Molecular markers of the secretory complex 1 gene in Penaeus vannamei and its application
By using SNP molecular markers of the secretory complex 1 gene of whiteleg shrimp, we screened and bred whiteleg shrimp varieties with strong disease resistance, solved the frequent occurrence of Vibrio parahaemolyticus disease, and improved the accuracy of breeding and disease resistance.
Patent Information
- Application Number
- CN202410670149.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-05-28
AI Technical Summary
In the existing technology, Vibrio parahaemolyticus disease frequently occurs during the farming of whiteleg shrimp, resulting in economic losses and the spread of drug-resistant strains, and there is a lack of effective molecular markers for disease-resistant breeding.
Using SNP molecular markers of the secretory complex 1 gene of white shrimp, the genotype of individuals is determined through PCR amplification and sequencing, individuals with disease-resistant traits are selected as reserve parents for breeding, and gene editing or knockout technology is used to improve the variety.
The disease resistance of whiteleg shrimp has been steadily improved, the use of antibiotics and the spread of drug-resistant strains have been reduced, and an efficient breeding foundation has been provided.
Smart Images

Figure CN118345178B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of whiteleg shrimp breeding, and particularly relates to a whiteleg shrimp exocytic complex 1 gene molecular marker and application thereof. Background Art
[0002] In recent years, with the expansion of shrimp farming and increased stocking density, large amounts of feed, shrimp feces, and residual feed have accumulated at the bottom of ponds, leading to frequent outbreaks of bacterial diseases. This not only causes severe economic losses to aquaculture production but also leads to numerous negative impacts, including the misuse of antibiotics and the spread of antibiotic-resistant strains. Vibriosis, caused by Vibrio parahaemolyticus, is the most common and most harmful bacterial disease in whiteleg shrimp farming. Antibiotics are commonly used to combat vibriosis, but reliance on and overuse of these drugs leads to environmental pollution and the spread of antibiotic-resistant strains. With the advancement of molecular biology and genotyping technologies, molecular markers based on trait-related functional genes have become a key technology for the precise selection of animals with high disease resistance. Single nucleotide polymorphisms (SNPs) refer to DNA sequence variations caused by variations in a single nucleotide at the genomic level. SNPs offer advantages such as high abundance, widespread distribution, strong representativeness, good genetic stability, and ease of high-throughput, highly automated detection and analysis. SNP markers have been used in the breeding of whiteleg shrimp, and molecular markers related to ammonia nitrogen resistance, nitrate resistance and growth traits have been reported, but SNP markers related to Vibrio parahaemolyticus resistance have rarely been reported.
[0003] When bacterial pathogens infect hosts, they often utilize a host vesicle trafficking pathway called polarized exocytosis to reshape the eukaryotic cell plasma membrane during infection. This exocytosis is typically mediated by the evolutionarily conserved octameric protein complex known as the exocyst. The exocyst comprises eight proteins: Sec3, Sec5, Sec6, Sec8, Sec10, Sec15, Exo70, and Exo84. Studies have shown that Sec6 expression is significantly upregulated in the kidneys and spleens of scorpionfish (Pseudomonas aeruginosa) following infection with scorpionfish scorpiontitis virus (SGIV), and that Sec6 can regulate SGIV-induced apoptosis. This suggests that the exocyst may also play an important role in shrimp infection with Vibrio spp., but this has not been reported. Summary of the Invention
[0004] In response to the above-mentioned shortcomings, the present invention discloses a molecular marker for the exocyst complex component 1 gene of Penaeus vannamei. The SNP molecular marker is obtained based on screening of the exocyst complex component 1 gene of Penaeus vannamei. These markers are used as functional markers for the resistance of Penaeus vannamei to Vibrio parahaemolyticus and can be used in disease-resistant breeding of Penaeus vannamei to obtain new varieties of Penaeus vannamei with good resistance to Vibrio parahaemolyticus.
[0005] The present invention is achieved by adopting the following technical solutions:
[0006] A molecular marker of a secretory complex 1 gene of white shrimp Penaeus vannamei, comprising any one or more of molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K, and molecular marker L;
[0007] The molecular marker A is located at the 5271 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5271 T>C. The base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous.
[0008] The molecular marker B is located at the 5280 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5280 A>G. The base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;
[0009] The molecular marker C is located at the 5328 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5328 A>G. The base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;
[0010] The molecular marker D is located at the 5373 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5373 T>A. The base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous.
[0011] The molecular marker E is located at the 5381 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5381 A>C. The base at this site is A or C, and the mutation types are A / A homozygous, A / C heterozygous, and C / C homozygous;
[0012] The molecular marker F is located at the 5392 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5392 A>G. The base at this position is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;
[0013] The molecular marker G is located at the 5401 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5401 A>T. The base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous;
[0014] The molecular marker H is located at the 5422 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5422 T>A. The base at this position is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous.
[0015] The molecular marker 1 is located at the 5448 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.5448 C>T. The base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous.
[0016] The molecular marker J is located at the 5450 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5450 A>G. The base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous;
[0017] The molecular marker K is located at the 5474 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D.5474 C>A. The base at this position is A or C, and the mutation types are A / A homozygous, A / C heterozygous, and C / C homozygous.
[0018] The molecular marker L is located at the 5519 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D.5519 A>T. The base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous.
[0019] The nucleotide sequence described in Sequence Table 1 in the sequence listing is the nucleotide sequence of the exocyst complex component 1 gene.
[0020] The application of the whiteleg shrimp secretory complex 1 gene molecular marker is to use it for the selective breeding of whiteleg shrimp, specifically, first extracting genomic DNA from the muscle tissue of the whiteleg shrimp to be tested, then using the obtained genomic DNA as template DNA for PCR amplification and purifying the PCR amplification product, and then sequencing the obtained PCR amplification product to determine the genotypes of the molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K and molecular marker L;
[0021] When the genotype of molecular marker A is the CC genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker B is the GG genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker C is the GG genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker D is the AA genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; When the genotype of molecular marker E is the CC genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker F is the AA genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker G is the TT genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker H is the TT genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; When the genotype of molecular marker I is the TT genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker J is the GG genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker K is the CC genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker L is the TT genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding.
[0022] The present invention extracts DNA from the appendage muscle tissue of the whiteleg shrimp, which does not significantly affect the shrimp body. Breeding can be carried out using molecular assisted breeding methods, such as using gene knockout or gene editing methods to process molecular markers to obtain varieties.
[0023] During the PCR amplification process, the primer set for detecting the molecular marker of the exocytic complex 1 gene of white shrimp includes primer F and primer R. The sequence of primer F is CAAAAGCCCTCATCATCAGTG (sequence 2 in the sequence listing), and the sequence of primer R is TTTGTGACTCTGCACTCCTG (sequence 3 in the sequence listing).
[0024] The PCR amplification system consisted of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTPs (10 mmol / L each), 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH 2 O, and 2.0 μL of template DNA.
[0025] The reaction procedure of the PCR amplification comprises the following steps:
[0026] S1, pre-denaturation at 95°C for 5 min;
[0027] S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles;
[0028] S3. Extend at 72°C for 5 min.
[0029] Compared with the existing technology, this technical solution has the following beneficial effects:
[0030] The exocyst complex component 1 (Exoc1) described in the present invention is a component of the Exocyst complex and plays an important role in mammalian germ cell production, cerebral cortex development, etc. Studies have also found that it plays an important role in the process of Vibrio infection in whiteleg shrimp. Therefore, based on the screening of the exocyst complex component 1 gene of whiteleg shrimp, the present invention obtains SNP molecular markers closely related to the resistance of whiteleg shrimp to Vibrio parahaemolyticus. The SNP molecular markers can be used to select and breed new whiteleg shrimp varieties that are resistant to Vibrio parahaemolyticus. In addition, the genotypes of the selected individuals are stable and do not undergo genetic differentiation, providing a good foundation for the breeding and improvement of whiteleg shrimp varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Figure 1 is a partial fragment sequence of the product obtained by amplifying the exocyst complex component 1 gene in the embodiment. a represents positions 121 to 125, wherein the CC, CT, and TT peak maps of the D. 5271 T>C site are shown; b represents positions 130 to 134, wherein the AA, AG, and GG peak maps of the D. 5280 A>G site are shown; c represents positions 178 to 182, wherein the AA, AG, and GG peak maps of the D. 5328 A>G site are shown; d represents positions 223 to 227, wherein the AA, AT, and TT peak maps of the D. 5373 T>A site are shown; e represents positions 231 to 235, wherein the AA, AC, and CC peak maps of the D. 5381 A>C site are shown; and f represents positions 242 to 246, wherein the AA, AG, and GG peak maps of the D. 5392 A>G site are shown.
[0032] Figure 25401 A>T site, wherein the AA, AT, and TT peaks are shown; h represents positions 272 to 276, wherein the AA, AT, and TT peaks are shown; j represents positions 302 to 306, wherein the AA, AG, and GG peaks are shown; k represents positions 325 to 329, wherein the AA, AC, and CC peaks are shown; and l represents positions 370 to 374, wherein the AA, AT, and TT peaks are shown. DETAILED DESCRIPTION
[0033] The present invention is further illustrated by the following examples, which are not intended to limit the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods well known to those skilled in the art.
[0034] Example: The screening process of the molecular marker of the exocytic complex 1 gene of Penaeus vannamei of the present invention is as follows:
[0035] (1) 245 whiteleg shrimp weighing about 20 grams were selected and temporarily cultured for 5 days. The whiteleg shrimp were injected with a concentration of 7×10 6 cfu / mL of Vibrio parahaemolyticus; to exclude deaths caused by injection, deaths were recorded 6 hours after challenge, and 60 whiteleg shrimp that died first and survived 96 hours later were selected as samples of the whiteleg shrimp Vibrio parahaemolyticus-susceptible and Vibrio parahaemolyticus-tolerant groups, respectively.
[0036] (2) Five whiteleg shrimps were randomly selected from the sensitive group and the tolerant group, and their muscle tissues were extracted. The genomic DNA was extracted using the conventional phenol-imide extraction method, and the obtained genomic DNA was stored at -20 °C for later use.
[0037] (3) Primers F and R were designed based on the exocyst complex component 1 gene sequence of white shrimp, and then the SNP sites located in the exocyst complex component 1 gene were amplified and screened;
[0038] The sequence of the primer F is: CAAAAGCCCTCATCATCAGTG;
[0039] The sequence of the primer R is: TTTGTGACTCTGCACTCCTG;
[0040] The PCR amplification system consisted of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTPs (10 mmol / L each), 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH O, and 2.0 μL of template DNA;
[0041] The reaction procedure of the PCR amplification comprises the following steps:
[0042] S1, pre-denaturation at 95°C for 5 min;
[0043] S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles;
[0044] S3, extension at 72°C for 5 min;
[0045] (4) The PCR amplification products were purified and sequenced after 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak analysis, to screen out related SNPs sites. The PCR amplification product sequence of one sample is shown below:
[0046] CAAAAGCCCTCATCATCAGTGGCAAGCACACCTGGATCGAGTGGCAGTGAGGAGAGCAGTGGATCAGCTGGAACTAGTTCTGGTACAGTTGGTACTCCAGGCTCAGGGCATGGAAAGCTTGTTAACCG TGAAGTGCGCTCAATGATGGCAGCTTTGTTCACTACACTTGAACAACAACTAGGATCTTTCATCAATACTTATGATCGTGCAGATTCTTAGTAAGTTATTTTTGACTGTTTGGCAAATATTTTTATGT TGTATTTAGGATGCCTGTTGTGAAAATGAGCTTTGAATTCCTACTATGTAAAGCATATATTTATCTCATCATCTATTTTCTTTTCAGTTGCTGCTTGTATATCTATGTGCGACTAAGTGAGCATGTTC TTACTGCTGAGGATACAGGTTCCTTCCTTAGCACCACTTTTGGATCATGTTTGGTACAAGCCAAGAGGAACTTTGACCGCTTCATGAACTCGCAGCTGCAGTCAATCCAGGAGTGCAGAGTCACAAA;
[0047] Among them, the 123rd position is D. 5271 T>C, the 132nd position is D. 5280 A>G, the 180th position is D. 5328 A>G, the 225th position is D. 5373 T>A, the 233rd position is D. 5381 A>C, the 244th position is D. 5392 A>G, the 253rd position is D.5401 A>T, the 274th position is D. 5422 T>A, the 300th position is D. 5448 C>T, the 302nd position is D. 5450 A>G, the 326th position is D. 5474 C>A, and the 371st position is D. 5519 A>T;
[0048] (5) Based on the selected SNPs, the whiteleg shrimp in the sensitive group and the tolerant group were tested and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The specific results are shown in Tables 1 and 2.
[0049] According to the analysis in Table 1, the dominant type of molecular marker A was CC genotype, the dominant type of molecular marker B was GG genotype, the dominant type of molecular marker C was GG genotype, the dominant type of molecular marker D was AA genotype, the dominant type of molecular marker E was CC genotype, the dominant type of molecular marker F was AA genotype, the dominant type of molecular marker G was TT genotype, the dominant type of molecular marker H was TT genotype, the dominant type of molecular marker I was TT genotype, the dominant type of molecular marker J was GG genotype, the dominant type of molecular marker K was CC genotype, and the dominant type of molecular marker L was TT genotype.
[0050] Table 1 Chi-square analysis results of some sites
[0051]
[0052] Table 2 Chi-square analysis results of some sites
[0053]
[0054] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.
Claims
1. An application of a molecular marker for the secretory complex 1 gene of Penaeus vannamei, characterized in that: The molecular markers of the exocytic complex 1 gene of white shrimp include molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, molecular marker H, molecular marker I, molecular marker J, molecular marker K and molecular marker L; The molecular marker A is located at the 5271 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5271T>C, the base at this site is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker B is located at the 5280 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5280A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker C is located at the 5328 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. The base at 5328A>G is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker D is located at the 5373 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5373T>A, the base at this position is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous; The molecular marker E is located at the 5381 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5381A>C, the base at this position is A or C, and the mutation types are A / A homozygous, A / C heterozygous, and C / C homozygous; The molecular marker F is located at the 5392 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5392A>G, the base at this position is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker G is located at the 5401 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5401A>T, the base at this site is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous; The molecular marker H is located at the 5422 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5422T>A, the base at this position is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous; The molecular marker 1 is located at the 5448 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5448C>T, the base at this position is C or T, and the mutation types are C / C homozygous, C / T heterozygous, and T / T homozygous; The molecular marker J is located at the 5450 bp site of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5450A>G, the base at this site is A or G, and the mutation types are A / A homozygous, A / G heterozygous, and G / G homozygous; The molecular marker K is located at the 5474 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5474C>A, the base at this position is A or C, and the mutation types are A / A homozygous, A / C heterozygous, and C / C homozygous; The molecular marker L is located at the 5519 bp position of the nucleotide sequence shown in Sequence 1 in the sequence table, denoted as D. 5519A>T, the base at this position is A or T, and the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous; The vannamei secretory complex 1 gene molecular marker is used for selective breeding of vannamei shrimp. Specifically, genomic DNA is first extracted from muscle tissue of the to-be-tested vannamei shrimp, and the obtained genomic DNA is then used as template DNA for PCR amplification and purification of the PCR amplification product. The obtained PCR amplification product is then sequenced to determine the genotypes of the molecular markers A, B, C, D, E, F, G, H, I, J, K, and L. Individuals with dominant genotypes are then selected as reserve parents for breeding of vannamei shrimp varieties. The breeding is for screening vannamei shrimp varieties with resistance to Vibrio parahaemolyticus.
2. The use of the Penaeus vannamei secretory complex 1 gene molecular marker according to claim 1, characterized in that: When the molecular marker of the secretory complex 1 gene of Penaeus vannamei is used for selective breeding of Penaeus vannamei, when the genotype of molecular marker A is the CC genotype of the dominant genotype, the individual is selected as the reserve parent for breeding of Penaeus vannamei varieties; when the genotype of molecular marker B is the GG genotype of the dominant genotype, the individual is selected as the reserve parent for breeding of Penaeus vannamei varieties; when the genotype of molecular marker C is the GG genotype of the dominant genotype, the individual is selected as the reserve parent for breeding of Penaeus vannamei varieties; when the genotype of molecular marker D is the AA genotype of the dominant genotype, the individual is selected as the reserve parent for breeding of Penaeus vannamei varieties; When the genotype of molecular marker E is the CC genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker F is the AA genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker G is the TT genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker H is the TT genotype, which is the dominant genotype, the individual is selected as the reserve parent for whiteleg shrimp variety breeding; When the genotype of molecular marker I is the TT genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker J is the GG genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker K is the CC genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of molecular marker L is the TT genotype, which is a dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding.
3. The use of the molecular marker of the secretory complex 1 gene of Penaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primer set for detecting the exocytic complex 1 gene molecular marker of white shrimp comprises primer F and primer R, the sequence of primer F is CAAAAGCCCTCATCATCAGTG, and the sequence of primer R is TTTGTGACTCTGCACTCCTG.
4. The use of the Penaeus vannamei secretory complex 1 gene molecular marker according to claim 3, characterized in that: The PCR amplification system consists of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP, 0.2 μL of 5 U / μL Taq DNA polymerase, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH 2 O, and 2.0 μL of template DNA.
5. The use of the molecular marker of the secretory complex 1 gene of Penaeus vannamei according to claim 1, characterized in that: The reaction procedure of the PCR amplification comprises the following steps: S1, pre-denaturation at 95°C for 5 min; S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles; S3. Extend at 72°C for 5 min.
Citation Information
Patent Citations
SNP molecular marker related to nitrite nitrogen resistance character of litopenaeus vannamei and application of SNP molecular marker
CN117551785A
Penaeus vannamei programmed cell death protein molecular marker and application thereof
CN117568490A