A gene Xa47b mediating high resistance to rice bacterial blight and its use

Abstract

The present invention discloses a gene Xa47b that mediates high resistance to rice bacterial blight and its application. The application of gene Xa47b in regulating high resistance to rice bacterial blight, the gene ID of the gene Xa47b in the reference genome Nipponbare: LOC_Os11g36150. The Xa47b gene is a new gene that mediates high resistance to rice bacterial blight and has important application value in rice disease resistance breeding.

Description

Technical Field

[0001] The invention belongs to the field of rice, and in particular relates to a gene Xa47b mediating high resistance to rice bacterial blight and a use thereof. Background Art

[0002] Rice is one of the most important food crops in the world, with more than half of the world's population relying on rice as their staple food. As rice grows in a warm and humid environment, it is extremely vulnerable to pests and diseases throughout its entire growth and development stage. Among them, rice bacterial blight caused by Xanthomonas oryzae pv.oryzae (Xoo) is the most important bacterial disease of rice. Rice infection with bacterial blight generally reduces yield by 10-20%, and in severe cases can reach 60%, or even no grain is harvested. South China and East China are areas where rice bacterial blight often and repeatedly occurs. In recent years, due to the rapid increase in the incidence of new and highly pathogenic type IX bacterial blight pathogens, its morbidity rate for 500 Guangdong rice seed resources is as high as 96.40%, which makes rice production in Guangdong and even the rice-growing areas of South China face a greater risk of bacterial blight damage. Summary of the invention

[0003] The present invention aims to provide a gene Xa47b mediating high resistance to rice bacterial blight and its use

[0004] The nucleotide sequence of the gene Xa47b mediating high resistance to rice bacterial blight is shown in SEQ ID NO.1.

[0005] The present invention also provides application of the gene Xa47b in regulating high resistance to rice bacterial blight.

[0006] Preferably, the gene Xa47b is knocked out or gene-edited to make rice highly susceptible to bacterial blight.

[0007] The target site of the gene editing is 150-1: GGAGTCATCCCTTCATCTTT or 150-2: TGGTAAGATTCCTGTCTCGC.

[0008] When targeting the target site 150-1, the primer is: 150-gRT1:

[0009] GAGTCATCCCTTCATCTTTgttttagagctagaaat;150-OsU6aT1:

[0010] AAAGATGAAGGGATGACTCCggcagccaagccagca.

[0011] When targeting the target site 150-2, the primer is: 150-gRT2:

[0012] TGGTAAGATTCCTGTCTCGCgttttagagctagaaat; 150-OsU6bT2:

[0013] GCGAGACAGGAATCTTACCACaacacaagcggcagc.

[0014] The Xa47b gene is a new gene that mediates high resistance to rice bacterial blight and has important application value in rice disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the sequence variation information of the target sites of 14 Xa47b gene editing lines;

[0016] Figure 2 This is the lesion of the Xa47b gene-edited T1 strain 14 days after inoculation with type IX bacterial blight;

[0017] Figure 3 It is the variation detected in the Xa47b gene between the disease-resistant strain T1338 and the reference genome Nipponbare;

[0018] Figure 4 It is the sequence variation of Xa47b between resistant and susceptible sister lines. DETAILED DESCRIPTION

[0019] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0020] Embodiment 1:

[0021] 1 Construction of gene editing vector and genetic transformation of Xa47b gene

[0022] from http: / / rice.uga.edu / cgi-bin / gbrowse / rice / The sequence of Xa47b (gene ID: LOC_Os11g36150, CDS coding region as shown in SEQ ID NO.1) in the Nipponbare reference gene was downloaded and the CRISPR-P2.0 website ( http: / / crispr.hzau.edu.cn / CRISPR2 / ) online analysis function, in the first exon of Xa47b gene Design in the sub-section 2 A gene editing target site, whose nucleotide sequence is shown in SEQ ID NO.2 (the underline is the target site sequence), was synthesized based on the CRISPR / Cas9 system, the dominant sequence primers Cas150-1 and Cas150-2, and after annealing, they were connected into the pYLCRISPR / Cas9Pubi-H binary vector to obtain a recombinant expression vector targeting the target site. After sequencing verification by Sangon Biotech (Shanghai) Co., Ltd., the rice disease-resistant material Guanghui 1283 was transformed by the Agrobacterium EHA105-mediated method, and hygromycin was used as a screening marker to obtain transgenic regenerated plants.

[0023] 2. Resistance identification of genetically transformed plants and detection of target site variation

[0024] Seeds of 15 T0 generation genetic transformation lines were harvested to plant T1 generation lines. At the same time, the transformation recipient Guanghui 1283 was planted as a control. Type IX bacterial blight pathogen was inoculated by leaf cutting method before heading (ear panicle development stage VI). 4-5 leaves were cut from each individual plant, and the length of the lesions was investigated 14 days after inoculation.

[0025] Primer Premier 5 software was used to design the upper primer and lower primer of the detection marker TCAS150 upstream of the editing target site 1 and downstream of the target site 2, respectively. Leaves of T0 and T1 generation plants were taken, genomic DNA was extracted using the CTAB method, and PCR amplification target sites were sequenced and sequence variations were analyzed by comparison.

[0026] 3 Analysis of sequence variation of Xa47b gene in resistant and susceptible materials

[0027] To further understand the sequence variation of disease resistance genes, we assembled the genomes of the resistant and susceptible sister lines T1337 and T1338 from the same F5 generation strain, and compared the genome sequences of these two sister lines with the Nipponbare reference sequence of LOC_Os11g36150.

[0028] Experimental Results

[0029] 1 Two target sites were designed in the first exon of the Xa47b gene (underline, underline + italics are the positions of the detection primers) (SEQ ID NO.2)

[0030] GCATATCGCCGTTCTTGGGCAACCTATCCTTTCTCAAGACACTGGACCTTGGCAACAACCAGCTTGTCGGGCAGATACCTTCGGAGCTTGGTCACCTCAGCAAGCTTCGGATGCTGAATCTGAGCACAAATTTGCTCCGAGGAAGCATTCCTGTGGAGATGAGAGGATGCACCAAGCTCATGACCCTTCACCTA GGCAATAACCAGCTTCAAGGTGAGATCCCAGCTGAGATAGGTTCCAGCTTGAAAAATCTCATCAATTTATATCTTACCAGAAATCTTTTGTCGGGAGAGATCCCTCAATCTCTGGCCGAGTTACCATCGCTGGAACTGTTATCTTTGTCGCACAATAAATTATCTGGAGAGGTACCATCTGCTTTGAGCAATCTCACAAACCTCTTGAATATTCGTTTCTCCAATAACATGCTTTCA GGAGTCATCCCTTCATCTTTAGG CATGTTGCCCAATTTATATGAGCTCAGCTTAGGTTTTAACAATTTATCTGGACCAATCCCAACTTCTATTTGGAACATTTCATCTTTGAGGGCGCTTTCTGTCCAAGGAAATATGCTAAGTGGAACCATACCTGCTAATGCATTTGAAACTCTTCCACATCTCGAGGAATTATACATGGACCACAACCACCTCCA TGGTAAGATTCCTGTCTCGCTGG GTAATTCTTCCAATCTGTCAATGATTATCCTTGGCGCTAACCTTTTCAACGGCATTGTTCCCCAAGAGATTGGAAGACTAAGAAAGTTAGAACAACTTGTACTGACACAAACTTTAGTTGGAGCGAAAGAACAAAAAGATTGGGAGTTCATAACAGCATTAGCTAATTGCTCCCAGTTACAGGT TTTGGTATTGGGTATGTG TGAGTTTGGTGGGGTTCTTCCTAATT

[0031] Target site 1: GGAGTCATCCCTTCATCTTT

[0032] Corresponding primer 150-1:

[0033] 150-gRT1: GAGTCATCCCTTCATCTTTgttttagagctagaaat

[0034] 150-OsU6aT1: AAAGATGAAGGGATGACTCCggcagccaagccagca

[0035] Target site 2: TGGTAAGATTCCTGTCTCGC

[0036] Corresponding primer 150-2:

[0037] 150-gRT2:TGGTAAGATTCCTGTCTCGCgttttagagctagaaat

[0038] 150-OsU6bT2:GCGAGACAGGAATCTTACCACaacacaagcggcagc

[0039] 2. Target site variation detection and inoculation identification

[0040] 1) Target site variation detection

[0041] Target site detection marker TCAS150:

[0042] F:5'-GGCAATAACCAGCTTCAA-3'

[0043] R: 5'-CACATACCCAATACCAAA-3' amplified fragment size 680 bp

[0044] Among the 15 genetically transformed strains obtained ( Figure 1 ), the target site amplification sequencing results of strain 11 showed overlapping peaks and could not be compared. The sequencing results of the other 14 strains were compared with the wild-type Guanghui 1283 (registered for new plant variety rights of the Ministry of Agriculture and Rural Affairs of the People's Republic of China, application number 20221008912, application date November 7, 2022, and announced). At target site 1, except for strains 1, 6 and 13, other strains underwent different types of mutations; at target site 2, strain 6 did not mutate. Although strain 6 did not mutate at both target sites, T was inserted after target site 1, resulting in a frameshift mutation. Different types of mutations occurred in the remaining 13 strains.

[0045] 2) Inoculation and identification of Xa47b gene-edited strains

[0046] Combined with the sequencing results of the editing target sites, all 15 transformed strains showed high susceptibility to type IX bacterial blight ( Figure 2 ), indicating that this gene mediates high resistance to rice bacterial blight.

[0047] 3 Gene sequence variation of Xa47b in resistant materials

[0048] We assembled the genomes of the resistant and susceptible sister lines T1337 and T1338 and compared them with the gene LOC_Os11g36150 in the Nipponbare reference genome. We found that only two single base variations were detected in the first exon of Xa47b in the highly resistant material T1338 ( Figure 3We further analyzed the sequence variation of Xa47b between resistant and susceptible sister lines and found that in addition to some single-base variations, there were multiple insertions / deletions in the 5'UTR, first exon, and introns ( Figure 4 ).

[0049] Xa47b gene (SEQ ID NO.1)

[0050]

[0051] The genome sequence of Xa47b gene in disease-resistant materials T1338 and Guanghui 1283:

[0052]

[0053] Note: 1-158 is 5'UTR, 159-2906 and 3118-3477 are exons, 2907-3117 is the intron region, and 3478-3769 is 3'UTR.

Claims

1. Genes that mediate high resistance to rice bacterial blight XOtM , characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. The gene according to claim 1 XOtM The application is characterized in that Knockout XOtM Makes rice highly susceptible to bacterial leaf blight.

3. The use according to claim 2, characterized in that: The target site of the knockout is 150-1: GGAGTCATCCCTTCATCTTT or 150-2: TGGTAAGATTCCTGTCTCGC.

4. The use according to claim 3, characterized in that: For the target site 150-1, the primers are: 150-gRT1:GAGTCATCCCTTCATCTTTgttttagagctagaaat; 150-OsU6aT1: AAAGATGAAGGGATGACTCCggcagccaagccagca.

5. The use according to claim 3, characterized in that: When targeting the target site 150-2, the primers are: 150-gRT2:TGGTAAGATTCCTGTCTCGCgttttagagctagaaat; 150-OsU6bT2:GCGAGACAGGAATCTTACCACaacacaagcggcagc.

Images