A blood perfusion composition, a blood perfusion device and its application

Abstract

The present invention relates to a mucin-containing blood perfusion composition, a blood perfusion device and applications thereof. The blood perfusion composition comprises a mucin component, poloxamer and a resin. The blood perfusion device adopts the above-mentioned perfusion composition, which can effectively reduce free radicals in the patient's body, so that the free radical level is controlled at a low level, and effectively improves the blood condition of stroke patients.

Description

Technical Field

[0001] The present invention relates to blood perfusion technology, and in particular to a blood perfusion composition, a perfusion device and applications thereof. Background Art

[0002] Hemoperfusion is commonly used to remove toxins, drugs or other harmful substances from the blood. This technology involves directing the patient's blood out of the body, filtering the blood through a hemoperfusion device, and then returning it to the patient's body. Hemoperfusion is often used for poisoning treatment, immune diseases, etc. Currently, there are many perfusion materials for hemoperfusion devices. After a cerebral hemorrhage, the patient may experience an imbalance in the generation and removal of reactive oxygen free radicals. A large number of free radicals can aggravate nerve damage by damaging DNA, affecting signal transduction, and participating in gene expression regulation. The inflammatory response after cerebral hemorrhage is closely related to oxidative stress. Inflammation causes brain damage through oxidative stress, and oxidative stress stimulation promotes further development of inflammation, aggravating neurovascular damage and neurological dysfunction. It is particularly important to improve the inflammatory environment in the patient's blood and reduce the amount of free radicals to cause complications. However, there is currently no existing technology that uses functional enzymes as perfusion filler components and can fully exert the role of functional enzymes. For example, Chinese patent CN202211287838.4 discloses a radiation-resistant filler for a hemoperfusion device, which adds a variety of functional enzymes to the hemoperfusion filler, including superoxide dismutase or catalase. By adding the action of functional enzymes, the effect of radiation sterilization on the blood filler is avoided, but it does not explore other effects of functional enzymes. Summary of the invention

[0003] In order to solve the above problems existing in the prior art, the present invention aims to provide a blood perfusion composition, a perfusion device and applications.

[0004] In one aspect, the present invention provides a mucin having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No. 1, and substantially retains the biological function of the sequence from which it is derived.

[0005] In a specific embodiment, the mucin comprises white relative to the amino acid sequence shown in SEQ ID No. 1: starting from the first amino acid at the N-terminus, it lacks 1-85 amino acids;

[0006] In a specific embodiment, the mucin comprises amino acid substitutions at positions 87, 92, 871 and 892 relative to the amino acid sequence shown in SEQ ID No. 1.

[0007] In a specific embodiment, the mucin comprises an amino acid sequence relative to SEQ ID No. 1, selected from L87A, Q92R, K871L, G892I.

[0008] In another aspect, the present invention provides a blood perfusion filler composition, comprising the aforementioned mucin, SOD enzyme, and resin.

[0009] In one aspect, the present invention also provides a method for preparing a blood perfusion material, comprising the following steps:

[0010] (1) preparing a poloxamer buffer solution with a pH value of 8.0, dissolving the SOD enzyme in the poloxamer buffer solution, and stirring at 12-16° C. to obtain a poloxamer buffer solution containing a positively charged SOD enzyme for use;

[0011] (2) using medical grade polystyrene resin, placing the polystyrene resin in 3-5 g / ml dilute hydrochloric acid, washing for 3-6 hours, and then washing with 0.5 mol / L NaOH solution for 3-6 hours, then immersing the resin in pure water, ultrasonically cleaning at least 5 times, separating the resin, and drying to obtain an exchange resin with hydroxyl ions;

[0012] (3) adding the exchange resin with hydroxyl ions obtained in step (2) to the poloxamer buffer obtained in step (1), stirring and mixing for 5-10 minutes to obtain an exchange resin-poloxamer mixed solution, taking the mucin described in the first aspect, adding it to the exchange resin-poloxamer mixed solution, stirring for 30-60 minutes to obtain a blood perfusion material mixture, filtering out the liquid, sterilizing the obtained blood perfusion material mixture, and then aging at 4° C. for 5-12 days to obtain a final product of the blood perfusion material.

[0013] In a specific embodiment, the concentration of the poloxamer buffer in step (1) is 0.2 g / ml, the amount of the SOD enzyme added to each 100 ml of the poloxamer buffer is 5 mg, the stirring temperature is 15° C., and the stirring time is 1-2 min.

[0014] In a specific embodiment, in step (3), the weight ratio of the resin to the mucin is 200 g:90 mg, the stirring speed is 200 r / min, and the stirring time is 60 min.

[0015] In a specific embodiment, in step (3), the exchange resin with hydroxyl ions obtained in step (2) is added to the poloxamer buffer obtained in step (1), and the mixture is stirred for 6 minutes to obtain an exchange resin-poloxamer mixed solution.

[0016] In a specific embodiment, the aging time in step (3) is 10 days.

[0017] In one aspect, the present invention further provides the use of the mucin described in the first aspect, the composition described in the second aspect, or the preparation method described in the third aspect in the preparation of hemoperfusion fillers.

[0018] In another aspect, the present invention further provides a blood perfusion device, which comprises the mucin of the first aspect or the composition of the second aspect.

[0019] Technical effects of the present invention:

[0020] 1. Through screening, we found mucin that can be used as blood perfusion material. This protein has a simple structure and is easy to obtain.

[0021] 2. By performing PCR error-prone mutations on the mucin sequence, a mutant protein with better activity was found.

[0022] 3. The blood perfusion material prepared by the present invention can be used for medical purposes and has potential value.

[0023] 4. The perfusion material described in the present invention can effectively reduce free radicals in the patient's body, so that the free radical level is controlled at a low level, and effectively improve the blood condition of stroke patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results show that perfusion fillers containing mucin can scavenge blood free radicals.

[0025] Figure 2 The results show that the perfusion medium containing variant mucin can scavenge blood free radicals. Specific implementation plan

[0026] The present invention can be further described by the following examples, however, the scope of the present invention is not limited to the following examples. It will be appreciated by those skilled in the art that various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. The present invention provides general and / or specific descriptions of the materials and test methods used in the test. Although many materials and operating methods used to achieve the purpose of the present invention are well known in the art, the present invention is still described in as much detail as possible herein. The following examples further illustrate the present invention, rather than limiting the present invention.

[0027] Example 1 Obtaining wild-type mussel mucin

[0028] The amino acid sequence of the California mussel mucin (NCBI, XP_052063322.1) described in this example is as follows:

[0029] MKAKLILVVFIQSVYLCLTDAQNIIIEGDNPLVANGGDRKVIACKVVSGVANGENPDLKWYDNRGSIVTTSGRIFVLSQSATDLKLLLNDVQEDDAGSYNCTGFINGQLQSAHIVVKTKMPLIITEEQAPRTQLFPEGGSARIKCAPQGQVSVSWRDRNGTRIESSHERYVISPGYLEIPNVNRTDDGVYQCVVIGGGDFEVVKITVTVTVPPQIVKPPTAQSVSVGEAARFECVATAKPSPKYYWYFNSITIELTGERYNLSRDAGVLIIKKVIKDDAGTYKCVARSTDKSDEKDAALTVLVPPQINKLDNATGDEGTSATIKCTAYGEPIPKITWMKEGTSVEITDGTQIDNSDIVASQVARPDRMEVEGSLQISNLKSSDAGFYICKATNEAKSVEKSAYLSVQYKPNFSKVMKDVMYSWGGQSTNIKCIATGVPSADISWAKGGQTINAGDQYYSLKSVTIGEDTESTLTVSVDFSNEAIVFGVYTCKAGNAIGESTKNFTLQRADPPPSPSARLKETTPISITFDVNIPKTFNGPPVQEIEVRYSNAQPRKERVGTMDSKIEIVLDNLTPGTAYNIKVYAKNEVGLSPEYSLPTQTLQARKPYPIVVRSKPYGDYPLKFNLQWNTPNNGGFPISSVYVKYAQVEVFPNKSASNEFQRKEYISGWNPPITVDGAATAYEITSLKPSSYYEVEVTAVNNKGTSDARAFIFVTSKEDKRFQRPEEPTTEAPVEEITSKPSKKSQDTNSSAQQVPLGIVIAIIIIVVIILFIVIDVTCYYKRKCGVFMCIKEKVGRTGSMETRSKEKIIEEGDADGEKKVPLLADNKDTEGSDADQEIGETAPSDEKEPEDKEEKPITPVKEVEEAEEAKPEDQDKPASPKEETKEVTDGGKE(SEQ ID NO.1).

[0030] The nucleotide coding sequence of the mussel adhesive protein is shown as follows:

[0031]

[0032] The mucin nucleotide coding sequence was then synthesized by Suzhou Jinweizhi Biotechnology and constructed into the pPIC9K Pichia pastoris vector (Invitrogen, V17520) to obtain a mucin recombinant expression vector.

[0033] After kanamycin resistance screening, the constructed recombinant expression vector was verified by PCR using upstream and downstream verification primers. The primers used are as follows:

[0034] Upstream primer: ggtggcgaacggcggcgatcgca (SEQ ID NO.3), downstream primer: gcgcgctgctgttggtatcctgg (SEQ ID NO.4)

[0035] The obtained mucin recombinant expression vector was transferred into GS115 competent cells (Beijing Coolbo Technology, CC200), and a single colony was picked and cultured in BMGY medium (Beijing Coolbo Technology). A single colony was picked and inoculated in BMGY medium, cultured at 30°C and 220rpm until the OD600nm absorbance value was 2.0-6.0, and then the OD value was adjusted to 2.0 by adding new BMGY medium, and 0.5% methanol was added every 24h for induction. When the OD value reached about 5 again, the bacterial solution sample was collected and the expression supernatant was collected by centrifugation.

[0036] Example 2 Preparation of blood perfusion filler

[0037] 1. Prepare a poloxamer buffer solution with a pH value of 8.0 (concentration of 0.2 g / ml), and dissolve the SOD enzyme (beyotime, S0086) in the poloxamer buffer solution, wherein the amount of the SOD enzyme added to each 100 ml of the poloxamer buffer solution is 5 mg, the stirring temperature is 15° C., the stirring time is 1-2 min, and the poloxamer buffer solution containing the positively charged SOD enzyme is obtained by stirring at 12-16° C. for use;

[0038] 2. Using medical grade polystyrene resin, the polystyrene resin was placed in 3g / ml dilute hydrochloric acid, rinsed for 6 hours, and then rinsed with 0.5mol / L NaOH solution for 5 hours, and then the resin was immersed in pure water, ultrasonically cleaned for at least 5 times, the resin was separated, and dried to obtain an exchange resin with hydroxyl ions;

[0039] 3. Add the exchange resin with hydroxyl ions obtained in step 2 to the poloxamer buffer obtained in step 1, stir and mix for 6 minutes to obtain an exchange resin-poloxamer mixed solution; take the mucin obtained in Example 1, add it to the exchange resin-poloxamer mixed solution, the weight ratio of the resin to the mucin is 200g:90mg, the stirring speed is 200r / min, the stirring time is 60min, and a blood perfusion material mixture is obtained. After filtering out the liquid, the obtained blood perfusion material mixture is sterilized, and then aged at 4°C for 10d to obtain the final product of the blood perfusion material.

[0040] Example 3 Detection of free radical scavenging by perfusion filler

[0041] In order to evaluate the scavenging effect of the perfusion material obtained in Example 2 on free radicals, the applicant selected hydroxyl radicals as the scavenging index. For ease of detection, this example uses a hydroxyl radical assay kit (Nanjing Jiancheng Biology, A018-1-1) to measure the scavenging ability of the perfusion material on hydroxyl radicals (HO.).

[0042] 1. New Zealand rabbits were adaptively raised in an experimental environment at (24±2)°C and relative humidity (45±3)% and fed with standard feed. After 7 days, they were divided into a control group and a perfusion experimental group according to their body weight. The body weight of both groups was 2.5-3kg, with 3 rabbits in each group. Blood was collected from New Zealand rabbits before the perfusion experiment began.

[0043] 2. Both the control group and the experimental group were fed normally. The experimental group was perfused with a perfusion device containing blood perfusion material (50g). The perfusion blood volume was 180mL and the flow rate was 100mL / min. The blood perfusion was continued for three days. After the perfusion, blood was collected to measure the blood indicators of each group of New Zealand rabbits.

[0044] 3. The scavenging of hydroxyl radicals was detected by using the aforementioned hydroxyl radical determination kit. By comparing the differences before and after perfusion, as well as the hydroxyl radical index of the control group, it was found that both the control group and the experimental group had a hydroxyl radical scavenging effect ( Figure 1 ), while by comparison, the hydroxyl radicals in the experimental group were significantly reduced after perfusion, which indicates that the perfusion material described in the present application has the effect of scavenging free radicals.

[0045] Example 4 Obtaining mucin variants and testing perfusion effects

[0046] To evaluate the effects of different mucin variants on perfusion clearance, the applicant mutated mucin.

[0047] Based on protein structure and function prediction, the applicant found multiple sites that may affect its function, including five sites: L87, Q92, S471, K871, and G892. Through molecular simulation, the following five variants were found:

[0048] L87A, Q92R, S471A, K871L, G892I.

[0049] Mucin variants were generated by PCR-based site-directed mutagenesis. The specific method is to divide the DNA sequence of mucin into two parts with the mutation site as the center, design two pairs of primers to amplify the two parts of the DNA sequence respectively, and introduce the sequence to be mutated on the primers, and finally load the two fragments into the pPIC9K Pichia yeast vector (Invitrogen, V17520) by Gibson cloning to obtain a variant mucin recombinant expression vector, which can express five variants of L87A, Q92R, S471A, K871L, and G892I.

[0050] The mutated codons of the five variants are shown in the following table:

[0051]

[0052]

[0053] The perfusion material containing the five variants is obtained according to the method of Examples 1 and 2, and the perfusion effect of each variant is detected according to the method of Example 3.

[0054] It was found through testing that each variant has a scavenging effect on hydroxyl radicals, especially L87A, Q92R, K871L, and G892I, which have better scavenging effects.

[0055] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A mucin, wherein the mucin is subjected to a mutation selected from the group consisting of L87A, Q92R, K871L and G892I relative to the amino acid sequence shown in SEQ ID No.

1.

2. A blood perfusion filler composition comprising the mucin as claimed in claim 1, SOD enzyme, and resin.

3. A method for preparing a blood perfusion material, comprising the following steps: (1) preparing a poloxamer buffer solution with a pH value of 8.0, dissolving the SOD enzyme in the poloxamer buffer solution, and stirring at 12-16° C. to obtain a poloxamer buffer solution containing a positively charged SOD enzyme for use; (2) using medical grade polystyrene resin, placing the polystyrene resin in 3-5 g / ml dilute hydrochloric acid, washing for 3-6 hours, and then washing with 0.5 mol / L NaOH solution for 3-6 hours, then immersing the resin in pure water, ultrasonically cleaning at least 5 times, separating the resin, and drying to obtain an exchange resin with hydroxyl ions; (3) adding the exchange resin with hydroxyl ions obtained in step (2) to the poloxamer buffer obtained in step (1), stirring and mixing for 5-10 minutes to obtain an exchange resin-poloxamer mixed solution, taking the mucin according to claim 1, adding it to the exchange resin-poloxamer mixed solution, stirring for 30-60 minutes to obtain a blood perfusion material mixture, filtering out the liquid, sterilizing the obtained blood perfusion material mixture, and then aging at 4° C. for 5-12 days to obtain a final product of the blood perfusion material.

4. The preparation method according to claim 3, wherein the concentration of the poloxamer buffer in the step (1) is 0.2 g / ml, the amount of the SOD enzyme added to each 100 ml of the poloxamer buffer is 5 mg, the stirring temperature is 15° C., and the stirring time is 1-2 min.

5. The preparation method according to claim 3 or 4, wherein in step (3), the weight ratio of the resin to the mucin is 200 g:90 mg, the stirring speed is 200 r / min, and the stirring time is 60 min.

6. The preparation method according to claim 5, wherein in step (3), the exchange resin with hydroxyl ions obtained in step (2) is added to the poloxamer buffer obtained in step (1), and the mixture is stirred for 6 minutes to obtain an exchange resin-poloxamer mixed solution.

7. The preparation method according to claim 3 or 4, wherein the aging time in step (3) is 10 days.

8. Use of the mucin according to claim 1, the composition according to claim 2, or the preparation method according to any one of claims 3 to 7 in preparing a blood perfusion filler.

9. A blood perfusion device comprising the mucin according to claim 1 or the composition according to claim 2.

Images