A CAPS marker and application of the Taper64-2A gene based on regulating wheat seed dormancy level and pre-harvest germination resistance.

Abstract

This invention discloses a CAPS marker and its application based on the TaPer64-2A gene, which regulates wheat seed dormancy level and pre-harvest resistance, relating to the field of plant genetics and breeding technology. The nucleotide sequence of the TaPer64-2A gene is shown in SEQ ID NO.1; the CAPS marker is TaPer64-cds. Using a population consisting of the parental line Jing 411 / Hongmangchun 21, 174 families (JH-RILs), and 160 wheat varieties, this invention verified that the above-mentioned CAPS marker TaPer64-cds is highly significantly correlated with the seed germination index (GI). Specifically, the seed germination index (GI) of families carrying the HMC21 genotype was significantly lower than that of families carrying the J411 genotype, indicating that the CAPS marker developed in this invention can effectively distinguish between wheat varieties with strong / weak dormancy or resistant / susceptible pre-harvest types.

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to a CAPS marker and application of the TaPer64-2A gene, which regulates wheat seed dormancy level and ear budding resistance. Background Technology

[0002] Compared to chemical agents, breeding and planting wheat varieties resistant to ear sprouting is the safest and most effective measure to reduce ear sprouting disasters.

[0003] Seed dormancy is closely related to PHS resistance (sprouting resistance). Wheat varieties with high seed dormancy levels have stronger resistance to sprouting, and vice versa. Therefore, identifying seed dormancy genes and developing molecular markers is of great significance for breeding new wheat varieties resistant to sprouting through gene aggregation breeding. However, few seed dormancy / sprouting resistance genes have been identified in wheat (such as TaVp-1, TaMFT / TaPHS1, TaMKK3-A, TaSdr, TaQsd1, TaMyb10-D, and Tapi4K-2A), and some genes have no significant effect on improving sprouting resistance, which is not conducive to improving the sprouting resistance of wheat varieties. Therefore, cloning new important seed dormancy / sprouting resistance genes and developing molecular markers can provide new gene resources and molecular tools for efficiently improving the sprouting resistance of wheat varieties through gene aggregation. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, the purpose of this invention is to provide a CAPS marker and application based on the TaPer64-2A gene, which regulates wheat seed dormancy level and ear budding resistance.

[0005] The present invention achieves the above objectives through the following technical solutions:

[0006] This invention provides a CAPS marker based on the TaPer64-2A gene, which regulates wheat seed dormancy level and pre-harvest resistance. The nucleotide sequence of the TaPer64-2A gene is shown in SEQ ID NO.1, and the CAPS marker is TaPer64-cds, which comprises:

[0007] Primers used to amplify the sequence of the +769th polymorphic site in the coding region of the TaPer64-2A gene and its upstream and downstream nucleotides, wherein the base type of the +769th polymorphic site in the coding region of the TaPer64-2A gene is A or T.

[0008] Restriction endonuclease used to verify the base type of Taper64-cds.

[0009] As a further optimization of the present invention, the restriction endonuclease used to verify the base type of TaPer64-cds is BmgB I.

[0010] The application of a CAPS marker in identifying wheat seed dormancy level and pre-budding resistance, wherein when the wheat seed is of type Taper64-cds-T, it is a wheat variety with strong dormancy or resistance to pre-budding, and when the wheat seed is of type Taper64-cds-A, it is a wheat variety with weak dormancy or susceptibility to pre-budding.

[0011] As a further optimization of the present invention, the nucleotide sequence containing the Taber64-cds-T base in strongly dormant or resistant to pre-budding wheat is shown in SEQ ID NO.2, and the nucleotide sequence containing the Taber64-cds-A base in weakly dormant or susceptible to pre-budding wheat is shown in SEQ ID NO.3.

[0012] A method for identifying wheat seed dormancy level and spikelet germination resistance using CAPS markers includes the following steps:

[0013] S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0014] S2. Using the nucleotide sequence composed of the Taper64-cds polymorphic site and its upstream and downstream nucleotides as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain the amplification product containing the Taper64-cds polymorphic site.

[0015] S3. Use restriction endonuclease BmgB I to verify the base type of Taper64-cds, determine the gene type of the amplified product based on the base type of Taper64-cds, and determine the dormancy level and germination resistance of wheat seeds based on the gene type.

[0016] As a further optimization of the present invention, the CAPS primers are specifically as follows:

[0017] SEQ ID NO.4: TaPer64-cds-F: 5'AGGACCTGGGTGGTGCTCTC 3';

[0018] SEQ ID NO. 5: TaPer64-cds-R: 5'TATGGTCTTGCACTTTCTCCA 3'.

[0019] The present invention has the following beneficial effects:

[0020] This invention utilizes transcriptome sequencing to identify a seed dormancy candidate gene, TaPer64-2A (TraesC S2A02G467000, named TaPer64-2A). Based on the sequence differences in the coding region of this gene in strong / weak dormancy (resistant / susceptible to pre-budding) wheat materials (Jing 411 (J411, weak dormancy, susceptible to PHS / susceptible to pre-budding) and Hongmangchun 21 (HMC21, strong dormancy, resistant to PHS / resistant to pre-budding)), a gene functional marker (CAPS marker) TaPer64-cds, which is easy to detect on a large scale, was developed. After electrophoresis, the bands of this CAPS marker are clearly distinguishable, and the banding differences between different strong / weak dormancy (resistant / susceptible to pre-budding) wheat varieties are obvious. The detection method is simple and helps to improve the targeting and specificity of molecular marker selection, thereby improving the efficiency of genetic improvement of wheat dormancy level and pre-budding resistance. Attached Figure Description

[0021] Figure 1 A statistical chart showing the germination rate of Wheat Buds (WTB, strong dormancy, PHS resistant / ear germination resistant) seeds at different developmental stages (28 and 35 days after flowering) before and after heat treatment. Figure 1 A) and the expression analysis diagram of the Taper64-2A gene ( Figure 1 B, C), *P<0.05; **P<0.01;

[0022] Figure 2 A sequence difference map of the coding region of the Taper64-2A gene in Jing 411 (J411, weak dormancy / susceptible to pre-budding and PHS) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding and PHS).

[0023] Figure 3 This is a chromatogram of agarose gel electrophoresis. Detailed Implementation

[0024] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Materials

[0026] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0027] 2. Method

[0028] 2.1 Identification and analysis of wheat gene Taper64-2A

[0029] 2.1.1 Transcriptome Analysis

[0030] Seeds of the wheat variety WTB (strong dormancy, PHS resistant) at different developmental stages (28 and 35 days after flowering, representing the seed dormancy formation stage) were subjected to heat treatment (25℃ at night to 35℃ during the day, relative humidity: 60%, 16h during the day). Seed samples were collected before and after heat treatment at different developmental stages (28 and 35 days after flowering). Transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954) identified a peroxidase gene TaPer64-2A (encoding a class III peroxidase, TraesCS2A02G467000, named TaPer64-2A) associated with seed dormancy.

[0031] Transcriptome sequencing (RNA-seq) data of seeds of the wheat variety WTB (strong dormancy, PHS resistant) were analyzed, and the results are as follows: Figure 1 As shown, Figure 1 A is a statistical graph showing the germination rate of seeds of the wheat variety WTB (strong dormancy, PHS resistant) 28 and 35 days after flowering (28 DPA and 35 DPA) before and after heat treatment. Figure 1 B is a statistical graph showing the relative expression levels of the Taper64-2A gene in seeds of the wheat variety WTB (strong dormancy, PHS resistant) 28 and 35 days after flowering (28 DPA, 35 DPA); *P<0.05;

[0032] thus Figure 1 As shown in A and 1B, the germination rate of WTB (strong dormancy, PHS resistant) seeds was significantly increased after heat treatment, indicating that heat treatment promotes wheat seed germination. The expression level of the Taper64-2A gene was significantly upregulated, suggesting that the Taper64-2A gene may be closely related to seed dormancy.

[0033] 2.1.2 qRT-PCR analysis

[0034] Quantitative real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, monitor the entire PCR process in real time by accumulating fluorescence signals, and finally quantify unknown templates using a standard curve. The fluorescent substances used in qRT-PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye. The principle is that a certain amount of SYBR fluorescent dye is added to the PCR reaction system. SYBR dye specifically incorporates into the DNA double strand and emits a fluorescent signal, while SYBR dye molecules not incorporated into the strand do not emit any fluorescent signal, thus ensuring that the increase in fluorescence signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA; therefore, the specificity of the PCR reaction can be determined by using a melting curve.

[0035] Wheat seeds from different developmental stages (28 and 35 days after flowering, representing the dormancy formation stage) before and after heat treatment in step 2.1.1 were collected. Wheat seed RNA was extracted and reverse transcribed into cDNA. Reverse transcription was performed using the PrimeScript RT-Reagent Kit (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was then performed according to the instructions of the SYBR Premix Ex Taq GC Kit (Takara Biotechnology, Dalian, China). The PCR primer sequences, PCR reaction system, and PCR reaction procedure are as follows:

[0036] PCR amplification primer sequences:

[0037] SEQ ID NO.6: qRT-PCR-TaPer64-2A-F: GCCTTCTTCGTCGTCGACA;

[0038] SEQ ID NO. 7: qRT-PCR-TaPer64-2A-R: GCAGCAAAGAGGTGGTGTC.

[0039] PCR reaction system: The total qPCR reaction system is 20 μL, including 10 μL of SYBR Advantage Premix (2×), 2.0 μL of reverse transcribed cDNA and 7.2 μL of ddH2O, and 0.4 μL each of 10 μM upstream and downstream primers for mRNA quantification.

[0040] PCR reaction program: For quantification, the mRNA quantification program was 95℃ for 2 min, 95℃ for 10 s, and 60℃ for 30 s, with 40 cycles. The real-time PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal reference gene for mRNA, and each sample was replicated in quadruplicate. The Ct values ​​for each group of samples were calculated using 2... -△Ct The algorithm calculates the change in relative expression levels.

[0041] Analyze the qRT-PCR test data of wheat variety WTB (strong dormancy, PHS resistant) seeds. Figure 1 C is a statistical graph showing the relative expression levels of the Taper64-2A gene in seeds of the wheat variety WTB (strong dormancy, PHS resistant) 28 and 35 days after flowering before and after heat treatment; **P<0.01;

[0042] This indicates that, consistent with the transcriptome sequencing data mentioned above, the expression level of the Taper64-2A gene was significantly upregulated in heat-treated WTB (strong dormancy, PHS resistant) seeds, while the expression level of the Taper64-2A gene was significantly upregulated. Figure 1 A indicates that heat treatment promotes wheat seed germination, which proves that the Taper64-2A gene is involved in regulating seed dormancy and germination, and that the Taper64-2A gene negatively regulates plant seed dormancy levels and PHS resistance (sprouting resistance).

[0043] 2.2 Development of CAPS markers for the TaPer64-2A gene

[0044] Cleaved Amplified Polymorphism Sequences (CAPS), also known as RFLP-PCR, works by screening DNA sequences containing known restriction enzyme sites and designing corresponding specific PCR primers. The DNA fragment at that site is then amplified using these primers. The amplified product is then digested with a restriction endonuclease that specifically recognizes the site. Gel electrophoresis separates the digested fragments, and staining and analysis of site changes are performed. CAPS markers are co-dominant markers, relatively simple to use, and can be detected directly by agarose gel electrophoresis. However, CAPS markers require suitable restriction endonucleases, making their development a significant undertaking.

[0045] 2.2.1 Cloning of candidate genes

[0046] The full-length TaPer64-2A gene and a partial sequence of its promoter region were obtained from the wheat reference genome (IWGSC RefSeq v.1.0) (as shown in SEQ ID NO.1). Using the obtained partial sequence of the TaPer64-2A gene and its promoter region as a template, specific primers were designed using Primer Premier 5.0 software (https: / / www.PremierBiosoft.com) for fragment amplification. The full-length TaPer64-2A gene and a partial sequence of its promoter region were cloned in Jing 411 (J411, a PHS-susceptible material, susceptible to pre-budding) and Hongmangchun 21 (HMC21, a PHS-resistant material, resistant to pre-budding) as follows:

[0047] The specific primer sequences used for cloning are as follows:

[0048] SEQ ID NO.8: TaPer64-2A-Clone1-F: 5'ATTGAATGAAAATGACCTGTTA 3';

[0049] SEQ ID NO.9: TaPer64-2A-Clone1-R: 5'AAATACAGTTATGTGGCAGAGA 3'.

[0050] PCR amplification was performed using the high-fidelity enzyme Fastpfu, which has high amplification efficiency and speed, according to the following reaction system: 10 μL 5×PCR Buffer (15 mM MgCl2), 5 μL dNTPmix (2.5 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 4 μL template DNA (50-100 ng / μL), 1 μL F Fastpfu (2.5 U / μL), and distilled water to a final volume of 50 μL.

[0051] Reaction procedure: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, annealing at the primer's required annealing temperature for 20 s, extension at 72℃ (extension time can be calculated based on fragment length and Fastpfu amplification efficiency of 2-4 kb / min), repeat the denaturation-annealing-extension three-step cycle 35 times, supplement the extension at 72℃ for 5 min, and store the product at 4℃.

[0052] Add 2 μL of 6× DNA loading buffer to the PCR product and perform electrophoresis on a 1.5% agarose gel. After electrophoresis, cut off the gel block containing the target fragment and recover and purify the target fragment using the agarose gel DNA recovery kit purchased from Kangwei Century Biotechnology Co., Ltd., following the instructions (https: / / www.cwbiotech.com / uploads / websitepdf / 216c4037-3eae-4ac2-b86a-762277a7adc1.pdf).

[0053] Add 1 μL of plasmid (Blunt-zero, purchased from TransGen Biotech, http: / / www.transgen.com.cn / ) and 4 μL of PCR purification product to a sample tube, ligate at 25°C for 20 min, and cool at 12°C. Remove the ligated sample and add 50 μL of competent cells (Trans-T, stored at -80°C before use) to a UV-sterilized workbench. Mix gently and incubate on ice for 20 min. After completion, transfer the sample to a water bath and heat shock at 42°C for 45 s, then immediately place it on ice for 2 min. On a sterile workbench, add 950 μL of SOC medium (formula per 100 mL: 2 g tryptone, 0.5 g yeast extract, 0.06 g NaCl, 0.02 g KCl, 0.2033 g MgCl2·6H2O, 0.2465 g MgSO4·7H2O, 0.36 g glucose, 100 mL ultrapure water) to the sample and incubate at 37°C for 1-1.5 h. Next, in a sterile workbench, spread 100-200 μL of the bacterial culture evenly onto LB solid medium supplemented with kanamycin (formula per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 1.5 g agar powder, 100 μL kanamycin solution, 100 mL ultrapure water) and incubate at 37°C for 15-16 h. Once the bacterial colonies have grown to a suitable size, add 6 μL of sterile water to each PCR sample well. Using a pipette with a maximum volume of 10 μL, transfer the bacteria into the well, gently mix, and then transfer 4 μL to a centrifuge tube containing 1000 μL of LB liquid medium (per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 100 μL kanamycin solution, 100 mL ultrapure water). Incubate the centrifuge tube at 37°C for 4-6 hours. Simultaneously, using the remaining 2 μL of bacterial culture in each well as a template, perform PCR detection using the universal primer M13 for bacterial sequencing. If the PCR reaction result is positive and contains the target fragment, the sample can be sent for sequencing.

[0054] The M13 primer sequence is as follows:

[0055] SEQ ID NO.10: M13-F:5'CAGGAAACAGCTATGACCATGAT 3';

[0056] SEQ ID NO. 11: M13-R:5'GTAAAACGACGGCCAGTGC 3'.

[0057] 2.2.2 Sequence analysis of candidate genes

[0058] The alignment and structural analysis of candidate gene sequencing results were performed using DNAMAN software (https: / / www.lynnon.com / dnaman.html). Sequence alignment of strong / weak dormancy (resistant / susceptible to pre-bud break, resistant / susceptible to PHS, Hongmangchun 21 / Jing 411) revealed sequence differences in the coding regions (e.g., Figure 2 As shown in the figure, sequence analysis of the coding regions of the clones of Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding, resistant to PHS) and Jing 411 (J411, weak dormancy / susceptible to pre-budding, susceptible to PHS) (the coding region sequence of the TaPer64-2A gene in the PHS-resistant material is shown in SEQ ID NO.2, and the coding region sequence in the PHS-susceptible material is shown in SEQ ID NO.3) revealed a missense mutation in the coding region of the TaPer64-2A gene in HMC21 and J411 (the base at +769bp of the coding region is A or T; serine / threonine). Specific primers (as shown in SEQ ID NO.4-5) were designed using PrimerPremier5.0 software to target this mutation, and CAPS markers, namely TaPer64-cds, were developed.

[0059] The nucleotide sequences of the specific primers are as follows:

[0060] SEQ ID NO.4: TaPer64-cds-F: 5'AGGACCTGGGTGGTGCTCTC 3';

[0061] SEQ ID NO. 5: TaPer64-cds-R: 5'TATGGTCTTGCACTTTCTCCA 3'.

[0062] 2.2.3 Amplification, enzyme digestion, and electrophoresis of CAPS markers

[0063] PCR amplification program: 1 μL 2.5 mM dNTP, 0.25 μL 10 μM primers, 1 μL 10×EasyTaq Buffer, 0.5 U EasyTaq, 100 ng DNA template Add double-distilled water to bring the volume to 10 μL.

[0064] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; annealing for 30 s at 62℃ with a 0.3℃ decrease per cycle; 72℃ extension for 30 s, 40 cycles; 72℃ extension for 8 min.

[0065] The enzyme digestion system after amplification was as follows: 5 μL PCR product, 1 μL 10×CutSmart Buffer, 0.5 U BmgBI (CACGTC), and double-distilled water was added to bring the total volume to 10 μL.

[0066] Enzyme digestion procedure: After digestion with BmgBI at 37℃ for 8 hours, add 3μL of 6×DNA Loading Buffer to the sample, and take 5μL of the digested product for typing by 2.5% agarose gel electrophoresis.

[0067] like Figure 3 As shown, the band of Jing 411 (weak dormancy / PHS susceptibility / susceptibility to pre-budding, Taper64-cds-A allelic variant) can be digested by enzymes, while the band of Hongmangchun 21 (strong dormancy / PHS resistance / resistant to pre-budding, Taper64-cds-T allelic variant) cannot be digested by enzymes. Figure 3 As can be seen, the PCR product of Jing 411 was digested into two bands, indicating that it is of type Taper64-cds-A, while Hongmangchun 21 had only one band, indicating that it is of type Taper64-cds-T. The bands are clearly visible and easy to identify.

[0068] 2.2.4 Validation of CAPS markers in linked and natural populations

[0069] Germination index (GI) measurement

[0070] At different times post-harvest (days 5 and 15), 50 whole seeds from 174 recombinant inbred lines of J411 and HMC21 and 160 wheat varieties were collected in two replicates and evenly placed ventrally downwards in 90 mm diameter Petri dishes. 10 mL of sterile water was added, and the dishes were incubated for 3 days at 20°C under 14 h (daytime) / 10 h (nighttime) conditions. The number of germinated seeds (n1) on day 1, n2 on day 2, n3 on day 3, and the number of remaining ungerminated seeds (n0) were recorded. The germination index (GI) was calculated using the following formula:

[0071] GI=(3*n1+2*n2+n3) / 3*(n1+n2+n3+n0).

[0072] The phenotypic data was prepared using Excel software, and the correlation analysis between the phenotypic data and the labels was performed using SPSS software.

[0073] In the recombinant inbred line population of Jing 411 and Hongmangchun 21 (JH-RILs, containing 174 recombinant inbred lines) and the natural population of 160 wheat varieties (Table 1), the Manny-Whitney test (U-test) analysis between different allelic types (TaPer64-cds-A and TaPer64-cds-T types) and the PHS trait was performed using IBM SPSS Statistas20 software (www.spss.com).

[0074] Table 1 uses a population of 174 recombinant inbred lines of Jing 411 / Hongmangchun 21 and a natural population of 160 wheat varieties to verify the association between two allelic types, Taper64-cds-A and Taper64-cds-T, and the PHS trait.

[0075]

[0076] Note: 14GI-5, 15GI-5, 16GI-5, 17GI-5, 18GI-5, 19GI-5, and 21GI-5 refer to the seed germination index measured on the 5th day after wheat harvest in 2014, 2015, 2016, 2017, 2018, 2019, and 2021, respectively. The seed germination index (GI) is calculated as follows: 14GI-15, 15GI-15, 17GI-15, and 21GI-15 refer to the seed germination index (GI) measured 15 days after wheat harvest in 2014, 2015, 2017, and 2021, respectively; 22GI5-HF, 22GI5-SZ, 23GI5-GH, 23GI5-HF, and 23GI5-HB represent the seed germination index (GI) of 160 wheat varieties planted in four environments (Huaibei (HB), Suzhou (SZ), Guohe Town, Lujiang County, Hefei City (GH), and Hefei (HF)) in 2022 and 2023, respectively.

[0077] * indicates that the two different allelic variants of the marker are highly significantly correlated with the seed dormancy phenotype at the 0.05 level;

[0078] **This indicates that the two different allelic variants of the marker are highly significantly correlated with the seed dormancy phenotype at the 0.01 level.

[0079] As shown in Table 1, the differences in seed dormancy phenotypic values ​​(GI) among wheat varieties carrying the two allelic variations TaPer64-cds-A and TaPer64-cds-T were all extremely significant or significant (P < 0.05 or 0.01).

[0080] 3. Conclusion

[0081] This application used transcriptome sequencing to identify a candidate seed dormancy gene, TaPer64-2A. qRT-PCR was used to detect changes in seed germination rate and relative expression levels of the TaPer64-2A gene before and after heat treatment of wheat seeds at different developmental stages (28 and 35 days after flowering, representing the dormancy formation stage). The results showed that heat treatment promoted seed germination in WTB seeds at different developmental stages (28 and 35 days after flowering, representing the dormancy formation stage), and significantly upregulated the expression level of the TaPer64-2A gene, consistent with transcriptome sequencing results. This verifies that the TaPer64-2A gene is closely related to seed dormancy and negatively regulates plant seed dormancy levels and PHS resistance (ear germination resistance).

[0082] Cloning and sequencing comparisons of the Taper64-2A gene in wheat varieties J411 and HMC21 revealed a missense mutation in the coding region of both HMC21 and J411 (base A or T at +769 bp; serine / threonine). Based on this sequence variation, this application developed a CAPS marker, Taper64-cds (containing two allelic variants, Taper64-cds-A and Taper64-cds-T). The correlation between the aforementioned CAPS marker Taper64-cds (TaPer64-cds-A and Taper64-cds-T) and seed germination index was validated using a recombinant inbred line population of Jing 411 and Hongmangchun 21 (JH-RILs, including 174 families) and a natural population of 160 wheat varieties. The seed germination index (GI) was highly significantly correlated with that of wheat varieties carrying the HMC21 genotype (TaPer64-cds-T allelic variant). Specifically, the seed germination index (GI) of wheat varieties carrying the J411 genotype (TaPer64-cds-A) was significantly lower than that of wheat varieties carrying the J411 genotype (TaPer64-cds-A). This indicates that the CAPS marker TaPer64-cds (TaPer64-cds-A and TaPer64-cds-T) developed in this invention can effectively distinguish between wheat varieties with strong / weak dormancy (resistant / susceptible to PHS, resistant / susceptible to pre-bud sprouting). This provides important genetic resources and molecular markers for creating new germplasm with strong dormancy / pre-bud sprouting resistance and for breeding new varieties with strong dormancy / pre-bud sprouting resistance through transgenic or gene editing methods.

[0083] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. An application of the CAPS marker of the TaPer64-2A gene, which regulates wheat seed dormancy level and pre-harvest resistance, in identifying wheat seed dormancy level and pre-harvest resistance, characterized in that, The nucleotide sequence of the TaPer64-2A gene is shown in SEQ ID NO.

1. The CAPS is labeled TaPer64-cds and includes primers for amplifying the sequence of the +769th polymorphic site in the coding region of the TaPer64-2A gene and its upstream and downstream nucleotides. The base type of the +769th polymorphic site in the coding region of the TaPer64-2A gene is A or T. BmgB I, a restriction endonuclease used to verify the base type of Taper64-cds; When the wheat seeds are of type Taper64-cds-T, they are strong dormancy or resistant to ear sprouting. When the wheat seeds are of type Taper64-cds-A, they are weak dormancy or susceptible to ear sprouting.

2. The application according to claim 1, characterized in that, Nucleotide sequences containing the Taber64-cds-T base in strongly dormant or resistant-sprouting wheat are shown in SEQ ID NO.2, and nucleotide sequences containing the Taber64-cds-A base in weakly dormant or susceptible-sprouting wheat are shown in SEQ ID NO.

3.

3. A method for identifying wheat seed dormancy level and pre-harvest resistance using the CAPS marker of the Taper64-2A gene, which regulates wheat seed dormancy level and pre-harvest resistance, characterized in that, Includes the following steps: S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA; The nucleotide sequence of the TaPer64-2A gene is shown in SEQ ID NO.

1. The CAPS is labeled TaPer64-cds and includes primers for amplifying the sequence of the +769th polymorphic site in the coding region of the TaPer64-2A gene and its upstream and downstream nucleotides. The base type of the +769th polymorphic site in the coding region of the TaPer64-2A gene is A or T. S2. Using the nucleotide sequence composed of the Taper64-cds polymorphic site and its upstream and downstream nucleotides as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain the amplification product containing the Taper64-cds polymorphic site. S3. Use restriction endonuclease BmgB I to verify the base type of Taper64-cds, determine the gene type of the amplified product based on the base type of Taper64-cds, and determine the dormancy level and germination resistance of wheat seeds based on the gene type. When the wheat seeds are of type Taper64-cds-T, they are strong dormancy or resistant to ear sprouting. When the wheat seeds are of type Taper64-cds-A, they are weak dormancy or susceptible to ear sprouting.

4. The method according to claim 3, characterized in that, The specific CAPS primers are as follows: SEQ ID NO.4: TaPer64-cds-F: 5' AGGACCTGGGTGGTGCTCTC 3'; SEQ ID NO. 5: TaPer64-cds-R: 5' TATGGTCTTGCACTTTCTCCA 3'.

Images