A gene Xa47a mediating high resistance to rice bacterial blight and its use

Abstract

The present invention discloses a gene Xa47a for mediating high resistance to rice bacterial blight and its application. The application of gene Xa47a in regulating high resistance to rice bacterial blight, the gene ID of gene Xa47a in the reference genome Nipponbare is LOC_Os11g35840. Xa47a gene is a new gene for mediating high resistance to rice bacterial blight, and has important application value in rice disease resistance breeding.

Description

Technical Field

[0001] The invention belongs to the field of rice, and in particular relates to a gene Xa47a mediating high resistance to rice bacterial blight and a use thereof. Background Art

[0002] Rice is one of the most important food crops in the world, with more than half of the world's population relying on rice as their staple food. As rice grows in a warm and humid environment, it is extremely vulnerable to pests and diseases throughout its entire growth and development stage. Among them, rice bacterial blight caused by Xanthomonas oryzae pv.oryzae (Xoo) is the most important bacterial disease of rice. Rice infection with bacterial blight generally reduces yield by 10-20%, and in severe cases can reach 60%, or even no grain is harvested. South China and East China are areas where rice bacterial blight often and repeatedly occurs. In recent years, due to the rapid increase in the incidence of new and highly pathogenic type IX bacterial blight pathogens, its morbidity rate for 500 Guangdong rice seed resources is as high as 96.40%, which makes rice production in Guangdong and even the rice-growing areas of South China face a greater risk of bacterial blight damage. Summary of the invention

[0003] The purpose of the present invention is to provide a gene Xa47a mediating high resistance to rice bacterial blight and its use

[0004] The nucleotide sequence of the gene Xa47a that mediates high resistance to rice bacterial blight is shown in SEQ ID NO.1.

[0005] The present invention also provides application of the gene Xa47a in regulating high resistance of rice to bacterial blight.

[0006] Preferably, the gene Xa47a is knocked out or gene-edited to make rice highly susceptible to bacterial blight.

[0007] Preferably, the target site of the gene editing is 840-1: TGAACCAGCTTCCTTCCTTA or 840-2: CTCAAGGACCTCATACTTTC.

[0008] Preferably, for the target site 840-1, the primers are: 840-gRT1: TGAACCAGCTTCCTTCCTTAgttttagagctagaaat; 840-OsU6aT1: TAAGGAAGGAAGCTGGTTCACggcagccaagccagca.

[0009] Preferably, for the target site 840-2, the primer is: 840-gRT2:

[0010] CTCAAGGACCTCATACTTTCgttttagagctagaaat;840-OsU6bT2:

[0011] GAAAGTATGAGGTCCTTGAGCaacacaagcggcagc.

[0012] The Xa47a gene is a new gene that mediates high resistance to rice bacterial blight and has important application value in rice disease resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the sequence variation information of the target sites of 11 Xa47a gene editing lines;

[0014] Figure 2 This is the lesion of the T1 strain edited with Xa47a gene 14 days after inoculation with type IX bacterial blight fungus;

[0015] Figure 3 It is a sequence variation at 1483 bp upstream of the start codon;

[0016] Figure 4 It is a sequence variation in exon 2. DETAILED DESCRIPTION

[0017] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0018] Embodiment 1:

[0019] Experimental methods

[0020] Construction of gene editing vector and genetic transformation of 1Xa47a gene

[0021] from http: / / rice.uga.edu / cgi-bin / gbrowse / rice / Download the sequence of Xa47 (gene ID: LOC_Os11g35840) in the Nipponbare reference gene and use the CRISPR-P 2.0 website ( http: / / crispr.hzau.edu.cn / CRISPR2 / ) online analysis function, designed in the first exon of the Xa47a gene 2 A gene editing target site, whose nucleotide sequence is shown in SEQ ID NO.1 (the yellow mark is the target site sequence), was synthesized based on the CRISPR / Cas9 system target sequence primers Cas840-1 and Cas840-2, and after annealing, they were connected into the pYLCRISPR / Cas9Pubi-H binary vector to obtain a recombinant expression vector targeting the target site. After sequencing verification by Sangon Biotech (Shanghai) Co., Ltd., the rice disease-resistant material Guanghui 1283 was transformed by Agrobacterium EHA105-mediated method, and hygromycin was used as a screening marker to obtain transgenic regenerated plants.

[0022] 2. Resistance identification of genetically transformed plants and detection of target site variation

[0023] Seeds of 11 T0 generation genetic transformation lines were harvested to plant T1 generation lines. At the same time, the transformation recipient Guanghui 1283 was planted as a control. Type IX bacterial blight pathogen was inoculated by leaf cutting method before heading (ear panicle development stage VI). 4-5 leaves were cut from each individual plant, and the length of the lesions was investigated 14 days after inoculation.

[0024] Primer Premier 5 software was used to design the upper and lower primers of the detection marker TCAS840 upstream of the editing target site 1 and downstream of the target site 2, respectively. Leaves of T0 and T1 generation plants were taken, and genomic DNA was extracted using the CTAB method. PCR amplification of the target site was performed for sequencing and sequence variation was compared and analyzed.

[0025] Sequence variation analysis of 3Xa47a gene in resistant and susceptible materials

[0026] To further understand the sequence variation of disease resistance genes, we assembled the genomes of the resistant and susceptible sister lines T1337 and T1338 from the same F5 generation strain, and compared the genome sequences of these two sister lines with the Nipponbare reference sequence of LOC_Os11g35840.

[0027] Experimental Results

[0028] 1Two target sites were designed in the first exon of the Xa47a gene (underlined parts)

[0029] ATAAGTCCCTCTCTGCTTTCTTTGGAGCATCTGCAACATCTTGATCTCAGCTGGAACAACCTAAGTGGTTCAGATGGCCACATTCCAGGGTTCATAGGATCTTTTAGGAACTTGAGATATCTGAACCTCTCTGGCATGCCGTTCATCGGCGTGGTGCCGCCTCA GCTTGGTAACCTCTCAAAGCTGCAATTTCTTGACCTCTCATCTTGCATAGGGCTAGAAATGCAGTCAAGATCAGGCATGACATGGTTAAGGAACATACCTTTGCTACAGTATCTCAACCTTAATTCGGTAGACCTCAGCGCAGTTGATAATTGGCTTCATGTGA GTTCTTAATCTCTCTAATTGCTCACTTCAAAGAGCAGACCAAAAGCTGACTCACCTTCACAATAACTTCACCCGGCTCGAGAGACTTGATCTCTCCGGGAACCAGTTTAATCATCCTGCTGCTTCTTGTTGGTTTTGGAACATTACAAGC GAACAGATTATATGGCCAACTCCCTGATGCACTGGCAGATATGACATCCCTCCAGGTCCTCGATTTTTCGATTAATCGTCCTGTACCTATCTCACCAATAGGTCTGCTTCCATCCAGCCAAGCACCCCCTTCCTCCGGTGACGATGATGCCGCCATCGAAGGCATCACTATCATGGCTGAGAACTTGAGAAATCTATGCAGTTTAGAAATCCTGGACCTCACACAGAGTCTCTCATCTGGAAACATAACTGAGTTAATTGATAATTTGGCGAAATGCCCGGCCAGCAAACTGCAGCAATTGATTTTGAAATACAACAATATCACAGGCATCCTGCCAATATCAATGGGAGTGTTTTCCAGTTTAGTATACCTTGAC

[0030] Target site 1: TGAACCAGCTTCCTTCCTTA

[0031] Corresponding primer 840-1:

[0032] 840-gRT1: TGAACCAGCTTCCTTCCTTAgttttagagctagaaat

[0033] 840-OsU6aT1: TAAGGAAGGAAGCTGGTTCACggcagccaagccagca

[0034] Target site 2: CTCAAGGACCTCATACTTTC

[0035] Corresponding primer 840-2:

[0036] 840-gRT2: CTCAAGGACCTCATACTTTCgttttagagctagaaat

[0037] 840-OsU6bT2:GAAAGTATGAGGTCCTTGAGCaacacaagcggcagc

[0038] 2. Target site variation detection and inoculation identification

[0039] 1) Target site variation detection

[0040] Target site detection marker TCAS840:

[0041] F:5'-GCCGCCTCAGCTTGGTAA-3'

[0042] R: 5'-GGTGCTTGGCTGGATGGA-3' amplified fragment size 495 bp

[0043] Among the 11 genetically transformed strains obtained, compared with the wild-type Guanghui 1283, at target site 1, except for strains 10, 12, and 13, the other strains had different types of mutations; at target site 2, strains 3, 7, and 10 did not mutate. In short, among the 11 gene-edited strains obtained, except for strain 10, which did not mutate at both target sites, the other 10 strains had different types of sequence mutations ( Figure 1 ).

[0044] 2) Inoculation and identification of Xa47a gene-edited strains

[0045] Combined with the detection of target site mutations and inoculation identification, it was found that among the 11 Xa47a gene-edited lines, except for line 10 where the target site did not change, the other lines were highly susceptible to bacterial leaf blight. This indicates that this gene mediates high resistance to bacterial leaf blight in rice ( Figure 2 ).

[0046] 3Xa47a gene sequence variation in resistant materials

[0047] We assembled the genomes of the susceptible sister lines T1337 and T1338 and compared them with the gene LOC_Os11g35840 in the Nipponbare reference genome. We found that compared with the susceptible materials T1337 and Nipponbare, in the highly resistant material T1338, there was a continuous 17 bp variation at 1483 bp upstream of the start codon ATG, including a 12 bp deletion and a 5 bp base substitution ( Figure 3 ), there are 4 consecutive bp variations in the second exon, including 1 bp substitution and 3 bp deletion ( Figure 4 ). In addition, there are some base variations.

[0048] The genome sequence of Xa47a gene in disease-resistant materials T1338 and Guanghui 1283:

[0049]

[0050] Note: 1-2000 is the promoter, 2001-4823, 5725-7404 are the exon regions.

[0051] Xa47a CDS (SEQ ID NO.1)

[0052]

Claims

1. Genes that mediate high resistance to rice bacterial blight XA7 , characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. The gene according to claim 1 XA7 The application is characterized in that Knockout XA7 Makes rice highly susceptible to bacterial leaf blight.

3. The use according to claim 2, characterized in that: The target site of the knockout is 840-1: TGAACCAGCTTCCTTCCTTA or 840-2: CTCAAGGACCTCATACTTTC.

4. The use according to claim 3, characterized in that: When targeting the target site 840-1, the primers are: 840-gRT1: TGAACCAGCTTCCTTCCTTAgttttagagctagaaat; 840-OsU6aT1: TAAGGAAGGAAGCTGGTTCACggcagccaagccagca.

5. The use according to claim 3, characterized in that: When targeting the target site 840-2, the primers are: 840-gRT2: CTCAAGGACCTCATACTTTCgttttagagctagaaat; 840-OsU6bT2: GAAAGTATGAGGTCCTTGAGCaacacaagcggcagc.

Images