanol (about 250 μl, adjust according to the actual situation of the supernatant) to the collection tube, shake and mix for 15 sec;

[0026] 4) Transfer the above mixture to FastPure RNA Columns V (FastPure RNA Columns V has been placed in the collection tube), centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate;

[0027] 5) Add 700 μl Buffer RWA to FastPure RNA Columns V, centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate;

[0028] 6) Add 500 μl Buffer RWB (check whether 48 ml of anhydrous ethanol has been added before use) to FastPure RNA Columns V, centrifuge at 12,000 rpm (13,400 × g) for 30 sec, and discard the filtrate;

[0029] 7) Repeat step 6;

[0030] 8) Place FastPure RNA Columns V back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 min;

[0031] 9) Transfer the FastPure RNA Columns V to new RNase-free Collection Tubes 1.5ml centrifuge tubes, and add 30 - 100 μl of RNase-free ddH2O to the center of the membrane of the adsorption column, and centrifuge at 12,000 rpm (13,400 x g) for 1 min;

[0032] 10) The extracted RNA can be directly used for downstream experiments or stored at -85 ~ -65℃.

[0033] The cDNA was synthesized by reverse transcription using the RNA of Fengjie navel orange as a template. The synthesis of cDNA was performed by RNA reverse transcription using the reverse transcription kit Hiscript III RT SuperMix for qPCR. The specific operation steps of the synthesis method were performed according to the instructions. The obtained cDNA was used for CsAP2-16 PCR amplification of the gene. The above designed CsAP2-16-F1 and CsAP2-16-R1 were used as primers for PCR amplification. The detailed steps of PCR amplification were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles, and 72℃ extension for 5 min after the completion of the cycle. After the completion of amplification, a single band of PCR product was generated, which was purified and recovered by Omega gel recovery kit after 1% agarose gel electrophoresis. The purified product was ligated with the entry vector pDOR221, and the total reaction system volume was 10 μl. After incubation at room temperature for 5 min, the E. coli competent cells DH5α were transformed. Then, the bacterial liquid PCR positive identification was performed with the gene sequence primers (the primers here refer to CsAP2-16-F1 and CsAP2-16-R1), and the company was sequenced. Finally, according to the sequencing results, the single clone bacterial liquid with correct sequence was selected, the plasmid was extracted by Kang Weishiji CWO500M, and then was ligated with the final vector pK7WG2D. The ligation product was transformed into Agrobacterium GV3101. The plasmid contains the CDS sequence of the gene CsAP2-16 , the nucleotide sequence of which is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

[0034] CsAP2-16The CDS sequence length of the gene is 1290 bp, which includes a coding reading frame that can encode 429 amino acids, and the isoelectric point is 9.07. After MEGAX analysis (https: / / www.megasoftware.net) of the sequence and the evolutionary relationship of the AP2 / ERF family in Arabidopsis thaliana, it was found that it belongs to the AP2 subfamily, and according to the arrangement order of the CsAP2 subfamily on the chromosome, it was named CsAP2-16. CsAP2-16 .

[0035] Example 2: CsAP2-16 Subcellular localization of the gene

[0036] PRI101-GFP vector construction CsAP2-16 The gene localization vector was constructed. According to the gene sequence, the primers were designed, and according to the multiple cloning sites of the PRI101-GFP vector, the SaII / KPnI enzyme cutting sites were added to the primers in the forward and reverse directions, respectively. The CDS without stop codon was fused to the PRI101-GFP vector to construct the fusion protein CsAP2-16:GFP. The recombinant plasmid bacterial liquid was identified by PCR. The recombinant plasmid and the empty plasmid were respectively transferred into the Agrobacterium strain GV3101, and then transferred into the lower epidermis cells of Nicotiana benthamiana for transient expression.

[0037] Agrobacterium infection of tobacco epidermis was performed as follows:

[0038] 1) Bacterial activation: take the Agrobacterium GV3101 liquid containing recombinant plasmid and empty vector PRI101-GFP plasmid stored at -80℃, streak in LB (containing 25 mg / L Kana), and culture at 28℃ for 2 d to activate the bacterial cells;

[0039] 2) Small shaking of bacterial liquid: pick single colonies in 5 ml LB liquid medium, shake at 28℃, 220 r / min for 24 h;

[0040] 3) Large shaking of bacterial liquid: on the experimental day, take 300 μl of small shaking bacterial liquid and add it to a conical flask containing 30 ml of fresh liquid LB, shake at 28℃, 220 r / min for about 10 h, until the OD value of the bacterial liquid is 0.7; 600

[0041] 4) Bacterial cell collection: after large shaking, the bacterial liquid was loaded into a 50 ml sterile centrifuge tube and centrifuged at 4000 r / min for 5 min to remove the liquid and make it flow out;

[0042] ​5) Washing of bacterial cells: 10 ml washing solution (10 mM MES, 10 mM MgCl2, prepared fresh) was added to the bacterial cells, which were well suspended, and centrifuged at 4000 r / min for 5 min, and the supernatant was discarded. 5 ml washing solution was added again for washing, and then the bacterial cells were dissolved in 3 ml washing solution;

[0043] 6) OD value of suspended bacterial solution 600 Value determination: the suspended bacterial solution was diluted 20 times (for example: 150 μl of suspended solution + 2850 μl of washing solution), so that the OD value of the bacterial solution was 0.05, and 8 μl of acetyl-syringone (50 mg / ml) was added to 8 ml of washing solution, and mixed well, and incubated in a 30℃ incubator for 3 h; 600 The ratio was 0.7:0.5, 8 μl of acetyl-syringone (50 mg / ml) was added to 8 ml of washing solution, and mixed well, and incubated in a 30℃ incubator for 3 h;

[0044] 7) Injection of tobacco leaves: 3 tobacco plants with consistent growth and no disease were selected for injection, and 2 leaves of each plant were injected. When injecting, the back of the leaf (the back of the leaf has more stomata, and it is easier to inject the bacterial solution);

[0045] 8) Cultivation and observation: after 24 h, fluorescence observation was performed by laser confocal.

[0046] The results are shown in Figure 2 The fluorescence of the fusion protein of CsAP2-16:GFP after recombination only appeared in the nucleus, while the fluorescence of the empty vector was distributed in the whole cell tissue. The results show that CsAP2-16 the gene is located in the nucleus, and is a nuclear localization protein.

[0047] Example 3: CsAP2-16 Gene transcription activation analysis

[0048] Transcription activation activity is a basic feature of transcription factors. Here, we used the pGBKT7 vector to recombine and construct, to verify CsAP2-16Whether it has transcription activation activity. According to the gene sequence, specific primers are designed, and according to the sequence information of the pGBKT7 vector, EcoRI / SmaI enzyme digestion sites are added to the forward and reverse primers, respectively, the full-length CDS region of the gene is amplified, and is connected to the pGBKT7 vector to construct a recombinant plasmid, and a fusion expression vector pGBKT7-CsAP2-16 is obtained. After sequencing to confirm that the sequence is correct, the fusion expression vector and the empty vector (pGBKT7) are respectively transferred into the same yeast strain AH109 (purchased from Kangwei Century). Finally, the positive identification of the bacterial liquid is respectively uniformly coated on SD / -Trp, SD / -Trp-His, SD / -Trp-His-Ade and SD / -Trp-His-Ade-Leu four kinds of incomplete solid culture medium, and the survival of the transformants is detected by culturing on different deficient culture media. The results show that the yeast cells transformed by the empty vector can only grow on the deficient culture medium SD / -Trp, and the yeast transformed by the recombinant plasmid pGBKT7-CsAP2-16 cannot grow on the incomplete culture medium Figure 3 , which shows that the transcription factor CsAP2-16 cannot bind to GAL4-BD, cannot activate the transcription of the downstream reporter gene, and the yeast cannot grow normally on the incomplete culture medium, that is CsAP2-16 without transcription activation function.

[0049] Example 4: Overexpression of genes in tomato CsAP2-16

[0050] 1. Construction of plant transformation overexpression vector

[0051] A binary expression vector is constructed using the Gateway system, and the wild type Fengjie navel orange cDNA is used as a template, and the primers are designed as follows:

[0052] F1: 5'- AAAAAGCAGGCTCCATGATGGCGTCTTCTTCATCG -3'

[0053] R1: 5'- AGAAAGCTGGGTTTCACTCCTCTGGCCGAAAG -3'.

[0054] The synthesized cDNA by reverse transcription is used for CsAP2-16PCR amplification of the gene, after amplification to produce a single band of PCR product, 1% agarose gel electrophoresis, the amplified gel product was purified and recovered by Omega gel recovery kit, the product was subjected to BP reaction with the entry vector pDOR221, and then transformed into DH5a E. coli. The next day, the positive clones were selected and cultured in LB liquid medium containing kanamycin (Kan) antibiotic resistance, and the positive clones were detected and sequenced. After the correct sequencing result, the ligation product was transformed into E. coli competent cells DH5a, and the positive strain was subjected to plasmid extraction by Kangweishiji CWO500M, and the overexpression vector pK7WG2D- CsAP2-16 was constructed.

[0055] 2. Genetic transformation of tomato

[0056] Tomato is a good material for gene function verification in scientific research due to its short growth cycle and easy transformation. Mic-Tom is a dwarf plant, which is smaller than ordinary tomato and is easy to plant and manage at high density. The steps of Agrobacterium-mediated tomato genetic transformation are as follows:

[0057] 2.1 Inoculation

[0058] 1) Select seeds with full grains, soak in tap water for 1-2 hours;

[0059] 2) 75% ethanol disinfection treatment of seeds for 1 min (continuous stirring);

[0060] 3) 50% 84 disinfectant solution for 15 min;

[0061] 4) Wash with sterile water for 3 times, dry the seed surface with sterile filter paper, and evenly sow on S1 medium;

[0062] 5) 16 h light / 8 h dark culture room culture for about one week.

[0063] 2.2 Cotyledon cutting and Agrobacterium infection

[0064] 1) Strain activation and expansion: take Agrobacterium containing overexpression vector pK7WG2D- CsAP2-16 on LB (SPE resistant) solid medium, 28°C culture for 48 h; after activation, the bacteria were re-coated on new LB (SPE resistant) solid medium, and cultured at 28°C for 24 h;

[0065] 2) Sow for 6-10 days, and the tomato grows two cotyledons. Use a sterile scalpel to remove the leaf tip and the junction of the leaf and petiole, divide the middle section into two halves (about 0.4 cm long), and place the middle section with the back of the leaf facing up on S2 co-culture medium, 25±2°C dark culture for 24 h;

[0066] 3) Use a sterile blade to scrape the expanded Agrobacterium into 50 ml of Agrobacterium suspension, shake culture at 28°C for about 30 min to OD 600 0.2-0.6, and add 50 mg / L AS (acetyl-syringone) for standby;

[0067] 4) Take a sterile empty triangular flask, put the cotyledon pre-cultured in the medium into it, pour the prepared Agrobacterium suspension, shake for 5 min for infection;

[0068] 5) Pour off the suspension, dry the surface moisture of the cotyledon with sterile filter paper, and re-place it in S2 co-culture medium (the back of the leaf facing up), 25±2°C dark co-culture for 2 d.

[0069] 2.3 Screening culture

[0070] Transfer the leaf to S3 screening medium, inoculate the cotyledon pre-cultured for 48 h on S3 screening medium with the front facing up, make the cut fully contact with the medium, and culture at 25±2°C under light.

[0071] 2.4 Rooting culture

[0072] After about 7 days of culture, white callus will grow out of the edge of the tomato leaf, and after 12 days, transfer to S3 subculture medium, 10-14 days for callus to differentiate into bud points, and after 30 days or so, the bud grows into a growth point, then transfer to S4 rooting medium (at this time, positive identification can be made), and after about 7 days, rooting can be achieved.

[0073] Table 1 Tomato transformation seedling culture medium

[0074]

[0075] 3. Screening and identification of tomato transgenic positive seedlings

[0076] According to the above method, trans CsAP2-16 genic tomato plants are obtained, the plant leaves are taken to extract genomic DNA, and according to the 35S sequence and gene sequence on the vector, forward and reverse primers are designed for amplification to verify whether the exogenous target gene has been inserted into the genome of the transformed material.

[0077] 3.1 Tomato leaf DNA extraction

[0078] 1) Preparation of DNA buffer (1 L): 1 M Tris-HCl (pH 8.0) 100 mL; 0.5 M EDTA (pH 8.0) 100 mL; 5.0 M NaCl 300 mL; H2O 500 mL.

[0079] 1 M Tris-HCl (pH 8.0): Tris-Base 121 g, add 800 mL water, stir on a magnetic stirrer, add concentrated hydrochloric acid to adjust the pH to 8.0, then add water to 1000 mL, sterilize and store at room temperature. 0.5 M EDTA (pH 8.0): EDTA-Na2 salt 187 g, add about 800 mL water, stir on a magnetic stirrer, add solid NaOH, when EDTA and NaOH are completely dissolved, the pH of the solution is about 8.0, adjust with pH paper, sterilize and store at room temperature. 5 M NaCl: NaCl 300 g, add about 800 mL distilled water to a magnetic stirrer, stir well, stop stirring after about 5 min, stand for 2-3 min, pour off the supernatant, add another 100 mL distilled water and repeat the previous steps until the NaCl is completely dissolved, then add water to 1000 mL, sterilize and store at room temperature.

[0080] Phenol: chloroform: isopropyl alcohol (25:24:1) preparation: mix water-saturated phenol, chloroform, and isopropyl alcohol according to the volume ratio of 25:24:1, and store in a brown bottle; preparation of 70% anhydrous ethanol: mix anhydrous ethanol and water in a volume ratio of 7:3 for use.

[0081] The specific extraction steps are as follows:

[0082] 1) Weigh (0.64N x 1%) g PVP, (0.64N x 2%) g CTAB, and 0.64 x N mL DNA buffer to prepare 0.64 x N mL CTAB buffer solution into a 10 mL centrifuge tube, dissolve in a 65°C water bath (N refers to the sample number);

[0083] 2) Weigh about 0.1 g of sample into a 1.5 mL centrifuge tube, add liquid nitrogen and grind;

[0084] 3) Add 100 μL of β-mercaptoethanol (1%-4%) to the CTAB buffer solution;

[0085] 4) Add 640 μL of the above CTAB buffer mixture to each sample, shake up and down (or place on a vortex shaker to mix well);

[0086] 5) 65°C water bath for 60-90 min;

[0087] 6) Add 700 μL of phenol: chloroform: isopropyl alcohol (25:24:1), shake up and down for about 5 min, then centrifuge at 13000 rpm / min, 20°C for 8 min;

[0088] 7) Take 500 μL supernatant (yellow tip), add 60 μL 5M NaCl and 1 mL pre-cooled anhydrous ethanol, mix well, -20°C ice water bath for 30 min;

[0089] 8) 13000 rpm / min, 4°C, centrifuge for 6 min;

[0090] 9) Discard the supernatant, add 1 mL 70% anhydrous ethanol, -20°C for 2 h;

[0091] 10) 10000 rpm / min, 4°C, centrifuge for 5 min;

[0092] 11) Discard the supernatant, dry in a clean bench (not too dry);

[0093] 12) Add 100 μL TE, 1.5 μL 10 μM RNase enzyme to each centrifuge tube (operate in a clean bench);

[0094] 13) 37°C water bath overnight.

[0095] 3.2 DNA positive identification

[0096] Use specific primers 35S and gene reverse primers to identify positive plants. Among the selected transgenic lines, if a transgenic line can amplify a fragment of the expected size, it indicates that it is a positive transgenic line, and finally 8 positive plants are verified ( Figure 5 ).

[0097] 35S: 5'-GACGCACAATCCCACTAT-3'

[0098] CsAP2-16-R1: 5'-AGAAAGCTGGGTTTCACTCCTCTGGCCGAAAG-3'.

[0099] 4. Overexpression analysis of tomato transgenic positive seedlings

[0100] Extract the RNA of transgenic positive seedlings that survived transplanting (denoted as #1, #2, … #8 in turn) and reverse transcribe to synthesize cDNA (RNA extraction method is the same as in Example 1), dilute the cDNA obtained by reverse transcription 5 times with ddH2O as a template, and design the quantitative primers using an online website.

[0101] CsAP2-16 The quantitative primers are:

[0102] CsAP2-16-qPCR-F: 5'-TGAAGCTCACCTTTGGGATAAA-3'

[0103] CsAP2-16-qPCR-R: 5'-GGCATCTGGTATGGTTCAGTAG-3'.

[0104] Tomato Actin gene as a reference gene, its primer is:

[0105] SlActin-F: 5'-GTCCTCTTCCAGCCATCCAT-3'

[0106] SlActin-R: 5'-ACCACTGAGCACAATGTTACCG-3'

[0107] qRT-PCR method to identify the expression of the gene CsAP2-16 , can determine CsAP2-16 the expression of the gene in the positive transgenic tomato is relatively high Figure 6 ).

[0108] 5. Fruit phenotype observation of tomato transgenic positive seedlings

[0109] Peel color change means the beginning of maturity, which is often used to determine the starting time of fruit maturity. Phenotype observation was carried out on wild type (WT), and overexpression of CsAP2-16 Tomato, statistical analysis of the time required from full bloom to the beginning of fruit coloration, i.e. the number of days to break color. The results show that CsAP2-16 The fruit of the overexpression line breaks color earlier than the wild type (WT), and the fruit photo is as Figure 7 , the wild type fruit starts to color at about 43 DAF (Days after flowering), CsAP2-16 The fruit of the overexpression line starts to color at about 28 DAF. The results show that the number of days to break color of tomato fruit of the overexpression line is about 15 days earlier than that of the wild type (WT) CsAP2-16 ). Figure 7

[0110] Example 5: Overexpression and silencing of CsAP2-16 gene in kumquat

[0111] 1. VIGS silencing vector construction

[0112] The vectors used are pTRV1 and pTRV2. According to the characteristics of pTRV2 vector, EcoRI and Smal enzymes were selected as forward and reverse enzyme digestion sites, and the first 200 bp sequence of CsAP2-16 gene CDS was used as template to design primers, and wild type Fengjie navel orange cDNA was used as template to design primers as follows:

[0113] ​F2: 5'-GTGAGTAAGGTTACCGAATTCATGATGGCGTCTTCTTCATCG-3'

[0114] R2: 5'-TGCTCGACGACAAGACCCGGGCAAGGAGGCATCCTACTGATG-3'

[0115] After PCR amplification, the gel product obtained by amplification was purified and recovered by Omega glue recovery kit, and then the linearized pTRV2 vector after double enzyme digestion was homologously recombined with the gel recovery product. After homologous recombination, E. coli DH5a was transformed, and then the company sequencing was performed. The correct bacterial liquid plasmid was extracted, and the successfully constructed silencing vector was named pTRV2- CsAP2-16 . Finally, the agrobacterium GV3101 was transformed, and the positive verification correct bacterial liquid was stored in the-80℃ refrigerator in glycerol.

[0116] 2. Transient transformation of golden oranges

[0117] Agrobacterium liquid containing overexpression vector pK7WG2D- CsAP2-16 and empty pK7WG2D was activated for 2 d in LB (SPE) solid medium, and agrobacterium liquid containing silencing vector pTRV2- CsAP2-16 and empty pTRV2 was activated for 2 d in LB (Kan) fixed medium, and then secondary activation was performed for 1 d for subsequent genetic transformation. The detailed steps of agrobacterium-mediated transient transformation of golden oranges are as follows:

[0118] 1) For fruit injection, after washing once with suspension buffer, the target bacterial liquid was mixed with P19 auxiliary plasmid bacterial liquid. P19 belongs to gene silencing inhibitor, which can prevent post-transcriptional gene silencing of transgenic citrus fruits and promote high-level expression of target proteins, so that the OD 600 of the mixed bacterial liquid is 0.8.

[0119] 2) First, cut part of the syringe needle, leaving about 0.1-0.3 cm in length, and inject 0.4 mL of infection liquid into each fruit. The injection process needs to be slow and uniform, and the infection bacterial liquid can be seen with the naked eye to reach the site of the fruit subcutaneous layer. Mark the injection site with a marker pen for subsequent sampling. Suck the excess agrobacterium, and store the injected fruit at room temperature for 2 days and then bag it. After 5-15 days of infection, the gene expression, chlorophyll and carotenoid content are detected. CsAP2-16

[0120] ​Buffer formulation (10 ml): Glucose (0.05 g), MES (500 mM, 1 ml), Na3PO4 (20 mM, 1 ml), acetylsylgenone (1 M, 1 μl), and H2O (to a final volume of 10 ml). 1 M acetylsylgenone (AS): 0.0392 g AS dissolved in 0.2 mL DMSO, aliquoted into 10 μL containers and stored at -20°C; 20 mM Na3PO4: 0.17 g anhydrous Na3PO4 dissolved in 50 mL water and stored at 4°C; 500 mM MES: 4.88 g MES dissolved in 50 mL water and stored at 4°C.

[0121] 3. Identification of genes in kumquat-transformed fruits using qRT-PCR. CsAP2-16 expression level ( Figure 8 It can be seen that the expression level in the overexpression line kumquat fruit was significantly higher than that in the PK7 control, and the expression level in the silent line fruit was significantly lower than that in the TRV empty vector. Therefore, it can be concluded that... CsAP2-16 The gene was successfully and instantly converted into the fruit.

[0122] 4. Phenotypic observation of transgenic kumquat fruit

[0123] The results showed that the control group and the empty control group were statistically analyzed on the day of injection and five days later. CsAP2-16 Fruit color changes in gene overexpression lines and silent lines were studied. Results showed that the fruit color of the overexpression lines deteriorated faster than that of the wild type, while the fruit color of the silent lines deteriorated slower. After analyzing carotenoid and chlorophyll content, it was found that the carotenoid content in the silent lines was significantly lower than that in the unexpressed control, while the chlorophyll content was the opposite; the carotenoid content in the overexpression lines was significantly higher than that in the wild type, and the chlorophyll content was the opposite. Figure 9 ).

[0124] sequence list

[0125] <400> 1

[0126]

[0127] <400> 2

[0128] MMASSSSDPGLKHEVGSSSGCGGGGESSEAVIANDQLLLYRGLKKAKKERGCTAKERISRMPPCTAGKRSSIYRGVTRHRWTGRYEAHLWDKSTWNQNQNKKGKQVYLGAYDDEEAAARAYDLAALKYWGPGTLINFPVTDYTRDLEEMQNVSREDYLASLRRKSSGFSRGISKYRGLSSRWDSSLARMAGSEYFNNAHYGAADDPSTESEYLGGFCIDRKIDLTSYIKWWGPNKTRQADSAKKSLEDGKHAYAEDISSELKKSEWEIRPTEPYQMPRLGVSPGGKKHKGSAVSALSILSKSTAYKNFQEKALKKQDSNTDNDENENKNIVNKMDYGKAVEKSTGHDGRSERLGAALGMTGGLSLQRNAFPLAPFLSAPLLTNYNTIDPLVDPILWSSLVPALPTGLPRNSEVTKTESSSTYTFFRPEE*

[0129] SEQ ID NO: 3 (forward primer)

[0130] AAAAAGCAGGCTCCATGATGGCGTCTTCTTCATCG

[0131] SEQ ID NO: 4 (reverse primer)

[0132] AGAAAGCTGGGTTTCACTCCTCTGGCCGAAAG.

Claims

1. Application of overexpression of a citrus transcription factor CsAP2-16 gene in promoting fruit ripening of citrus or tomato, characterized in that, The CDS sequence of the CsAP2-16 gene is shown as SEQ ID NO.

1.

2. The use of a protein encoded by overexpression of the citrus transcription factor CsAP2-16 gene according to claim 1 in promoting fruit ripening of citrus or tomato, characterized in that, The protein amino acid sequence is shown as SEQ ID NO.

2.

3. Use of a recombinant expression vector for overexpression of the citrus transcription factor CsAP2-16 gene of claim 1 in promoting fruit ripening of citrus or tomato.

4. Use according to claim 3, characterized in that: The recombinant expression vector is used to construct a binary expression vector by Gateway system, comprising a gateway entry vector pDONR221 and an overexpression destination vector pK7WG2D.

5. Use of a host bacterium for overexpression of the citrus transcription factor CsAP2-16 gene of claim 1 in promoting fruit ripening of citrus or tomato.

6. The use according to claim 1, wherein The amplification primers of the CsAP2-16 gene are shown as SEQ ID NO. 3 and 4.

7. A method of promoting ripening of citrus or tomato fruits, characterized in that, Overexpression of the CsAP2-16 gene of claim 1 in citrus or tomato.

Citation Information

Patent Citations

  • Critical ethylene response factor (ERF) for regulating and controlling orange peel chlorophyll removal and application of critical ERF

    CN104774849A

  • CaRAP2-12 gene and application of CaRAP2-12 gene in regulation and control of synthesis of carotenoid in pepper fruits

    CN116891859A