InDel molecular marker ms_chr5_17258541 related to drought resistance of alfalfa and application thereof

Abstract

The application provides an InDel molecular marker Ms_Chr5_17258541 related to alfalfa drought resistance and an application, and belongs to the technical field of biology. The InDel molecular marker is located on the 5th chromosome of alfalfa, and the nucleotide sequence of the insertion or deletion fragment is shown in SEQ ID NO. 3. A primer pair for amplifying the InDel molecular marker is shown in SEQ ID NO. 1-2. The InDel molecular marker and the primer pair thereof can identify or assist in identifying the drought resistance of alfalfa. Meanwhile, the application also provides a method for rapidly identifying the drought resistance of alfalfa by using the InDel molecular marker. The method is simple and fast, the identification result is accurate, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an InDel molecular marker Ms_Chr5_17258541 related to drought resistance of alfalfa and an application thereof. Technical Background

[0002] In the breeding process, selecting appropriate target traits is crucial for cultivating superior varieties. This selection process is influenced by both genotype and phenotype. Traditional breeding techniques primarily rely on identifying and evaluating external plant characteristics, but this approach has several limitations. First, traditional breeding methods have relatively long cycles, requiring years of observation and breeding to determine whether the target trait is genetically stable. Second, external traits are easily affected by environmental conditions, leading to uncertainty in results. Compared to traditional methods, molecular marker-assisted selection (MAS) offers unique advantages in breeding. This technique utilizes the association between genetic markers and target traits for selection, allowing for more accurate and rapid identification of individuals or genotypes possessing the target trait. By analyzing molecular markers in the genome, breeders can better understand the relationship between genotype and traits, enabling more precise selection of individuals with superior traits for breeding.

[0003] Genome-wide association analysis (GWA) has attracted considerable attention in the field of breeding. By analyzing the associations between a large number of genetic markers and target traits, key genes or loci associated with these traits can be identified. The research and application of this technology has become a major hotspot and competitive area in current breeding. Drought-resistant breeding in alfalfa (Medicago sativa L.) is crucial for improving crop drought tolerance, increasing yields, and reducing resource consumption. Against the backdrop of climate change and increasingly scarce water resources, developing drought-resistant varieties can enhance crop growth and adaptability to drought conditions, reduce disaster risks, maintain agricultural production stability, promote sustainable agricultural development, and increase economic benefits for farmers. This is crucial for ensuring food security and sustainable ecological improvements. Alfalfa breeding started relatively late, and reports on the development and mapping of drought-resistant markers using GWA are very limited. Therefore, the development of molecular markers associated with drought resistance in alfalfa is crucial for establishing assisted selection breeding systems, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0004] One of the objectives of the present invention is to provide an InDel molecular marker related to drought resistance of alfalfa.

[0005] A second object of the present invention is to provide an application of the above-mentioned InDel molecular marker related to drought resistance of alfalfa.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The molecular marker closely linked to the drought resistance trait of alfalfa disclosed in the present invention is located on chromosome 5 of alfalfa, and the molecular marker is named Ms_Chr5_17258541.

[0008] A primer pair was used to amplify a molecular marker closely linked to the drought resistance trait of alfalfa. The primer pair sequence corresponding to the molecular marker Ms_Chr5_17258541 is:

[0009] Ms_Chr5_17258541: TAAGGCGTTTAAGGAGGATG (shown in SEQ ID NO.1);

[0010] Ms_Chr5_17258541: AGCAGATAAGCAAGAAGGAT (shown in SEQ ID NO. 2).

[0011] The present invention also discloses the use of the aforementioned molecular marker primer pair in drought-resistant assisted breeding of alfalfa. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting the presence of the molecular markers of the present invention, drought-resistance-related traits of alfalfa varieties can be identified. The detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. The detection can also be performed using sequencing.

[0012] The present invention also discloses the application of the molecular marker in identifying drought resistance traits of alfalfa, especially in screening and identifying the drought resistance of alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance traits are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the molecular marker Ms_Chr5_17258541 was used for PCR amplification. The PCR amplification reaction system is shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 20 s; extension at 72°C for 10 min; and storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 39 and judge the drought resistance of alfalfa based on the results of the bands.

[0018] PCR amplification was performed using primer pairs Ms_Chr5_17258541-F and Ms_Chr5_17258541-R. If the PCR amplification product had only one characteristic band with a length of 320 bp as shown in SEQ ID NO.4, the alfalfa was a non-drought-resistant type (i.e., a drought-sensitive type); if the PCR amplification product had only one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, or had both one characteristic band with a length of 320 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa was a drought-resistant type (i.e., a drought-tolerant type).

[0019] In addition, the present invention also protects a kit for identifying the drought resistance trait of alfalfa, comprising the primer pair Ms_Chr5_17258541-F and Ms_Chr5_17258541-R. The other components of the kit are conventional reagents, including 10× PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not specifically limit the concentration of the primer pair; primer concentrations well known in the art may be used. The present invention does not specifically limit the sources of the 10× PCR buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be used.

[0020] The kit of the present invention can be used to quickly identify the drought resistance trait of alfalfa and can also quickly identify the drought resistance genotype of alfalfa. The specific method refers to the specific steps for identifying whether alfalfa has the drought resistance trait, and the PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 320 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous non-drought resistance genotype; if the PCR amplification product has only one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa is a homozygous drought resistance genotype; if the PCR amplification product has both one characteristic band with a length of 320 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous drought resistance genotype.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of the present invention have screened out a molecular marker Ms_Chr5_17258541 that is closely linked to the drought resistance trait of alfalfa. The molecular marker is located on chromosome 5. The molecular marker Ms_Chr5_17258541 of the present invention can be used to quickly and accurately identify the drought resistance trait of alfalfa.

[0023] (2) Screening with markers linked to drought resistance traits is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0024] (3) The molecular marker of the present invention has the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa drought-resistant breeding practice and variety identification in a simple, rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the result of genome-wide association analysis of drought tolerance in alfalfa, which is a Manhattan plot obtained based on MLM model analysis. The red dots indicate the positions of the Indels associated with the present invention.

[0026] Figure 2 This is a boxplot of the Dry vs. Fresh distribution of the genotypes at the Ms_Chr5_17258541 locus for the alfalfa population in Example 1. 0 / 0 indicates a homozygous drought-intolerant genotype at the Ms_Chr5_17258541 locus, while 0 / 1 indicates a heterozygous drought-resistant genotype at the Ms_Chr5_17258541 locus. Circles indicate extreme values, and *** indicates P < 0.001.

[0027] Figure 3 This is the partial sequence alignment result of drought-tolerant varieties and drought-sensitive varieties in the drought-tolerance-associated region.

[0028] Figure 4 This is the electrophoresis diagram of molecular markers amplified from 23 alfalfa germplasm resources. The concentration of agarose gel is 2%.

[0029] In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0030] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0031] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0033] Example 1 Development of molecular markers related to drought resistance in alfalfa

[0034] The present invention measures the drought resistance of alfalfa by the ratio of dry weight after drought treatment to fresh weight after non-drought treatment (DryVsFresh). The higher the ratio, the more drought-resistant the alfalfa; the lower the ratio, the less drought-resistant the alfalfa. After measuring DryVsFresh in the alfalfa population, a GWAS analysis was performed to locate an InDel site in alfalfa ( Figure 1 The red locus is named Ms_Chr5_17258541. This locus is located at position 17258541 on chromosome 5 of the alfalfa reference genome. The first allele type is 0 / 0, and the second allele type is 0 / 1. The distribution box plot of the ratio of dry weight after drought treatment to fresh weight after non-drought treatment corresponding to the genotype of the Ms_Chr5_17258541 locus in the population ( Figure 2 ), indicating that the drought tolerance of alfalfa strains with genotype 0 / 1 was significantly higher than that of alfalfa strains with genotype 0 / 0. At position 17258541 on chromosome 5 of alfalfa, the insertion / deletion fragment AATAGAGCCGACACAAAAGAAGACAGGTCGTGTGGGTCATAACACCTT (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the drought tolerance of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is drought-sensitive alfalfa; the alfalfa with the fragment shown in SEQ ID NO.3 deleted is drought-resistant alfalfa.

[0035] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0036] Ms_Chr5_17258541: TAAGGCGTTTAAGGAGGATG (shown in SEQ ID NO.1);

[0037] Ms_Chr5_17258541: AGCAGATAAGCAAGAAGGAT (shown in SEQ ID NO. 2).

[0038] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous drought-sensitive alfalfa sample had only a 320bp characteristic band, while the PCR product of the heterozygous drought-resistant alfalfa sample had both a 320bp characteristic band and a 273bp characteristic band.

[0039] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0040] 23 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0041] Table 2 Drought resistance and genotypes of 23 germplasm materials

[0042]

[0043]

[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0045] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× Taq PCR Master Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 20 s, followed by extension at 72°C for 10 min, and storage at 4°C. Separation was performed by electrophoresis on a 2% agarose gel, and after spotting, electrophoresis was conducted at 140 V DC for 2 h. PCR banding patterns for each sample were then determined.

[0046] 2) Determining the drought tolerance of alfalfa based on the size of the PCR product: when the PCR product of the alfalfa to be identified lacks the fragment shown in SEQ ID NO. 3, the alfalfa to be identified is drought-resistant alfalfa;

[0047] When the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa;

[0048] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 320 bp (SEQ ID NO. 4), then the alfalfa to be identified is drought-sensitive alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, and the band length of the PCR product is 273 bp (SEQ ID NO. 5), the alfalfa to be identified is drought-resistant alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054]

[0055] When the PCR product of the alfalfa to be identified is two bands, namely a band with the fragment shown in SEQ ID NO.3 inserted and a band with the fragment shown in SEQ ID NO.3 deleted, and one of the PCR product bands is 320 bp in length and the other is 273 bp in length, then the alfalfa to be identified is heterozygous drought-resistant alfalfa.

[0056] And, from Figure 4 As can be seen from Table 2, 18 alfalfa materials only amplified a 320bp characteristic band, and the identification result was a homozygous drought-intolerant genotype (0 / 0). After measurement, the average dry-to-fresh ratio of these 18 alfalfa materials under drought was 0.210; 5 alfalfa materials amplified both a 320bp characteristic band and a 273bp characteristic band, and the identification result was a heterozygous drought-resistant type (0 / 1). After measurement, the average dry-to-fresh ratio of these 5 alfalfa materials was 0.334, which was 0.124 higher than the average value of the 18 drought-sensitive types. Variance analysis showed that the dry-to-fresh ratio of the drought-sensitive type and the drought-resistant type was extremely significantly different (P < 0.001). The PCR test results corresponded to the actual dry-to-fresh ratio measurement results. Therefore, the InDel molecular marker of the present invention can effectively identify the drought resistance of alfalfa and can be used for the prediction and screening of drought-resistant alfalfa varieties.

[0057] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel molecular marker related to drought resistance in alfalfa, characterized in that: The nucleotide sequences of the molecular marker are shown in SEQ ID NO. 4 and SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment AATAGAGCCGACACAAAAGAAGACAGGTCGTGTGGGTCATAACACCTT on chromosome 5 of the alfalfa reference genome; the primer pair sequence for amplifying the molecular marker is: Ms_Chr5_ 17258541:TAAGGCGTTTAAGGAGGATG; Ms_Chr5_17258541:AGCAGATAAGCAAGAAGGAT.

2. The use of the primer pair for amplifying the molecular marker according to claim 1 in identifying or assisting in identifying the drought resistance trait of alfalfa, characterized in that: The method for identifying drought resistance traits of alfalfa comprises the following steps: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair for amplifying the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2), with the specific criteria being: PCR amplification was performed using primer pairs Ms_Chr5_17258541-F and Ms_Chr5_17258541-R. If the PCR amplification product had only one characteristic band with a length of 320 bp as shown in SEQ ID NO.4, the alfalfa was not drought-resistant; if the PCR amplification product had only one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, or had both one characteristic band with a length of 320 bp as shown in SEQ ID NO.4 and one characteristic band with a length of 273 bp as shown in SEQ ID NO.5, the alfalfa was drought-resistant.

3. A kit for identifying drought resistance of alfalfa, characterized in that: The invention also comprises the primer pair for amplifying the molecular marker as claimed in claim 1.

4. Use of the kit according to claim 3 in identifying drought-resistant genotypes of alfalfa, characterized in that: The method for identifying the drought-resistant genotype of alfalfa using the kit is as follows: (1) Extracting genomic DNA of alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair for amplifying the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 320 bp in length as shown in SEQ ID NO. 4, the alfalfa was a homozygous non-drought-resistant genotype; if the PCR amplification product had only one characteristic band of 273 bp in length as shown in SEQ ID NO. 5, the alfalfa was a homozygous drought-resistant genotype; if the PCR amplification product had both one characteristic band of 320 bp in length as shown in SEQ ID NO. 4 and one characteristic band of 273 bp in length as shown in SEQ ID NO. 5, the alfalfa was a heterozygous drought-resistant genotype.

Images