BnaCupinC09.1 gene and application thereof in regulating seed development

Abstract

The present application relates to BnaCupinC09.1 gene and its application in regulating seed development, and belongs to the technical field of biology. The present application firstly uses the cloned full-length BnaCupinC09.1 coding sequence to construct a 35S promoter driven overexpression vector, transforms Brassica napus, obtains stable transgenic plants, and obtains transgenic plants with increased seed size. The application of Brassica napus BnaCupinC09.1 gene in promoting the increase of seed volume, seed number and seed weight is verified through a series of experiments. The present application realizes the increase of seed number, seed volume and seed weight of transgenic lines, which is of great significance for the yield increase of Brassica napus, and has important guiding significance for the production and breeding of economic crops such as Brassica napus.

Description

Technical Field

[0001] This invention relates to the BnaCupinC09.1 gene and its application in regulating seed development, belonging to the field of biotechnology. Background Technology

[0002] Besides being an important source of edible oil for humans, rapeseed is also a significant source of protein feed and a raw material for industries such as biodiesel production. Currently, the demand for rapeseed oil exceeds its production, therefore, rapeseed yield and oil production are receiving increasing attention, making the development of rapeseed production of great importance.

[0003] Seed size is particularly important for agricultural development because it is a key trait determining yield. There are multiple pathways that regulate plant seed size, including the HAIKU (IKU) pathway, the ubiquitin-proteasome pathway, the G protein regulatory pathway, the mitogen-activated protein kinase (MAPK) pathway, the transcription factor pathway, and the plant hormone regulatory pathway. In recent years, several gene molecules have also been reported to influence seed development. Promoting seed development to increase crop yield is one of the new breeding ideas, which is beneficial for creating more germplasm resources.

[0004] However, there are no reports on the BnaCupinC09.1 gene and its role in rapeseed seed development in the field of rapeseed. This invention aims to provide useful materials for the development of rapeseed seeds and the increase of rapeseed yield through research. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the purpose of this invention is to provide the BnaCupinC09.1 gene of Brassica napus and its application in regulating rapeseed development, especially the application of the BnaCupinC09.1 gene of Brassica napus in increasing the seed size and improving the yield of rapeseed.

[0006] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution:

[0007] The present invention first provides a gene BnaCupinC09.1 that regulates plant seed development, the nucleotide sequence of which is shown in SEQ ID No: 1.

[0008] Furthermore, the regulation includes promoting seed volume increase, seed number increase, seed weight increase and / or increasing rapeseed yield; the plant includes Brassica napus.

[0009] Furthermore, the regulation is achieved through overexpression of the gene BnaCupinC09.1.

[0010] The present invention also provides a recombinant expression vector comprising the gene BnaCupinC09.1.

[0011] Furthermore, the recombinant expression vector includes the vector pK7FWG2.0.

[0012] The present invention also provides a recombinant engineered bacterium, wherein the engineered bacterium contains the gene BnaCupinC09.1 or the recombinant expression vector.

[0013] Furthermore, the host bacterium of the engineered bacteria is Agrobacterium GV3101.

[0014] The present invention also provides the application of the gene BnaCupinC09.1, or the recombinant expression vector, or the recombinant engineered bacteria in regulating rapeseed seed development.

[0015] Furthermore, the application includes applications in promoting increased seed volume, increased seed quantity, increased seed weight, and / or increased rapeseed yield.

[0016] Furthermore, the application is achieved by overexpressing the gene BnaCupinC09.1.

[0017] This invention also provides a method for regulating rapeseed seed development, comprising the following steps:

[0018] The gene BnaCupinC09.1 was cloned, and a recombinant expression vector containing the gene BnaCupinC09.1 was constructed. The recombinant expression vector was transformed into rapeseed using Agrobacterium-mediated transformation, and transgenic plants were screened to obtain positive transgenic rapeseed.

[0019] The obtained positively transformed rapeseed refers to plants with increased seed volume, increased seed quantity, increased seed weight, and / or increased rapeseed yield.

[0020] Furthermore, the Agrobacterium-mediated transformation of rapeseed includes transforming the recombinant expression vector into recipient bacteria to obtain recombinant engineered bacteria; expanding the culture of the obtained recombinant engineered bacteria; and using the obtained bacterial solution to infect the hypocotyl of rapeseed for transformation.

[0021] Furthermore, the cloned gene BnaCupinC09.1 was amplified by PCR using the sequences shown in SEQ ID No: 2 and SEQ ID No: 3 as primers and rapeseed cDNA as a template.

[0022] Furthermore, the recombinant expression vector is obtained by ligating the BnaCupinC09.1 gene CDS sequence shown in SEQ ID No: 1 into the pENTR vector, and then recombining the BnaCupinC09.1 gene CDS sequence with the pK7FWG2.0 plant expression vector using the Gateway method.

[0023] The beneficial effects of this invention are:

[0024] (1) This invention provides for the first time the application of the BnaCupinC09.1 gene in promoting the increase of rapeseed seed volume, seed quantity and seed weight.

[0025] (2) This invention successfully constructed a 35S promoter-driven overexpression vector pK7FWG2.0-BnaCupinC09.1 using the cloned full-length coding sequence (CDS) of BnaCupinC09.1. Overexpression lines were obtained by genetic transformation of Brassica napus using Agrobacterium infection. Compared to wild-type lines, the overexpression lines showed significant increases in silique size, number of seeds per silique, seed size, and weight per 100 seeds, indicating that overexpression of the BnaCupinC09.1 gene in Brassica napus significantly promotes seed volume, seed quantity, and seed weight, which is of great significance for the growth, development, and yield increase of Brassica napus. Attached Figure Description

[0026] Figure 1 The expression levels of the BnaCupinC09.1 gene in various tissues of Brassica napus.

[0027] Figure 2 This is a schematic diagram of the pK7FWG2.0-BnaCupinC09.1-eGFP vector; in the diagram: LB: left boundary sequence of T-DNA; RB: right boundary sequence of T-DNA.

[0028] Figure 3 The gel image shows the identification of plants that are positive for overexpressing the BnaCupinC09.1 gene. The OE-CupinC09 genes in the image are numbered from left to right as OE-CupinC09.1-3, OE-CupinC09.1-4, and OE-CupinC09.1-7.

[0029] Figure 4 The results are RT-qPCR identification results of the positive plants in Example 3.

[0030] Figure 5To observe the phenotypic characteristics of siliques from plants overexpressing BnaCupinC09.1, OE-CupinC09 is numbered from left to right as OE-CupinC09.1-3, OE-CupinC09.1-4, and OE-CupinC09.1-7 in the figure.

[0031] Figure 6 To show the effect of overexpression of the BnaCupinC09.1 gene on rapeseed seed size, OE-CupinC09 are numbered from left to right as OE-CupinC09.1-3 and OE-CupinC09.1-7 in the figure.

[0032] Figure 7 The image shows 100 seeds from wild-type plants and plants overexpressing BnaCupinC09.1. The OE-CupinC09 seeds in the image are numbered from left to right as OE-CupinC09.1-3 and OE-CupinC09.1-7.

[0033] Figure 8 The dry weight of 100 seeds was compared between wild-type plants and plants overexpressing BnaCupinC09.1. Detailed Implementation

[0034] To enable those skilled in the art to better understand the technical solutions of the present invention, the preferred embodiments of the present invention will be described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.

[0035] In the embodiments of the present invention, unless otherwise described, conventional experimental methods were used. The processes involved in the embodiments, unless otherwise described, can be understood and easily implemented by those skilled in the art based on the product manual or basic knowledge in the field, and therefore will not be described in detail.

[0036] In this invention, the Brassica napus Y127 seed was provided by Professor Hong Dengfeng of Huazhong Agricultural University and is a publicly known and widely used material; the genetic transformation method of Brassica napus involved in this invention was provided by Professor Hong Dengfeng of Huazhong Agricultural University and is a publicly known and widely used method; the vectors, engineered bacteria, etc. involved in this invention can all be purchased through conventional channels and are publicly known and widely used materials.

[0037] Example 1: Analysis of the expression pattern of BnaCupinC09.1

[0038] The expression levels of the BnaCupinC09.1 gene in different tissues of rapeseed were demonstrated using RT-qPCR experiments.

[0039] Based on the nucleotide sequence of BnaCupinC09.1 (NCBI accession number: BnaC09g00360D), RT-qPCR primers (SEQ ID Nos: 8 and 9 in Table 3) were designed, and the expression level of BnaCupinC09.1 in different rapeseed organs was identified using the rapeseed Actin gene as an internal reference.

[0040] The expression level of BnaCupinC09.1 in the stem of rapeseed (Brassica napus Y127, provided by Professor Hong Dengfeng of Huazhong Agricultural University, a publicly known material) was used as a control, and the T-test was used to analyze the significance of the difference in expression levels between the stem and other tissues.

[0041] The results are as follows Figure 1 As shown, the BnaCupinC09.1 gene is expressed at certain levels in the roots, stems, leaves, flowers, young siliques, and mature siliques of rapeseed, but its expression level is the highest in the roots.

[0042] The reaction system for RT-qPCR is shown in Table 1, and the reaction procedure is shown in Table 2.

[0043] Table 1. RT-qPCR reaction system

[0044]

[0045] Table 2. RT-qPCR reaction procedures

[0046]

[0047] Example 2: Cloning of the BnaCupinC09.1 gene and construction of an overexpression vector

[0048] Based on the whole genome DNA sequence (NCBI database accession number: BnaC09g00360D) and CDS sequence (SEQ ID No: 1) of the Brassica napus BnaCupinC09.1 gene published on NCBI (http: / / www.ncbi.nlm.nih.gov / ), primers (SEQ ID No: 2 and SEQ ID No: 3), overexpression primers (SEQ ID No: 4 and SEQ ID No: 5), and universal primers for related vectors (SEQ ID No: 6 and SEQ ID No: 7) for amplifying the BnaCupinC09.1 CDS sequence were designed using Primer 5 software.

[0049] The primer sequences are shown in Table 3. All primers were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0050] Table 3. Overexpression primers, primers for amplifying the BnaCupinC09.1 CDS sequence, and universal primers for related vectors.

[0051]

[0052] Using the sequences shown in SEQ ID No: 2 and SEQ ID No: 3 as primers, PCR amplification was performed using Brassica napus cDNA as a template to clone the BnaCupinC09.1 CDS sequence. The PCR system and procedure are shown in Tables 4 and 5.

[0053] Table 4. PCR System

[0054] reagents Dosage Template (50 ng / μL) 1μL KOD-Plus-Neo 10×PCR Buffer 5μL KOD-Plus-Neo 1μL <![CDATA[MgSO4(25mM)]]> 3μL dNTP Mixture (2mM) 5μL SEQ ID No: 2 2μL SEQ ID No: 3 2μL <![CDATA[ddH2O]]> To 50μL

[0055] Table 5. PCR Procedure

[0056]

[0057] The CDS sequence of BnaCupinC09.1 was cloned by PCR using rapeseed cDNA as a template. After sequencing verification that the BnaCupinC09.1 CDS sequence was correct, the BnaCupinC09.1 CDS sequence was ligated into the pK7FWG2.0 plant expression vector (containing an eGFP tag) using the Gateway method, obtaining the recombinant expression vector pK7FWG2.0-BnaCupinC09.1-eGFP for overexpressing BnaCupinC09.1. A schematic diagram of the vector is shown below. Figure 2 As shown, the recombinant expression vector was transformed into E. coli DH5α, and the plasmid was extracted, verified by PCR, and then used for later use. The specific steps of the Gateway method are as follows:

[0058] The BnaCupinC09.1 fragment (i.e., the CDS sequence of the cloned BnaCupinC09.1) was ligated into the pENTR vector:

[0059] The connection system is as follows:

[0060] Table 6. Systems for linking pENTR carrier

[0061] Components Dosage (μL) pENTR vector (20 ng / μL) 0.5 BnaCupinC09.1 fragment (20 ng / μL) 1.2 Salt solution 0.5 <![CDATA[ddH2O]]> 1.8

[0062] The vector pENTR-BnaCupinC09.1 was obtained by ligation at 22℃ for 3 h. It was then transformed into Escherichia coli DH5α competent cells and identified by bacterial culture PCR using primers SEQ ID No: 2 and SEQ ID No: 3. After identification, the plasmid was extracted for later use.

[0063] LR reaction:

[0064] Using the Gateway reaction kit, the BnaCupinC09.1 fragment from the vector pENTR-BnaCupinC09.1 was transferred to the final vector pK7FWG2.0 (containing an eGFP tag). The reaction system is as follows:

[0065] Table 7. System of LR reaction

[0066] reagents Dosage (μL) <![CDATA[LR Clonase TM II Enzyme]]> 1 pK7FWG2.0 plasmid (100 ng / μL) 0.7 pENTR-BnaCupinC09.1 plasmid (140 ng / μL) 0.5 TE buffer To 5μL

[0067] After reacting at 25℃ for 3 hours, 1 μL of protein kinase K was added, and the reaction was carried out at 37℃ for 10 minutes to obtain the recombinant vector pK7FWG2.0-BnaCupinC09.1-eGFP. This vector was transformed into Escherichia coli and plated on a medium containing spectinomycin. After culturing, single clones were picked and identified by PCR using SEQ ID No: 4 and SEQ ID No: 5. The correctly identified strains were expanded and cultured, and the strains were stored at -80℃.

[0068] Example 3: Transformation of wild-type Brassica napus plants

[0069] S1. Transformation and identification of Agrobacterium:

[0070] The engineered strain GV3101-pK7FWG2.0-BnaCupinC09.1 containing the pK7FWG2.0-BnaCupinC09.1 vector was obtained by transforming Agrobacterium competent cells using liquid nitrogen cold shock. The engineered strain was then transformed into Brassica napus using the hypocotyl infection method, with the specific steps as follows:

[0071] (1) Take 30 μL of Agrobacterium competent cells GV3101 and thaw them on ice.

[0072] (2) Add 300 ng pK7FWG2.0-BnaCupinC09.1 vector plasmid to Agrobacterium competent cells, place on ice for 5 min, freeze in liquid nitrogen for 5 min, immediately in a 37°C water bath for 5 min, and then in an ice bath for 5 min.

[0073] (3) Add 700 μL of LB medium (manufacturer: Oxoid, catalog number: CM0996B) and incubate at 28℃ with shaking for 2-3 hours.

[0074] (4) Then, centrifuge to collect the bacterial cells, discard the supernatant, and use a spreader to spread the bacterial solution on a culture medium containing 50 mg / L rifampicin, gentamicin and the corresponding antibiotic of the carrier, and incubate at 28°C for 36-48 h.

[0075] (5) Select single clones for expansion culture and perform bacterial culture PCR identification. The correctly identified strains are preserved for later use, and the strains that are correctly transformed by plasmid are screened.

[0076] Using rapeseed Y127 seeds provided by Professor Hong Dengfeng of Huazhong Agricultural University, the hypocotyls of the rapeseed were selected for genetic transformation after sowing and germination.

[0077] Aseptic operation must be ensured during the experiment. Materials must be prepared before the experiment, and the pH of various culture media must be correct.

[0078] S2. Sowing:

[0079] Preparations before the experiment: M0 culture medium, sterile Erlenmeyer flasks or centrifuge tubes, and sterile water.

[0080] (1) Place the seeds in a centrifuge tube and disinfect them by soaking them in 75% alcohol for 1 minute.

[0081] (2) Discard the alcohol, then add hypochlorous acid-bleach disinfectant and soak the seeds for 4 minutes to disinfect them.

[0082] (3) Remove the disinfectant and rinse the seeds 3-5 times with sterilized RO water.

[0083] (4) Use tweezers to sow the sterilized seeds onto the M0 medium, 20-25 seeds per dish, and culture at 24°C in the dark for 6 days.

[0084] S3. Activation and preparation of Agrobacterium:

[0085] (1) Take out Agrobacterium strains containing the corresponding vectors, streak them for activation, and screen them using LB medium containing 50 mg / L rifampicin, gentamicin and spectinomycin respectively. Pick single bacteria and culture them in medium containing the corresponding antibiotics at 28℃ and 220 rpm for 12-24 h.

[0086] (2) After bacterial culture was identified by PCR, the culture was expanded to the OD value of the bacterial culture. 600 It is around 0.4-0.6.

[0087] (3) Take 2 mL of bacterial culture, centrifuge at 5,000 rpm for 10 min to collect the bacterial cells, resuspend twice with 4 mL of DM medium, and store at 4℃ for later use.

[0088] S4. Preparation and staining of explants:

[0089] (1) Add 36 mL of DM (AS+) to a sterile glass petri dish, and use a sterile scalpel to cut the rapeseed hypocotyl into DM. The explant length is about 0.8-1 cm.

[0090] (2) Pour 2 mL of the prepared bacterial solution into the cut explant and soak for 13.5 min, shaking 4 to 5 times during the process.

[0091] (3) After 13.5 min, remove the DM bacterial solution, use sterile tweezers to pick up the explant and place it on sterile filter paper, and remove the excess bacterial solution from the explant.

[0092] (4) Transfer the explants to M1 medium and culture them in the dark at 24°C for 36-48 hours. Then transfer the explants to M2 selection medium and culture them under light for 15 days (16 hours during the day and 8 hours at night at 24°C). After 15 days of culture under light, transfer the explants to M3 medium and subculture them every 2-3 weeks until green shoots appear. Transfer the green shoots with intact growth points to rooting medium, and transplant them into soil after they have grown and rooted.

[0093] Total DNA was extracted from the leaves of transgenic rapeseed plants using the CTAB method. Positive plants were identified by PCR using specific primers (SEQ ID No: 4, SEQ ID No: 5), and plants amplifying the expected length band were confirmed as positive. Total RNA was extracted from positive plants and reverse transcribed into cDNA. Using the Acting gene in rapeseed as an internal control, the expression level of the BnaCupinC09.1 gene in transgenic plants was identified by RT-qPCR. The results are as follows: Figure 3 As shown, a total of three positive plants were identified. The plant overexpressing BnaCupinC09.1 was designated as OE-CupinC09.1. All three positive plants were overexpressing BnaCupinC09.1, and were therefore designated as OE-CupinC09.1-3, OE-CupinC09.1-4, and OE-CupinC09.1-7, respectively.

[0094] RT-qPCR reaction system:

[0095] Table 8. RT-qPCR system

[0096]

[0097] RT-qPCR reaction procedure:

[0098] Table 9. RT-qPCR Procedure

[0099]

[0100] S5. Preparation of the culture medium involved in this embodiment:

[0101] (1) DM medium

[0102] The formula is shown in Table 10. After dissolving and bringing the volume to a final depth, adjust the pH to 5.8. Autoclave at 121°C for 15 minutes, cool, and then add 1 mL of 100 mM AS. Set aside for later use.

[0103] Table 10. Formulation of DM medium

[0104] reagents Dosage D-sucrose 30g MS medium (containing organic matter) 4.42g <![CDATA[ddH2O]]> To 1L

[0105] (2) Seed germination medium (M0)

[0106] The formula is shown in Table 11. Agar powder is dispensed into culture flasks in advance, the pH is adjusted to 5.8 and then the volume is brought to a final volume. The flasks are dispensed into 40 mL each and autoclaved at 121°C for 15 min.

[0107] Table 11. Formulation of M0 medium

[0108] reagents Dosage D-sucrose 20g MS medium (containing organic matter) 4.42g Agar powder 8g <![CDATA[ddH2O]]> To 1L

[0109] (3) Co-culture medium (M1)

[0110] Table 12. Formulation of M1 medium

[0111] reagents Dosage D-sucrose 30g MS medium (containing organic matter) 4.42g Agar powder 8g Mannitol 18g <![CDATA[ddH2O]]> To 1L

[0112] The formula is shown in Table 12. Weigh out all reagents, mix and dissolve them, adjust the pH to 5.8, and autoclave at 121℃ for 15 minutes. After cooling, add the reagents in the table below in a clean bench, and dispense into petri dishes for later use.

[0113] Table 13. Hormone formulation for M1 culture medium

[0114] reagents Dosage (mL) 1 mg / mL 2,4-D 1 0.3 mg / mL KT 0.3 100mM AS 1

[0115] (4) Screening medium (M2)

[0116] The formula is shown in Table 14. After weighing and dissolving, adjust the pH to 5.8 and autoclave at 121℃ for 15 minutes. After cooling, add the hormone in a laminar flow hood and dispense into petri dishes for later use.

[0117] Table 14. Formulation of M2 medium

[0118] reagents Dosage MS medium (containing organic matter) 2.21g D-sucrose 15g Mannitol 9g agarose 4g <![CDATA[ddH2O]]> To 500mL 1 mg / mL 2,4-D 0.5mL 1mg / mL KT 0.15mL 300mg / mL Timentin 0.5mL STS 0.75mL 30mg / mL Kan 0.4mL

[0119] (5) Subculture medium (M3)

[0120] The formula is shown in Table 15. After weighing and dissolving, adjust the pH to 5.8 and autoclave at 121℃ for 15 minutes.

[0121] Table 15. Formulation of M3 medium

[0122] reagents Dosage MS medium (containing organic matter) 2.21g Glucose 5g D-xylose 0.125g MES 0.3g Agarose 4g <![CDATA[ddH2O]]> To 500mL

[0123] After cooling, add the hormone prepared according to the formula in Table 16 in a clean bench, and dispense it into petri dishes for later use.

[0124] Table 16. Hormone formulation for M3 culture medium

[0125] Hormone Name volume 2mg / mL ZT 0.25mL 300mg / mL TMT 1mL 1 mg / mL IAA 0.5mL 30mg / mL Kan 0.8mL

[0126] (6) Rooting medium (M4)

[0127] The formula is shown in Table 17. After weighing and dissolving, adjust the pH to 5.8 and autoclave at 121℃ for 15 min. After cooling, add 1 mL of 300 mg / mL TMT in a clean bench and dispense into petri dishes for later use.

[0128] Table 17. Formulation of M4 medium

[0129] Reagent Name Dosage Ms culture medium 2.21g D-sucrose 10g Agar 3g <![CDATA[ddH2O]]> To 500mL

[0130] Example 4: Observation of seed traits in transgenic rapeseed plants overexpressing BnaCupinC09.1.

[0131] The three positive plants obtained in step S4 of Example 3 ( Figure 3 The characteristics of the seeds were observed:

[0132] RT-qPCR results of three positive plants ( Figure 4 The results showed that the expression level of BnaCupinC09.1 in the three positive plants of the T1 generation was significantly upregulated compared with that in the wild-type plants.

[0133] Rapeseed conversion plants (i.e., positive plants) and wild-type plants were sown separately on a culture medium (vermiculite: nutrient soil mixed in a 2:1 volume ratio) and cultured for several months in an environment with alternating 16h light / 8h dark at 24℃. Phenotypic observations were then performed on mature siliques and seeds. Figure 5 , Figure 6 , Figure 7 ) and calculation of the weight of 100 grains ( Figure 8 ).

[0134] like Figure 5-8 As shown, the overexpression lines, regardless of the size of the siliques ( Figure 5 ), number of fruits per horn ( Figure 6 Seed size Figure 7 ) and dry weight per 100 grains ( Figure 8 Compared with the wild type, the expression lines showed a significant increase, with the dry weight per 100 grains of the overexpression lines being at least 20% higher than that of the wild type lines.

[0135] The above data indicate that overexpression of the BnaCupinC09.1 gene can affect rapeseed seed development, including silique size, number of seeds per silique, seed size, and dry weight per 100 seeds. Figure 5 , Figure 6 , Figure 7 , Figure 8 This provides germplasm resources and theoretical and technical support for increasing rapeseed yield.

[0136] SEQ ID No: 1

[0137] >BnaC09g00360D

[0138] ATGATCCTACTTTCGGGTTAGTTCCTCTTCATCTCCCATCGCCGCCGTCTCTCCGTCGCGTTTCTTCTGATCTACTTCTCTGAACCTACTCTTGCAGCTCCTTGCCCGATCAATGGGTTGCCAATCGTGAGGAATATAAGTGAACT TCCTCAGGATAACTATGGAAGGCCAGGCCTTTCTCACATGACTGTTGCTGGCTCTGTTTTGCACGGAATGAAAGAGGTTGAGATATGGCTTCAAACGTTTGCTCCAGGTTCAGGGACACCGATCCACAGGCACTCTTGTGAAGAGGTTT TCGTTGTCCTTAAAGGCAATGGTACTCTGTATCTCGCGGAAACACATGGAAGTTTCCCTGGGAAACCAATTGAGTTTCAGTCTTTGCCAACGGTACTATTCATATTCCCATCAATGATGCTCATCAGGTCAAGAACACTGGTCAAGAG GACCTGCAGGTGTTGGTTATTATATCTCGGCCGCCCATTAAAGTCTTTACCTACGATGACTGGTTTATGCCACACACTGCTGCGAGGTTGAAGTTCCCTTACTACTGGGATGAGCAATGCCTCCAAGAATCACAGAAGGACGAGCTTTAA

Claims

1. The application of gene BnaCupinC09.1, or a recombinant expression vector containing gene BnaCupinC09.1, or a recombinant engineered bacterium containing gene BnaCupinC09.1 in regulating rapeseed seed development; the nucleotide sequence of gene BnaCupinC09.1 is shown in SEQ ID No: 1; the application includes promoting seed volume increase, seed number increase, seed weight increase and / or increasing rapeseed yield; the application is achieved by overexpressing gene BnaCupinC09.1; the rapeseed is Brassica napus.

2. A method for regulating rapeseed seed development, characterized in that, The method includes the following steps: The gene BnaCupinC09.1 was cloned, and a recombinant expression vector containing the gene BnaCupinC09.1 was constructed. The recombinant expression vector was transformed into rapeseed using Agrobacterium-mediated transformation, and transgenic plants were screened to obtain positive transformed rapeseed. The obtained positive transformed rapeseed is a plant with increased seed volume, increased seed quantity, increased seed weight, and / or increased rapeseed yield. The rapeseed is Brassica napus.

3. The method according to claim 2, characterized in that, The cloned gene BnaCupinC09.1 was created using the sequences shown in SEQ ID No: 2 and SEQ ID No: 3 as primers.

Images