Cell-labeled microbeads and their preparation methods and applications

Abstract

The present invention discloses a cell-labeling microbead, a preparation method and an application thereof, relating to the field of biological detection. The cell-labeling microbead includes a microbead, a universal primer sequence, a cell label and a linking sequence that are sequentially coupled to the microbead; wherein, the universal primer sequence is used to bind to a primer compatible with a sequencer, and dC in the universal primer sequence is 5-Methyl dC; the cell label is used to trace and identify target cells, and the bases in the cell label include A base, T base, G base; the linking sequence is used to link the cell label to the target cells. The technical solution of the present invention avoids base conversion by removing unmethylated C bases in the universal primer sequence and the cell label sequence, and realizes the construction of a high-throughput single-cell DNA methylation library; by labeling multiple sequences on the microbead, the number of primer syntheses and costs are significantly reduced, which helps to promote the development and application of high-throughput sequencing technology for single-cell DNA methylomes.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly relates to a cell-tagging microbead, a preparation method thereof, and an application thereof. Background Art

[0002] As an important epigenetic marker, DNA methylation is involved in determining the opening or closing of biological regulatory processes. Single-cell methylation sequencing is an important technical means for exploring the epigenetic heterogeneity among cells in a multicellular biological system, and may be of more important significance for research on embryonic development, cell differentiation, the occurrence and development of tumors, etc.

[0003] With the continuous development of single-cell omics technologies, it has also become possible to study single-base methylation of DNA at the single-cell level, and a number of single-cell methylation sequencing technologies have emerged one after another, such as scBS-seq, scWGBS-seq, snmC-seq, sc-sciMET, and scTAM-seq, etc. The emergence of these technologies is of great significance for the exploration of epigenetic information of highly heterogeneous cells. However, in these reported technologies, the preparation of single-cell libraries has evolved from initially separating single cells in sample tubes or well plates for individual library construction, to labeling cells with indexed random primers in well plates, and finally to labeling single cells with combinatorial tags without physical separation of single cells. Although the technological updates have significantly increased the cell throughput, it is still difficult to meet the throughput requirements for detecting 10 4 -10 5 single cells while elucidating the diversity of cells in complex tissues. Summary of the Invention

[0004] The main object of the present invention is to propose a cell-tagging microbead, a preparation method thereof, and an application thereof, aiming to improve the single-cell labeling throughput.

[0005] To achieve the above object, the present invention proposes a cell-tagging microbead, which includes a microbead, a universal primer sequence, a cell tag, and a linker sequence that are sequentially coupled to the microbead;

[0006] wherein, the universal primer sequence is used to bind to a primer compatible with a sequencer, and dC in the universal primer sequence is 5-Methyl dC;

[0007] the cell tag is used to trace and identify target cells, and the bases in the cell tag include at least one of A base, T base, and G base;

[0008] the linker sequence is used to link the cell tag to a target cell.

[0009] In one embodiment, the cell-labeled microbeads further include a molecular tag sequence, which is coupled between the cell label and the linking sequence, and the bases in the molecular tag sequence include at least one of A base, T base, and G base.

[0010] In one embodiment, the cell label includes a first cell label, an intermediate sequence, and a second cell label;

[0011] The intermediate sequence is used to connect the first cell label and the second cell label;

[0012] The first cell label and the second cell label are used to label the same cell.

[0013] In one embodiment, 10 5 ~10 10 nucleic acid sequences with the same cell label are labeled on each microbead.

[0014] In one embodiment, the types of the cell labels are 10 2 ~10 8 species.

[0015] In one embodiment, the microbeads are hydrogel microbeads or polymer magnetic beads.

[0016] The present invention also provides a method for preparing cell-labeled microbeads, comprising the following steps:

[0017] S10. Provide a universal primer sequence, a cell label sequence, and a linking sequence;

[0018] S20. Label the 5'-end of the universal primer sequence onto the microbeads to obtain coupled microbeads;

[0019] S30. Label the cell label sequence and the linking sequence onto the universal primer sequence of the coupled microbeads in sequence to obtain cell-labeled microbeads;

[0020] wherein, the cell-labeled microbeads are the aforementioned cell-labeled microbeads.

[0021] In one embodiment, the cell label sequence includes a first cell label, an intermediate sequence, and a second cell label;

[0022] Step S30 includes the following steps:

[0023] S31. Label the first cell label onto the universal primer sequence of the coupled microbeads to obtain first-labeled microbeads;

[0024] S32. Label the intermediate sequence, the second cell label, and the linking sequence onto the first cell label of the first-labeled microbeads to obtain cell-labeled microbeads.

[0025] In one embodiment, the cell tag sequence further includes a molecular tag sequence;

[0026] Step S32 includes:

[0027] Labeling the intermediate sequence, the second cell tag, the molecular tag sequence, and the linker sequence onto the first cell tag of the microbead to obtain a cell tag microbead.

[0028] The present invention also provides an application of the cell tag microbead as described above, or the cell tag microbead prepared by the preparation method as described above, in the detection of high-throughput single-cell whole-genome DNA methylation.

[0029] The technical solution of the present invention realizes the construction of a high-throughput single-cell DNA methylation library by replacing dC in the universal primer sequence with 5-Methyl dC and removing C bases in the cell tag sequence to avoid base conversion; by labeling multiple sequences onto the microbead, the primer synthesis quantity and cost are significantly reduced, which helps to promote the development and application of high-throughput sequencing technology for single-cell DNA methylome. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on the structures shown in these drawings.

[0031] Figure 1 It is a schematic structural diagram of an embodiment of the cell tag microbead provided by the present invention;

[0032] Figure 2 It is a schematic diagram of the three-segment sequence structure of the cell tag microbead;

[0033] Figure 3 It is a schematic diagram of coating an adapter sequence Tn5 transposase to break genomic DNA and ligate cell tags in Example 2 of the present invention;

[0034] Figure 4 It is an electrophoresis diagram of genomic DNA broken by Tn5 in cells / nuclei in Example 2 of the present invention;

[0035] Figure 5 It is a schematic diagram of library construction in Example 2 of the present invention;

[0036] Figure 6 It is a structural diagram of the DNA methylation sequencing library in Example 2 of the present invention;

[0037] Figure 7 This is the gel electrophoresis diagram before and after the ligation sequence 2 of the cell-labeled hydrogel beads in Example 2 of the present invention;

[0038] Figure 8 This is the quality control diagram of the cell-labeled hydrogel beads before the ligation sequence 2 in Example 2 of the present invention;

[0039] Figure 9 This is the quality control diagram of the cell-labeled hydrogel beads after the ligation sequence 2 in Example 2 of the present invention;

[0040] Figure 10 This is the quality control diagram of the cell-labeled hydrogel beads after the ligation sequence 3 in Example 2 of the present invention;

[0041] Figure 11 This is the quality control diagram of the cell-labeled hydrogel beads after removing the complementary strand in Example 2 of the present invention;

[0042] Figure 12 This is the quality control diagram (A) of the secondary fragmentation fragments and the quality control (B) diagram of the successfully constructed single-cell methylation library provided in Example 2 of the present invention;

[0043] Figure 13 This is the cell clustering analysis result diagram based on the methylation level of single-cell CpG sites provided in Example 2 of the present invention.

[0044] Explanation of the reference numerals in the attached drawings:

[0045] 100, cell-labeled microbeads; 1, microbeads; 2, universal primer sequence; 3, cell label; 4, molecular label; 5, ligation sequence; 6, cleavable group.

[0046] The realization, functional features and advantages of the object of the present invention will be further described in conjunction with the embodiments with reference to the accompanying drawings. Detailed implementation manners

[0047] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0048] It should be noted that if there are directional indications (such as up, down, left, right, front, back...) involved in the embodiments of the present invention, the directional indications are only used to explain the relative positional relationship and movement conditions between components in a specific posture. If the specific posture changes, the directional indications will also change accordingly.

[0049] In addition, if the embodiments of the present invention involve descriptions such as "first", "second", etc., the descriptions of "first", "second", etc. are only for descriptive purposes and should not be construed as indicating or implying their relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include at least one such feature. In addition, if "and / or" or "and / or" appears throughout the text, its meaning includes three parallel scenarios. Taking "A and / or B" as an example, it includes scenario A, or scenario B, or the scenario where both A and B are satisfied simultaneously. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the ability of those of ordinary skill in the art to implement. When the combination of technical solutions results in contradictions or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0050] As an important epigenetic marker, DNA methylation is involved in determining the activation or inactivation of biological regulatory processes. Single-cell methylation sequencing is an important technical means to explore the epigenetic heterogeneity among cells in a multicellular biological system, and it may be of greater significance for research on embryonic development, cell differentiation, the occurrence and development of tumors, etc.

[0051] With the continuous development of single-cell omics technologies, it has also become possible to study single-base DNA methylation at the single-cell level, and some single-cell methylome sequencing technologies have emerged one after another, such as scBS-seq, scWGBS-seq, snmC-seq, sc-sciMET, and scTAM-seq, etc. The emergence of these technologies is of great significance for the exploration of epigenetic information of highly heterogeneous cells. However, in these reported technologies, the preparation of single-cell libraries has evolved from initially separating single cells in sample tubes or well plates for individual library construction, to labeling cells with indexed random primers in well plates, and finally to labeling single cells with combinatorial tags without physical separation of single cells. Although the technological updates have significantly increased the cell throughput, it is still difficult to meet the throughput requirement of detecting 10 4 -10 5 single cells simultaneously to clarify the cell diversity of complex tissues.

[0052] In view of this, please refer to Figures 1 to 13 , the present invention provides a cell-labeling microbead 100, whose structure is as shown in Figure 1As shown, the cell label microbead 100 includes a microbead 1, a universal primer sequence 2, a cell label 3, and a linker sequence 5 that are sequentially coupled to the microbead 1. Among them, the universal primer sequence 2 is used to bind to a primer compatible with a sequencer, and dC in the universal primer sequence 2 is 5-Methyl dC. The cell label 3 is used to trace and identify target cells, and the bases in the cell label 3 include at least one of A base, T base, and G base. The linker sequence 5 is used to link the cell label 3 to the target cell.

[0053] The technical solution of the present invention realizes the construction of a high-throughput single-cell DNA methylation library by replacing dC in the universal primer sequence 2 with 5-Methyl dC and removing the C base in the cell label 3 sequence to avoid base conversion. By labeling multiple sequences on the microbead 1, the number of primer syntheses and costs are significantly reduced, which helps to promote the development and application of high-throughput sequencing technologies for single-cell DNA methylomes.

[0054] It should be noted that the universal primer sequence 2 in the present invention is the same in different microbeads 1. The universal primer sequence 2 is a specific sequence and is the binding region of a primer compatible with a sequencer, such as the sequencing primers of sequencing platforms such as illumina and MGIseq. The cell label 3 (Cell Barcode) can label individual cells with unique genetic identifiers or barcodes so that they can be traced. The cell label 3 only contains three bases, A, T, and G, and does not contain the C base. The linker sequence 5 is an artificially synthesized DNA sequence, which is the same in different microbeads 1, and its length ranges from 2 to 30 bp, preferably 5 to 18 bp. The sequence can be any sequence, which can contain four bases, A, T, C, and G, or only three bases, A, T, and G. Preferably, the sequence does not contain a hairpin structure. The function of the linker sequence 5 is to connect to the target DNA to achieve cell labeling of the target DNA.

[0055] Specifically, in some embodiments of the present invention, base conversion needs to be performed on the sample to be tested before sequencing, that is, unmodified C is converted to U, while 5-Methyl dC does not undergo conversion. To prevent the C in the universal primer sequence 2 from being converted, all dC in the universal primer sequence 2 are 5-Methyl dC. In another embodiment of the present invention, a cleavable group 6 is contained between the microbead 1 and the sequencing adapter sequence. The cleavable group 6 can fall off from the microbead 1 under specific stimulation conditions, such as light stimulation or chemical stimulation.

[0056] The technical solution of the present invention realizes the construction of a high-throughput single-cell DNA methylation library by replacing dC in the universal primer sequence 2 with 5-Methyl dC and removing the C base in the cell tag 3 sequence to avoid base conversion; by labeling multiple sequences on the microbead 1, the number of primer syntheses and costs are significantly reduced, which helps to promote the development and application of high-throughput sequencing technology for single-cell DNA methylomes.

[0057] In one embodiment, the cell tag microbead 100 further includes a molecular tag 4 sequence, which is coupled between the cell tag 3 and the linker sequence 5, and the bases in the molecular tag 4 sequence include at least one of A base, T base, and G base.

[0058] The technical solution of the present invention can add both the cell tag 3 and the molecular tag 4 sequence to single-cell DNA by using the molecular tag 4, increasing the types of cell tag microbeads 100, so that the cell tag microbeads 100 reduce the requirements for the types of cell tag 3 and molecular tag 4, and at the same time increase the diversity quantity of the cell tag 3 to meet the high-throughput labeling requirements. Preferably, the length of the molecular tag 4 is 8-15 bp; in some embodiments of the present invention, the molecular tag 4 is a 12-bp random degenerate base DDDDDDDDDDDD, and different molecular tag 4 sequences are labeled on a single microbead 1.

[0059] In one embodiment, the cell tag 3 includes a first cell tag, an intermediate sequence, and a second cell tag; the intermediate sequence is used to connect the first cell tag and the second cell tag; the first cell tag and the second cell tag are used to label the same cell.

[0060] It should be noted that the sequences and lengths of the first cell tag and the second cell tag can be the same or different, and are not limited herein; the same cell tag 3 is labeled on each microbead 1, and different types of cell tag 3 nucleic acid sequences are labeled on different microbeads 1.

[0061] The technical solution of the present invention can add both the first cell tag and the second cell tag to a single cell by using the first cell tag and the second cell tag. The diversity quantity of the cell tag 3 is the number of types of the first cell tag sequence multiplied by the number of types of the second cell tag, thereby increasing the diversity quantity of the cell tag 3. In some embodiments of the present invention, the intermediate sequence is 2 bp.

[0062] In one embodiment, 10 5 ~10 10 nucleic acid sequences with the same cell tag 3 are labeled on each microbead 1. The technical solution of the present invention labels 10 5 ~1010 A nucleic acid sequence that can increase the nucleic acid sequence loading amount of the cell label microbeads 100, so as to facilitate adding different cell labels 3 to different cells.

[0063] In one embodiment, there are 10 2 ~10 8 kinds of cell labels 3. Preferably, there are 10 5 ~10 7 kinds of cell labels 3.

[0064] In one embodiment, the microbeads 1 are hydrogel microbeads or polymer magnetic beads. Specifically, in some embodiments of the present invention, the microbeads 1 are hydrogel microbeads, so as to be adapted to the droplet microfluidic system. The droplet microfluidic technology can generate tens of thousands of water-in-oil droplets as reaction pools in a short time.

[0065] The present invention also provides a method for preparing cell label microbeads, including the following steps: S10. Provide a universal primer sequence, a cell label sequence, and a linker sequence; S20. Label the 5' end of the universal primer sequence onto the microbeads to obtain coupled microbeads; S30. Label the cell label sequence and the linker sequence onto the universal primer sequence of the coupled microbeads in sequence to obtain cell label microbeads; wherein, the cell label microbeads are the aforementioned cell label microbeads.

[0066] It should be noted that the universal primer sequence, the cell label sequence, and the linker sequence can be synthesized separately to form multiple fragments; in order to ensure cell label diversity while saving the primer synthesis cost, the cell labels can be synthesized in multiple fragments.

[0067] Since the method for preparing the cell label microbeads of the present invention adopts all the technical solutions of the above-mentioned all embodiments, it at least has all the beneficial effects brought by the technical solutions of the above-mentioned embodiments, and will not be elaborated herein one by one.

[0068] In one embodiment, the cell label sequence includes a first cell label, an intermediate sequence, and a second cell label; step S30 includes the following steps: S31. Label the first cell label onto the universal primer sequence of the coupled microbeads to obtain first-label microbeads; S32. Label the intermediate sequence, the second cell label, and the linker sequence onto the first cell label of the first-label microbeads to obtain cell label microbeads.

[0069] The technical solution of the present invention divides the cell label sequence into two segments, namely the first cell label sequence and the second cell label sequence. The number of cell label diversities is the product of the number of types of the first cell label sequence and the number of types of the second cell label sequence, thereby increasing cell label diversity.

[0070] In one embodiment, the cell tag sequence further includes a molecular tag sequence; step S32 includes: labeling the intermediate sequence, the second cell tag, the molecular tag sequence, and the linking sequence onto the first cell tag of the first tag bead to obtain a cell tag bead.

[0071] In one embodiment of the present invention, as Figure 2 shown, three bead-conjugated primer sequences are first synthesized respectively: sequence 1, sequence 2, and sequence 3. Sequence 1 contains a universal primer sequence, sequence 2 contains a first cell tag, and sequence 3 contains an intermediate sequence, a second cell tag, a molecular tag sequence, and a linking sequence. To ensure cell tag diversity while saving primer synthesis costs, preferably the cell tag sequence is at least divided into two segments, namely the first cell tag sequence and the second cell tag sequence, and the number of cell tag diversities is the number of types of the first cell tag sequence multiplied by the number of types of the second cell tag sequence. Among them, sequence 1 contains a universal primer sequence, sequence 2 contains the first cell tag sequence, and sequence 3 contains an intermediate sequence, the second cell tag sequence, a molecular tag sequence, and a linking sequence.

[0072] The universal primer sequence in sequence 1 is a sequencing primer binding sequence. To prevent the universal primer sequence, the cell tag sequence, and the molecular tag sequence from being transformed during base conversion, dC in sequence 1 is 5-Methyl dC. Both the first cell tag sequence and the second cell tag sequence contain only three bases A, T, and G. The nucleic acid sequences and lengths of the two cell tags can be the same or different. Further, the first tag sequence and the second tag sequence are connected through a specific intermediate sequence. Similarly, this intermediate sequence contains only three bases A, T, and G and has a length of 2 - 10 bp; in some embodiments of the present invention, the length of the intermediate sequence is 2 bp. The molecular tag sequence and the linking sequence are sequentially conjugated after the second cell tag. The molecular tag sequence contains only three bases A, T, and G. Preferably, DDDDDDDDDDDD degenerate bases are selected. The linking sequence is a specific sequence. Different beads all contain the same linking sequence, which can be any sequence, either containing four bases A, T, C, and G or only three bases A, T, and G. Preferably, the linking sequence does not contain a hairpin structure. In some embodiments of the present invention, the linking sequence has a fixed length of 7 bp. The three nucleic acid sequences conjugated to the beads, sequence 1, sequence 2, and sequence 3, are sequentially ligated through two enzymatic reactions.

[0073] The present invention also proposes an application of the cell tag bead as described above, or the cell tag bead prepared by the preparation method as described above, in the detection of high-throughput single-cell whole-genome DNA methylation.

[0074] The technical solutions of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention. For the methods without specific conditions noted in the embodiments, conventional methods and conditions in the art are adopted, or the conditions recommended by the instrument manufacturer are followed.

[0075] Example 1 Preparation of High-throughput Single-cell DNA Methylation Cell-labeled Hydrogel Beads

[0076] This example provides a method for preparing cell-labeled hydrogel beads suitable for high-throughput single-cell DNA methylation sequencing. According to the following method, 589,824 kinds of diverse hydrogel beads can be synthesized.

[0077] 1) Synthesize single-stranded nucleic acids with the following sequences respectively according to the table below. Among them, "D1D1D1D1D1D1D1D1" and "D2D2D2D2D2D2D2D2" are 8-bp cell labels without C bases. "H1H1H1H1H1H1H1H1" in sequence 2' is the reverse complementary sequence of "D1D1D1D1D1D1D1D1" in sequence 2, and "H2H2H2H2H2H2H2H2" in sequence 3' is the reverse complementary sequence of "D2D2D2D2D2D2D2D2" in sequence 3. "D3D3D3D3D3D3D3D3D3D3D3D3" is a 12-bp molecular label without C bases. Synthesize 1 kind of sequence 1, 768 kinds of sequence 2, 768 kinds of sequence 3, 768 kinds of sequence 2', and 768 kinds of sequence 3' respectively according to different cell labels. Both sequence 2 and sequence 3 are phosphorylated at the 5' end.

[0078] Table 1 Sequences of Cell Labels

[0079]

[0080] 2) Prepare hydrogel beads. First, dissolve the primer of sequence 1 in Nuclease-free Water to 1000 mM, prepare an oil-in-water aqueous solution containing sequence 1, and filter the prepared solution through a 0.2 mm filter membrane. Use the SeekOne microfluidic control system and droplet generation chip to generate oil-in-water droplets. The specific operation refers to the instrument instruction manual. When generating oil-in-water, it is necessary to observe and measure in real time under a microscope, adjust the corresponding parameters, and generate oil-in-water droplets with uniform size. After the generation of oil-in-water is completed, solidify overnight. After the solidification is completed, first use a pipette to remove the oil phase, add 5.5 mL of demulsifier to the remaining droplets, vortex and mix for 20 seconds, centrifuge at 3000 g for 3 minutes, remove the bottom oil phase, and repeat this step once to obtain solidified hydrogel beads.

[0081] 3) Hydrogel beads are linked to Sequence 2. First, dilute Sequence 2 and Sequence 2' to 250 mM with Nuclease-free Water. Mark the primer names on a 96-well plate. Anneal Sequence 2 and Sequence 2' corresponding to the cell tag sequence in order.

[0082] Aspirate 30 μL of the annealed Sequence 2 and add it to the 96-well plate in order. The hydrogel beads obtained in the previous step are washed three times with 0.01 M Tris-HCl (pH 8.0), resuspended and counted. Add 10 w hydrogel beads, 50 μL of ligation buffer, and 2 μL of ligase (DTT - ), and make up the volume to 100 μL with 0.01 M Tris-HCl (pH 8.0). After ligation, each well is washed five times with 200 μL of 0.01 M Tris-HCl (pH 8.0) and resuspended. Randomly select several wells, aspirate 1 μL of hydrogel beads, lyse them and perform Agilent 4200 TapeStation detection. The qualified peak pattern is around 25 bp, without obvious heterologous bands (refer to Figure 7 , Figure 8 and Figure 9 ). After passing the detection, the hydrogel beads in each well are combined and transferred to a 50 mL centrifuge tube, washed three times with 0.01 M Tris-HCl (pH 8.0), and resuspended with 0.01 M Tris-HCl (pH 8.0), and counted.

[0083] 4) Hydrogel beads are linked to Sequence 3. First, dilute Sequence 3 and Sequence 3' to 250 mM with Nuclease-free Water. Mark the primer names on a 96-well plate. Anneal Sequence 3 and Sequence 3' corresponding to the cell tag sequence in order.

[0084] Aspirate 30 μL of the annealed Sequence 3 and add it to the 96-well plate in order. Add 10 w hydrogel beads, 50 μL of ligation buffer, and 2 μL of ligase (DTT - ), and make up the volume to 100 μL with 0.01 M Tris-HCl (pH 8.0). After ligation, each well is washed five times with 200 μL of 0.01 M Tris-HCl (pH 8.0) and resuspended with 0.01 M Tris-HCl (pH 8.0). Randomly select several wells, aspirate 1 μL of hydrogel beads, lyse them and perform Agilent 4200 TapeStation detection. The qualified peak pattern is around 66 bp, without obvious heterologous bands (refer to Figure 10After passing the detection, the hydrogel beads in each well were combined and transferred to a 50 mL centrifuge tube.

[0085] 5) Denature and remove the complementary sequences Sequence 2' and Sequence 3'. After mixing the hydrogel beads, transfer them to eight 15 mL centrifuge tubes, centrifuge at 4000 g for 2 min, and remove the supernatant. Add 10 mL of 0.1 M NaOH to each tube, react at 95 °C for 10 min, centrifuge at 4000 g at room temperature for 2 min, remove the supernatant, and repeat this step twice. Pipette and lyse 2 μL of hydrogel beads, and detect with an Agilent 4200 TapeStation. The qualified peak pattern is around 41 bp, without obvious heterobands (refer to Figure 11 )

[0086] Example 2 Detection of 5mC and 5hmC Epigenetic Modifications of High-Throughput Single-Cell Whole-Genome DNA

[0087] This example provides a method for detecting 5mC and 5hmC epigenetic modifications of high-throughput single-cell whole-genome DNA based on the cell-tagged beads of the present invention. The specific process includes:

[0088] (1) Fix cells / nuclei and remove nucleosomes to loosen genomic DNA;

[0089] (2) Fragment DNA in cells;

[0090] (3) Generate a water-in-oil droplet by combining a DNA-fragmented cell with a bead disclosed in this patent. The bead releases the coupled cell-tag nucleic acid sequence to ligate and label the fragmented DNA in the water-in-oil partition, generating DNA with a cell tag;

[0091] (4) Uncrosslink and release DNA from cells, and perform base conversion;

[0092] (5) Amplify the converted DNA and construct a DNA methylation library;

[0093] (6) Sequence and analyze single-cell DNA methylation data.

[0094] To detect the single-base methylation level of DNA in the whole genome, it is necessary to remove nucleosome proteins while ensuring the integrity of cells / nuclei, and convert chromosomes into open chromatin to achieve unbiased fragmentation of whole-genome DNA. First, fix, permeabilize, and remove nucleosomes from cells / nuclei. The fixing reagents include but are not limited to aldehydes, alcohols, and DSP fixing reagents; the permeabilizing reagents include but are not limited to surfactants such as Triton X-100, Tween 20, NP40, or alcohol reagents; the nucleosome-removing reagents include but are not limited to detergents or acid reagents such as sodium dodecyl sulfate (SDS), sodium glycocholate, and quaternary ammonium compounds.

[0095] Within a single fixed cell / nucleus, the Tn5 transposase cleaves DNA and inserts an adapter sequence. In addition to containing the ME sequence, the adapter sequence contains at least a nucleic acid sequence at the 5' end of the ME sequence that can be used for ligating cell tags or PCR. The 5' end of this nucleic acid sequence may or may not contain a phosphate modification, and this 5' phosphate modification can be used for the next ligation with the cell tag nucleic acid sequence; if there is no 5' phosphate modification, a phosphokinase such as T4 PNK needs to be added to the ligation system. Further, the Tn5 transposase coats two adapter sequences, and the nucleic acid sequences can be either the same primer sequence or two different primer sequences. Since the length of DNA fragmentation in the cell / nucleus is too long, with an average length of about 1300 bp, as Figure 4 shown, not performing secondary fragmentation for library construction and sequencing will result in some sequences not being detected, reducing the genome coverage. Therefore, it is preferred to perform secondary fragmentation during library construction. To prevent the loss of DNA sequence information at the end of the cell tag sequence that is not ligated during re-fragmentation, it is preferred that Tn5 coats the same adapter sequence, as Figure 3 shown. This adapter sequence is ligated to the cell tag sequence on the microbeads, so that both ends of the DNA carry cell tag information. After secondary fragmentation, both ends of the DNA after the first fragmentation carry a complete amplification primer binding sequence and cell tags, so that the full-length DNA sequence information after the first fragmentation is retained.

[0096] The contact between a cell / nucleus after Tn5 transposition and a single microbead with a cell tag is completed in batches in a water-in-oil droplet. The droplet partitioning technology based on water-in-oil is represented by the 10X Genomics, Drop-Seq platform, and inDrop platform. Such technologies use microfluidics to encapsulate barcode-labeled microbeads and single cells in an oil droplet. In this example, each hydrogel microbead is conjugated with a ligation sequence containing a cell tag and a molecular tag; these ligation sequences enter the fixed cell / nucleus, and different cell tags are labeled on the DNA from different cell sources through enzymatic ligation and used for subsequent pooled library construction and sequencing analysis. The main difference between this patent and the existing liquid partitioning technology before is that the nucleic acid sequence with a cell tag ligated to the microbeads in this article is not the reverse transcription primer in the ordinary single-cell transcriptome technology, but a nucleic acid sequence that can be ligated to the transposon. This patent realizes the ligation of a single cell (nucleus) with a unique cell tag in a large number of physically partitioned droplets, thereby achieving high-throughput labeling of different cell tags on the DNA from different cells and the same cell tags on the DNA from the same cell. The ligation reaction process and participating molecules such as Figure 3As shown. The number of cells that can be independently labeled can be between 100 and 1,000,000, depending on the number of water-in-oil droplets. Usually, the number of droplets needs to be 10 times or more of the number of cells to be detected to ensure a low probability of cell label repetition. Inside the water-in-oil, the primers conjugated on the microbeads are released under specific stimulation conditions and enter the permeable cells / nuclei, and are directionally ligated to the adapter sequences of the Tn5 transposon inserted into the genomic DNA. Since the cell tag primers are derived from the same microbead, the DNA of the same cell / nucleus all carries the same cell tag.

[0097] The DNA labeled with cell tags is released from the cells / nuclei and mixed. After base conversion, a library is constructed. The specific process is as Figure 5 shown. Base conversion can use chemical conversion methods such as bisulfite, or enzymatic conversion such as TET combined with APOBEC. Preferably, enzymatic conversion is selected. This method has less damage to DNA and can retain more DNA sequences with the complete structure of cell tags. After the converted DNA is amplified using U-resistant amplification enzymes, library construction is carried out. The two ends of the amplified DNA have the same universal primer sequences. At the same time, the length of the DNA fragments after Tn5 interruption in the cells is too long, with an average length of about 1300 bp. Therefore, secondary interruption is also required to reduce the length of the library DNA insert fragments, and at the same time add the other end of the universal primer sequence. This process can be carried out in various ways, such as Tn5 transposase interrupting and inserting adapters, fragmenting enzymes interrupting and ligating adapters, random primer amplification, etc. The DNA with added adapters is amplified with double-end index primers, and the library structure is as Figure 6 shown.

[0098] The detection scheme for high-throughput single-cell whole-genome DNA 5mC and 5hmC is as follows:

[0099] 1) Cell fixation and nucleosome removal

[0100] Digest and count the freshly cultured prostate cancer cell lines PC-3 and 22Rv1. For each of the two cell types, 10 w is aspirated and added to a formaldehyde solution with a final concentration of 1%. Pipette and mix well, and fix at 26°C for 20 min. After washing once with NE buffer, add SDS and incubate with shaking for 30 min to remove nucleosomes. After the reaction is completed, wash once with PBS, centrifuge at 2000 g at 4°C for 5 min, remove the supernatant, add PBS to resuspend the cells and count.

[0101] 2) Insertion of adapter sequences by Tn5 transposition inside cells

[0102] Absorb 1 w cells according to the counting result, centrifuge at 2000 g for 5 min at 4°C, retain 5 μL of cells, remove the remaining supernatant, and use the transposase complex Tn5 Enzyme 1 coated with the same adapter sequence (ttgctgtcgtccgtcgtAGATGTGTATAAGAGACAG, SEQ ID NO.6) to fragment genomic DNA in the cells. Prepare the reaction system according to the following table, pipette 20 times to mix evenly, and react at 55°C for 2 h. After the reaction, wash and resuspend with PBS and count.

[0103] Table 2 Reaction System

[0104]

[0105] 3) Water-in-oil generation and cell labeling

[0106] According to the target cell capture number, calculate the input volume of the cell sample according to a 50% cell capture efficiency. In this example, the PC-3 and 22Rv1 cell lines are input at a ratio of 2:1, and 800 and 400 cells are input respectively. First, according to the cell count, absorb the corresponding volume of cells, supplement Nuclease-free Water to 64.2 μL in the cell resuspension, prepare the ligation system on ice according to the following table and add it to the cell sample. The reagents for this step are all from the SeekOne® DD single-cell water-in-oil ligation kit. Use the SeekOne digital droplet instrument of Beijing Xunyin Biotechnology Co., Ltd. to complete the water-in-oil generation. The ligation program is 16°C, 2 h; 65°C, 10 min; 4°C, Hold.

[0107] Table 3 Ligation System

[0108]

[0109] 4) Decrosslinking to release genomic DNA

[0110] After ligation, use the SeekOne DD single-cell decrosslinking kit to decrosslink and release genomic DNA. First, add 100 μL of Demulsion Agent to the ligation system, let it stand at room temperature for 2 min, centrifuge instantaneously, slowly aspirate and remove 130 μL of the oil-phase mixture from the bottom of the PCR tube, add 90 μL of DCL Buffer and 18 μL of Enzyme K1 to the upper-layer reaction solution, mix well by oscillation, and react at 55°C at 500 rpm for 2 h. Purify the released DNA with Cleanupbeads in the SeekOne® DD single-cell purification kit, and resuspend the DNA with 30 μL of Nuclease-free Water.

[0111] 5) Base conversion

[0112] After decrosslinking, the DNA is first filled in with an extender enzyme to repair the nicks generated by Tn5 cleavage. This step uses unmodified dATP, dGTP, and dTTP, and methyl-modified 5-methyl-dCTP. After the extension product is purified using 1x DNA sorting magnetic beads, the DNA is subjected to base conversion using the NEBNext® Enzymatic Methyl-seq Kit. The specific procedure refers to the instruction manual. The converted product is purified using 1.8x DNA sorting magnetic beads and eluted with 24 μL of Nuclease-free Water.

[0113] 6) Library construction

[0114] ① DNA enrichment and amplification

[0115] First, the converted DNA is enriched and amplified. Prepare the amplification system according to the following table. The sequence of Primer S is CTACACGACGCTCTTCCGATCT (SEQ ID NO.7). Add the prepared system to the purified product from the previous step.

[0116] Table 4 Amplification system

[0117]

[0118] Run the PCR program according to the following table. The hot lid is at 105°C and the volume is 50 μL. The DNA product is purified using 1x DNA sorting magnetic beads and eluted with 30 μL of Nuclease-free Water for DNA quantification.

[0119] Table 5 PCR amplification program

[0120]

[0121] ② DNA fragmentation

[0122] Prepare the secondary fragmentation reaction system on ice according to the following table. The sequence of the Tn5 Enzyme 2 coating is GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO.8). Pipette and mix 15 times, centrifuge briefly, add 10 μL of the DNA purified product from the previous step to the fragmentation system, react at 55°C for 10 min to terminate the fragmentation reaction, and then purify the fragmented product using cleanup beads and elute with 37 μL of Nuclease-free Water. Use the Agilent 4200 TapeStation to perform quality control on the secondary fragmented fragments, and the results are as Figure 12 shown in A.

[0123] Table 6 Interruption System

[0124]

[0125] ③ Library Amplification

[0126] Prepare the amplification reaction solution according to the following table. Add the 37 μL eluate from the previous step to the amplification reaction solution, pipette and mix well, centrifuge briefly, and run the PCR program according to the table. After PCR is completed, purify with 0.7× DNA sorting magnetic beads and elute with 30 μL Nuclease-free Water. Use Agilent 4200 TapeStation to perform quality control on the obtained library, and the results are as Figure 12 shown in B.

[0127] It should be noted that in the sequence of P5, [i5] represents the i5 index sequence, and its sequence length is 8 bp; in the sequence of P7, [i7] represents the i7 index sequence, and its sequence length is 8 bp.

[0128] Table 7 Components of Library Amplification Reaction Solution

[0129]

[0130] Table 8 Sequences of P5 and P7

[0131]

[0132] Table 9 Library Amplification Program

[0133]

[0134] 7) High-throughput Sequencing

[0135] The methylation library is sequenced on the Illumina platform with paired-end reads, and the sequencing data volume is 5G. The schematic diagram of the methylation library structure is as Figure 6 shown. Among them, Read1 and Read2 have read lengths of 150 bp respectively. The DNA methylation library structure starts with P5 and ends with P7, where the cell barcode length is 17 bp, the UMI length is 12 bp, the linker sequence contains 24 bp, the Tn5 ME sequence is 19 bp, the Tn5 incision is 9 bp, and the sample paired-end indexes are N5 and N7 with 8 bp each. Through the sequencing of the library, the basic data FASTQ for single-cell standard analysis can be obtained.

[0136] 8) Single-cell DNA Methylation Data Analysis

[0137] First, use the fastp software to perform quality control and deduplication on the original data, remove low-quality and PCR-duplicated reads to obtain Clean data. Then, use the Bsmap software to align the Clean data with the reference genome to obtain a bam file. Use samtools to sort the bam file and remove unaligned reads. Use bedtools to calculate the coverage of reads. At the same time, use MethylDackel to extract CpG sites and count the number of CpG sites to complete the quality control analysis of single-cell methylation data. The specific results are shown in the following table. In the step of connecting cell tags in water-in-oil, a total of 1200 cells of the two types were input. The number of captured cells was 671, and the capture efficiency was 55.9%; the proportion of reads with valid cell tags was 93.32%; the proportion of uniquely aligned to the reference genome was 73.48%; when the median read number detected in the cells was 14450, 19935 CpG sites could be detected, and the genome coverage rate was 0.05%.

[0138] Table 10 Results of quality control data analysis

[0139]

[0140] After the quality control data analysis is completed, use the seurat package of R to perform dimensionality reduction clustering on the average methylation level of single-cell CpG sites within 100 bins. The results are as Figure 13 shown. The two types of cells can be significantly divided into two categories, and the proportion is consistent with the cell input proportion.

[0141] The above is only an exemplary embodiment of the present invention, and does not limit the patent scope of the present invention. Any equivalent structural transformation made under the technical concept of the present invention by using the content of the specification and drawings of the present invention, or directly / indirectly applied in other related technical fields, is included in the patent protection scope of the present invention.

Claims

1. A cell labeling microbead, characterized in that: It comprises microbeads and a universal primer sequence, a cell tag and a connection sequence which are sequentially coupled to the microbeads; Each of the microbeads is marked with 10 5 ~10 10 Nucleic acid sequences with the same cell label; The universal primer sequence is used to combine with a primer compatible with a sequencer, and the dC in the universal primer sequence is 5-MethyldC; The cell label is used to track and identify target cells, and the bases in the cell label are selected from A base, T base, and G base; The cell label includes a first cell label, an intermediate sequence and a second cell label, the intermediate sequence is used to connect the first cell label and the second cell label, the first cell label and the second cell label are used to mark the same cell, the base sequence of the intermediate sequence is AG, the length of the first cell label is 8 bp, and the length of the second cell label is 8 bp; The linker sequence is used to connect the cell tag to the target cell; The cell label microbeads further include a molecular label sequence, which is coupled between the cell label and the connection sequence, and the bases in the molecular label sequence are selected from A bases, T bases, and G bases.

2. The cell labeling microbeads according to claim 1, characterized in that There are 10 types of cell labels 2 ~10 8 kind.

3. The cell labeling microbeads according to claim 1, characterized in that The microbeads are hydrogel microbeads or polymer magnetic beads.

4. The cell labeling microbeads according to claim 1, characterized in that The preparation method of the cell label microbeads comprises the following steps: S10. Provide universal primer sequences, cell tag sequences and connection sequences; S20. Labeling the 5' end of the universal primer sequence onto the microbeads to obtain coupled microbeads; S30. Sequentially label the cell label sequence and the connection sequence onto the universal primer sequence of the coupled microbeads to obtain cell label microbeads.

5. The cell labeling microbeads according to claim 4, characterized in that Step S30 includes the following steps: S31. labeling the first cell label onto the universal primer sequence of the coupled microbeads to obtain first labeled microbeads; S32. Label the intermediate sequence, the second cell label and the connecting sequence onto the first cell label of the first label microbead to obtain the cell label microbead.

6. The cell labeling microbeads according to claim 4, characterized in that Step S32 includes: The intermediate sequence, the second cell tag, the molecular tag sequence and the connecting sequence are labeled onto the first cell tag of the first tag microbead to obtain the cell tag microbead.

7. Use of the cell labeling microbeads as claimed in any one of claims 1 to 6 in high-throughput single-cell whole-genome DNA methylation detection.

Images