A SNP molecular marker combination for identification of superior kiwifruit plants and varieties and its application

Abstract

The present invention discloses a SNP molecular marker combination and application thereof for identifying superior kiwifruit strains and varieties, and belongs to the field of biological breeding technology. The present invention discloses a SNP molecular marker for identifying superior kiwifruit strains and varieties, which is composed of 10 SNP molecular markers, each of which corresponds to a SNP site. Based on the results of Hyper‑seq high-throughput sequencing, the present invention has developed 10 pairs of SNP primers, and multiple primer combinations can be used to identify multiple varieties of candidate superior strains, Chinese series and delicious series, and can be used to construct a fingerprint map of kiwifruit at the same time. The superior strains to be selected are obviously different from the current cultivated varieties in genetics, and the superior kiwifruit strains and varieties can be distinguished at the molecular level. The method has the advantages of high accuracy, good stability, and simple operation, which improves the success rate of identification of kiwifruit varieties and plays a positive role in kiwifruit molecular marker-assisted breeding and variety protection.

Description

Technical Field

[0001] The invention relates to a SNP molecular marker combination for identifying superior kiwifruit plants and varieties and application thereof, belonging to the technical field of biological breeding. Background Art

[0002] Kiwifruit belongs to the Actinidia family and the Actinidia genus. It is a woody vine native to China and is dioecious. Kiwifruit is rich in nutrients such as vitamin C, polyphenols, organic acids, and amino acids. It has the effects of inhibiting tumor cell proliferation, preventing cardiovascular diseases, and reducing inflammation and swelling, and is deeply loved by consumers. Among them, Chinese kiwifruit and delicious kiwifruit are the main commercially cultivated species because of their large fruits, good flavor, and high economic value in the genus Actinidia. Kiwifruit is a dioecious fruit tree. Female flowers usually bear fruit only after pollination, and the quality of the fruit is also affected by male pollen. The future development of the kiwifruit industry requires that female varieties be equipped with specific optimal pollination male varieties to ensure the best pollination effect. Therefore, the selection, breeding, utilization and research and development of excellent male varieties are important aspects of kiwifruit scientific research and industrial development in the future.

[0003] Existing studies have shown that the fruit yield, appearance quality and internal substances of the same kiwifruit variety pollinated by pollen from different male plants all show obvious pollen xenesis effects. However, the main kiwifruit varieties in my country are diversified, but the pollination varieties are basically universal types, while New Zealand, where the kiwifruit industry is well developed, has a single main variety and relatively certain suitable male plants. The excellent male kiwifruit plants Yong 21, Yong 5 and Yong 20 were screened from wild kiwifruit resources in Jiangxi Province. These three male superior plants can cover the pollination needs of the main female kiwifruit varieties with three different flowering periods of early, mid and late flowering. These three kiwifruit male superior plants all have great potential application value.

[0004] At present, kiwifruit varieties are mostly identified by fruit phenotype. Although some varieties can be distinguished by traditional means such as branch, leaf morphology, flowering period and flower morphology, many kiwifruit varieties have similar appearance characteristics, and multiple phenotypes such as fruit and flower phenotypes entering the fruiting period need to be jointly confirmed. It is difficult to complete variety identification in the seedling stage, and there are certain problems with identification accuracy. Therefore, the development of an efficient and accurate kiwifruit variety identification technology is of great significance to the identification of excellent kiwifruit varieties and the protection of new varieties in my country.

[0005] Molecular markers have evolved from the initial random amplified polymorphism (RAPD) to the later simple sequence repeat polymorphism (SSR), and then to the current single nucleotide polymorphism (SNP) and gene chips. In recent years, SNP has become a popular genetic marker and is the third generation of molecular markers. SNP mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level, and is widely present in the genome of plants in the form of transversion, conversion, insertion and deletion of a single base. SNP molecular markers have the characteristics of high distribution density on the genome, easy data integration, and high detection throughput. Summary of the invention

[0006] In view of the deficiencies in the prior art, the technical problem to be solved by the present invention is to provide a SNP molecular marker combination for kiwifruit variety identification. Another technical problem to be solved by the present invention is to provide a SNP molecular marker combination for kiwifruit superior plant identification. Another technical problem to be solved by the present invention is to provide a method for constructing a SNP molecular marker combination for kiwifruit variety identification. Another technical problem to be solved by the present invention is to provide a method for constructing a SNP molecular marker combination for kiwifruit superior plant identification. Another technical problem to be solved by the present invention is to provide an application of a SNP molecular marker combination for kiwifruit superior plant and variety identification, which is used to quickly and accurately identify kiwifruit superior plants and varieties, and to construct a fingerprint map for kiwifruit superior plant and variety identification. Another technical problem to be solved by the present invention is to provide a PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit variety identification. Another technical problem to be solved by the present invention is to provide a PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit superior plant identification. Another technical problem to be solved by the present invention is to provide an application of a SNP molecular marker combination for identifying superior kiwifruit strains and varieties, for quickly and accurately identifying superior kiwifruit strains and varieties, and constructing a fingerprint map for identifying superior kiwifruit strains and varieties.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0008] The SNP molecular marker combination for kiwifruit variety identification consists of 10 SNP molecular markers, each of which corresponds to a SNP site:

[0009] The first SNP molecular marker corresponds to SNP site SNP1: 0_2901252;

[0010] The second SNP molecular marker corresponds to SNP site SNP2: 0_14226366;

[0011] The third SNP molecular marker corresponds to the SNP site SNP3: 1_14362496;

[0012] The fourth SNP molecular marker corresponds to SNP site SNP4: 2_4994100;

[0013] The fifth SNP molecular marker corresponds to the SNP site SNP5: 5_1788218;

[0014] The sixth SNP molecular marker corresponds to SNP site SNP6: 6_17181155;

[0015] The seventh SNP molecular marker corresponds to SNP site SNP7: 9_19862480;

[0016] The eighth SNP molecular marker corresponds to SNP site SNP8: 14_831466;

[0017] The ninth SNP molecular marker corresponds to the SNP site SNP9: 14_18238473;

[0018] The tenth SNP molecular marker corresponds to SNP site SNP10: 16_922059.

[0019] The SNP molecular marker combination for identifying superior kiwifruit plants consists of 10 SNP molecular markers, each of which corresponds to a SNP site:

[0020] The first SNP molecular marker corresponds to SNP site SNP1: 0_2901252;

[0021] The second SNP molecular marker corresponds to SNP site SNP2: 0_14226366;

[0022] The third SNP molecular marker corresponds to the SNP site SNP3: 1_14362496;

[0023] The fourth SNP molecular marker corresponds to SNP site SNP4: 2_4994100;

[0024] The fifth SNP molecular marker corresponds to the SNP site SNP5: 5_1788218;

[0025] The sixth SNP molecular marker corresponds to SNP site SNP6: 6_17181155;

[0026] The seventh SNP molecular marker corresponds to SNP site SNP7: 9_19862480;

[0027] The eighth SNP molecular marker corresponds to SNP site SNP8: 14_831466;

[0028] The ninth SNP molecular marker corresponds to the SNP site SNP9: 14_18238473;

[0029] The tenth SNP molecular marker corresponds to SNP site SNP10: 16_922059.

[0030] The method for constructing a SNP molecular marker combination for identifying superior kiwifruit plants comprises the following specific steps:

[0031] 1) Extracting total DNA from kiwifruit;

[0032] 2) After the extracted kiwifruit total DNA was subjected to Hyper-seq high-throughput sequencing, the data was aligned to the Hongyang kiwifruit genome;

[0033] 3) Perform statistics on SNP and INDEL data for each sample to obtain variation identification results, select highly diverse variation sites to construct fingerprint maps for each sample, and finally obtain a SNP molecular marker combination for kiwifruit variety identification and / or superior plant identification.

[0034] Application of a SNP molecular marker combination for kiwifruit variety identification in identifying kiwifruit varieties and / or constructing a kiwifruit variety identification fingerprint map and / or preparing a kit for identifying kiwifruit varieties.

[0035] Application of a SNP molecular marker combination for identifying superior kiwifruit strains in identifying superior kiwifruit strains and / or constructing a fingerprint map for identifying superior kiwifruit strains and / or preparing a kit for identifying superior kiwifruit strains.

[0036] The PCR amplification primer pair combination of the SNP molecular marker combination for kiwifruit variety identification includes:

[0037] SNP1-F: TGGCCATGGAGATCCAGCTA,

[0038] SNP1-R:ACCTTTTGTAGGGTGCATGGT;

[0039] SNP2-F: GAGTGCCTCGTGCATTCCTT,

[0040] SNP2-R: TGATGGTAGCTGAACTCTCGG;

[0041] SNP3-F:TAGAAGCACCGTCAAGTGGG,

[0042] SNP3-R: TCACTGCCCTAGCACTTTCA;

[0043] SNP4-F: AGAGCAGATTAGGGCTGGGA,

[0044] SNP4-R:AAGCCACCGGATGATGTCAG;

[0045] SNP5-F: TACGTCGACAAGGGCCAAAA,

[0046] SNP5-R: CGCATTTAGTGCGTGTGAGG;

[0047] SNP6-F: GGCCCTGAAAAGGAGTGAGA,

[0048] SNP6-R: TGGAACCGAACCGTAAAACCA;

[0049] SNP7-F: AAGCAGAAGGTGCCGAATGA,

[0050] SNP7-R: TCGACGTGTCACTGTTTTGGT;

[0051] SNP8-F:CCCACTGGGTCACTTGTTGA,

[0052] SNP8-R:TTTCGCGGAGGGACAGAAAA;

[0053] SNP9-F:ATCCCAGCAACGGTCAACAA,

[0054] SNP9-R: TGACTGATGCTCCTTCGGAC;

[0055] SNP10-F: GGGACAGAGGCTGGGAAAAA,

[0056] SNP10-R:CTCACTTAACCACCCCACCC.

[0057] The PCR amplification primer pair combination of the SNP molecular marker combination for identifying superior kiwifruit plants includes: SNP1-F: TGGCCATGGAGATCCAGCTA, SNP1-R: ACCTTTTGTAGGGTGCATGGT;

[0058] SNP2-F: GAGTGCCTCGTGCATTCCTT,

[0059] SNP2-R: TGATGGTAGCTGAACTCTCGG;

[0060] SNP3-F:TAGAAGCACCGTCAAGTGGG,

[0061] SNP3-R: TCACTGCCCTAGCACTTTCA;

[0062] SNP4-F: AGAGCAGATTAGGGCTGGGA,

[0063] SNP4-R:AAGCCACCGGATGATGTCAG;

[0064] SNP5-F: TACGTCGACAAGGGCCAAAA,

[0065] SNP5-R: CGCATTTAGTGCGTGTGAGG;

[0066] SNP6-F: GGCCCTGAAAAGGAGTGAGA,

[0067] SNP6-R: TGGAACCGAACCGTAAAACCA;

[0068] SNP7-F: AAGCAGAAGGTGCCGAATGA,

[0069] SNP7-R: TCGACGTGTCACTGTTTTGGT;

[0070] SNP8-F:CCCACTGGGTCACTTGTTGA,

[0071] SNP8-R:TTTCGCGGAGGGACAGAAAA;

[0072] SNP9-F:ATCCCAGCAACGGTCAACAA,

[0073] SNP9-R: TGACTGATGCTCCTTCGGAC;

[0074] SNP10-F: GGGACAGAGGCTGGGAAAAA,

[0075] SNP10-R:CTCACTTAACCACCCCACCC.

[0076] The invention discloses an application of a PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit variety identification in identifying kiwifruit varieties and / or identifying superior kiwifruit plants.

[0077] The invention discloses an application of a PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit variety identification in constructing a kiwifruit variety identification fingerprint map and / or a kiwifruit superior plant identification fingerprint map.

[0078] Application of a PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit variety identification in preparing a kit for identifying kiwifruit varieties and / or preparing a kit for identifying superior kiwifruit strains.

[0079] Beneficial effects of the present invention:

[0080] The SNP molecular marker for kiwifruit variety identification disclosed in the present invention is composed of 10 SNP molecular markers, each of which corresponds to a SNP site. Based on the results of Hyper-seq high-throughput sequencing, the present invention develops 10 pairs of SNP primers, and multiple primer combinations can be used to identify candidate superior plants, various varieties of Chinese series and delicious series, and can also be used to construct fingerprint maps of male kiwifruit plants. The superior plants to be selected are obviously different from the current cultivated varieties in genetics, and the superior plants and varieties of kiwifruit can be distinguished at the molecular level. The method has the advantages of high accuracy, good stability, and simple operation, which improves the success rate of kiwifruit variety identification and plays a positive role in kiwifruit molecular marker-assisted breeding and variety protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 This is the NJ clustering tree diagram of 18 main kiwifruit varieties and superior plants;

[0082] Figure 2 This is the fingerprint map of 18 main kiwifruit varieties and superior plants. DETAILED DESCRIPTION

[0083] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0084] The 18 kiwifruit varieties and superior individuals used in this application were all planted at the experimental base of the Institute of Biological Resources of Jiangxi Academy of Sciences. 2-3 fresh young leaves were collected from each sample, placed in a sealed bag containing silica gel for drying, and stored in a -80°C refrigerator. See Table 1.

[0085] Table 1 18 kiwifruit varieties and superior plants used in this application

[0086] Serial number name category Serial number name category 1 Chu Hong Main varieties 10 Jin Kui Main varieties 2 Donghong Main varieties 11 Xu Xiang Main varieties 3 Red Ten Main varieties 12 Moshanxiong No.2 Male plant variety 4 Hongyang Main varieties 13 Moshan No. 4 Male plant variety 5 Golden Peach Main varieties 14 Guihai No.4 Male plant variety 6 Jin Yan Main varieties 15 Yong 20 Candidate superior strain 7 Red sky Main varieties 16 Yong 21 Candidate superior strain 8 Jade Main varieties 17 Yong 5 Candidate superior strain 9 Wuzhi No.3 Main varieties 18 ZJ-4 Candidate superior strain

[0087] Example 1

[0088] 1. DNA extraction

[0089] The total DNA of kiwifruit was extracted using the Plant Genomic DNA Extraction Kit (Kangwei Reagent Biotechnology Co., Ltd.). The specific steps are as follows:

[0090] Take about 20 mg of kiwifruit leaves, freeze them in liquid nitrogen and grind them into fine powder. Add 400 μL Buffer LP1 and 6 μL RNaseA (10 mg / mL), vortex for 1 min, and let stand at room temperature 40°C for 10 min. Add 130 μL Buffer LP2, vortex for 1 min, centrifuge at 12000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube. Add 1.5 times the volume of Buffer LP3 and mix thoroughly. Add all the solution and precipitate obtained in the previous step to the adsorption column in the collection tube. If the solution cannot be added in one time, it can be transferred in multiple times, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 500 μL Buffer GW2 (add anhydrous ethanol before use) to the adsorption column, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and put the adsorption column back into the collection tube. Repeat this step twice. Centrifuge at 12000rpm for 2min, discard the waste liquid in the collection tube, and place the adsorption column at room temperature for several minutes to dry thoroughly. Place the adsorption column in a new centrifuge tube, add 50-100μL Buffer GE or sterile water to the middle part of the adsorption membrane, place at room temperature for 2-5min, centrifuge at 12000rpm for 1min, and collect the DNA solution. Store DNA at -20℃.

[0091] 2. Development of polymorphic sites

[0092] The DNA of all extracted samples was homogenized to control the DNA concentration of each sample at 150-200 ng / μL. Hyper-seq libraries were constructed for all 18 samples. After passing the test, the second-generation platform Illumina NovaSeq 6000 platform or DNBSEQ-T7 platform (Illumina, San Diego, CA, USA) was used for high-throughput sequencing PCR amplification, gel cutting and recovery, and sequencing. After sequence quality control, the data was aligned to the Hongyang kiwifruit genome.

[0093] The results showed that the size of the reference genome of Hongyang kiwifruit was 653.93M, the alignment rate of 18 samples to the Hongyang kiwifruit genome was between 35.77% and 88.95%, the coverage of the reference genome was between 2.386% and 7.043%, and the average sequencing depth was between 0.094X and 0.342X. The SNP and INDEL data of each sample were statistically analyzed, and the distribution of the variation on the genome was visualized. The NJ clustering tree of 18 main kiwifruit varieties and male plants was constructed.

[0094] The results are as follows Figure 1As shown, the 18 main kiwifruit varieties and male superior plants of this application form 3 main branches. Chinese kiwifruit varieties and superior plants form 2 branches, and all delicious kiwifruit varieties form one branch. The clustering results clearly reveal the genetic relationship between different varieties and superior plants, which is consistent with the phylogenetic origin of the samples. For example, 'Wuzhi No. 3' and 'Moshan No. 4' are both derived from wild resources in northern Jiangxi Province, and the parents of the 'Jintao' kiwifruit variety also come from here. These varieties are consistent with the sources of the excellent individual plants we selected from northern Jiangxi Province, and together form a cluster branch.

[0095] 3. Construction of kiwifruit fingerprint

[0096] Based on the results of variant identification, the di-allelic SNP sites with a maf value (minor allele frequency) greater than 0.05 and a genotype missing rate of 0 were retained, and finally 10 variant sites with high diversity were selected (Table 2).

[0097] Table 2 Information of 10 SNP loci

[0098]

[0099]

[0100] The base information of these 10 SNP polymorphic sites was used to construct fingerprint maps of 18 kiwifruit varieties and superior plant samples (Table 3).

[0101] Table 3 Fingerprints of 18 kiwifruit varieties / superior plants

[0102] Variety / Superior Plant Name Fingerprint Variety / Superior Plant Name Fingerprint Chu Hong 0122001002 Jin Kui 2101102100 Donghong 0100000000 Xu Xiang 0101000100 Red Ten 0110000000 Moshanxiong No.2 0122000010 Hongyang 0100000010 Moshan No. 4 0001110000 Golden Peach 0101110000 Guihai No.4 0101000000 Jin Yan 0021000010 Yong 20 0111100002 Red sky 1000000010 Yong 21 0101110010 Jade 0122000100 Yong 5 0101010001 Wuzhi No.3 1111000012 ZJ-4 0010011001

[0103] Among them, 0 means that all SNP sites are base type 1, 1 means that two base types coexist, and 2 means that all SNP sites are base type 2.

[0104] Different colors were assigned to different base types at the 10 SNP sites of each sample to visualize the fingerprint map.

[0105] The results are as follows Figure 2 As shown in the figure, the three Chinese red-fleshed kiwifruits have high genetic similarity, but there are still suitable loci for differentiation. The 'Donghong' kiwifruit can be differentiated from the 'Hongshier' at locus 3, and from the 'Hongyang' at the SNP9 locus; for the excellent male varieties 'Moshan Xiong 2' and 'Moshan 4', the SNP2-SNP6 and SNP9 loci can distinguish these two male plants; the kiwifruit 'Jinkui' can be distinguished from all other samples at the SNP1 locus, so this locus can be used as a characteristic variation site of the kiwifruit 'Jinkui' for variety identification.

[0106] 4. Finally, it was determined that the combination of 10 SNP molecular markers could distinguish different varieties and superior plants of kiwifruit, and was used to construct a DNA fingerprint of kiwifruit. The nucleotide sequences of the 10 SNP molecular markers corresponded to the nucleotide sequences of SEQ ID NO.1-10 molecular markers respectively.

[0107] Example 2

[0108] 1. Design and synthesis of SNP site primers

[0109] Primers were designed using the software obtained from Primer-BLAST on the NCBI website. Each pair of primers was required to be more than 50 bp away from the polymorphic site and the product length was set between 200 bp and 800 bp. A total of 10 pairs of SNP primers were designed (Table 4) and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0110] Table 4 10 pairs of primers for amplification of SNP sites

[0111]

[0112] 2. Screening of SNP primers and product detection for kiwifruit varieties and identification of male superior plants

[0113] The genomic DNA of 18 kiwifruit varieties and male superior plants were used as templates, and 10 pairs of SNP primers in Table 4 were used for amplification to obtain PCR amplification products.

[0114] PCR reaction system (20 μL): 2× Bio Taq PCR Mix (+Dye) Mix 10 μL, DNA template 40 ng, upstream and downstream primers 0.2 μM each, and ddH2O to make up to 20 μL.

[0115] TouchDown PCR reaction program: pre-denaturation at 95°C for 5 min; 15 cycles of denaturation at 95°C for 30 s, annealing at 65-55°C (0.7°C decrease per cycle) for 30 s, and extension at 72°C for 40 s; 20 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 40 s; and extension at 72°C for 4 min.

[0116] The PCR product was detected using 1.2% agarose gel, with a voltage of 120 V and electrophoresis for 15-20 min. Clear bands were visible in the primer amplification, and the fragment size was consistent with the target fragment size.

[0117] The amplified PCR product containing the target fragment was sent to Shanghai Sangon Biotechnology Co., Ltd. and sequenced using the amplified primer product.

[0118] Sequencing revealed that the sequencing results of the 10 SNP sites were consistent with the initial hyperseq sequencing results. The length of the SNP site amplification product and the base of the polymorphic site are shown in Table 5.

[0119] Table 5 Information of 10 SNP loci

[0120] Location Product length (bp) Base type 1 Base type 2 SNP1 574 C T SNP2 688 C T SNP3 670 A T SNP4 737 T C SNP5 495 C T SNP6 257 C G SNP7 628 G A SNP8 350 A G SNP9 734 T C SNP10 687 G A

[0121] Example 3

[0122] Four male superior kiwifruit plants (ZJ-4, Yong 5, Yong 20, Yong 21) and three male varieties (Moshan Xiong 2, Moshan 4, Guihai 4) were selected for leaf collection and DNA extraction. Four pairs of primers (SNP2, SNP6, SNP9, SNP10) were used for PCR amplification.

[0123] PCR reaction system (20 μL): 2× Bio Taq PCR Mix (+Dye) Mix 10 μL, DNA template 40 ng, upstream and downstream primers 0.2 μM each, and ddH2O to make up to 20 μL.

[0124] TouchDown PCR reaction program: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 65-55℃ (0.7℃ drop per cycle) annealing for 30s, 72℃ extension for 40s, 15 cycles; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 40s, 20 cycles; 72℃ extension for 4min. PCR amplification products were sent to Shanghai Shenggong Biotechnology Co., Ltd. for first-generation sequencing using amplification primer sequences.

[0125] According to the sequencing results, the base information of the seven kiwifruit samples at the four SNP sites was obtained and converted into fingerprint codes, and the results are shown in Table 6. Among them, under the amplification of the SNP10 primer, only sample 4 showed base type A at the SNP10 site (converted into a fingerprint code of 2), so sample 4 was identified as the excellent single plant Yong 20. The bases of samples 6 and 7 at the SNP10 site were AG (converted into a fingerprint code of 1). At the same time, under the amplification of the SNP2 primer, the bases of samples 6 and 7 at the SNP2 site were TC and C, respectively, and converted into fingerprint codes of 1 and 0, respectively. Therefore, samples 6 and 7 can be identified as excellent plants Yong 5 and ZJ-4, respectively. Among the remaining samples, only sample 2 has a base of C at the SNP2 site, which is converted into a fingerprint code of 0, so sample 2 is identified as Moshan No. 4. When samples 1 and 5 were amplified with primers SNP9 and SNP6, the sequences of the SNP9 locus were both CT, which was converted into a fingerprint code of 1, while the bases of the SNP6 locus were converted into fingerprint codes of 0 and 1, respectively. Therefore, samples 1 and 5 were Moshan Xiong No. 2 and Yong 21, respectively. Therefore, samples 1-7 were identified as: Moshan Xiong No. 2, Moshan No. 4, Guihai No. 4 Xiong, and excellent single plants Yong 20, Yong 21, Yong 5, and ZJ-4, respectively. The identification results were consistent with the actual sample sources, with an identification accuracy rate of 100%.

[0126] Table 6 Amplified fingerprints and identification results of 7 kiwifruit male varieties and superior plant samples

[0127] Sample Code Amplified fingerprint Identification results Actual source Sample 1 -1---0--10 Moshanxiong No.2 Moshanxiong No.2 Sample 2 -0---1--00 Moshan No. 4 Moshan No. 4 Sample 3 -1---0--00 Guihai No.4 Guihai No.4 Sample 4 -1---0--02 Yong 20 Yong 20 Sample 5 -1---1--10 Yong 21 Yong 21 Sample 6 -1---1--01 Yong 5 Yong 5 Sample 7 -0---1--01 ZJ-4 ZJ-4

[0128] Example 4

[0129] 18 kiwifruit samples were randomly selected and numbered 1-18, and genomic DNA of each sample was extracted. Sequence amplification was performed using 10 pairs of SNP site primers (Table 4). The sample DNA extraction and amplification sequencing methods were the same as those in Example 3.

[0130] According to the base sequencing results of different samples at 10 SNP sites, they were converted into fingerprint codes for identification and verification. The specific identification results are shown in Table 7.

[0131] Table 7 Identification results of 18 kiwifruit samples

[0132] Sample Code Fingerprint Identification results Actual species Sample 1 0122001002 Chu Hong Chu Hong Sample 2 0100000000 Donghong Donghong Sample 3 0110000000 Red Ten Red Ten Sample 4 0100000010 Hongyang Hongyang Sample 5 0101110000 Golden Peach Golden Peach Sample 6 0021000010 Jin Yan Jin Yan Sample 7 1000000010 Red sky Red sky Sample 8 0122000100 Jade Jade Sample 9 1111000012 Wuzhi No.3 Wuzhi No.3 Sample 10 2101102100 Jin Kui Jin Kui Sample 11 0101000100 Xu Xiang Xu Xiang Sample 12 0122000010 Moshanxiong No.2 Moshanxiong No.2 Sample 13 0001110000 Moshan No. 4 Moshan No. 4 Sample 14 0101000000 Guihai No.4 Guihai No.4 Sample 15 0111100002 Yong 20 Yong 20 Sample 16 0101110010 Yong 21 Yong 21 Sample 17 0101010001 Yong 5 Yong 5 Sample 18 0010011001 ZJ-4 ZJ-4

[0133] Example 5

[0134] A kit for identifying kiwifruit varieties, the kit comprising the following molecular marker combination:

[0135] The first SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.1, wherein Y is C or T; the second SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.2, wherein Y is C or T; the third SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.3, wherein W is A or T; the fourth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.4, wherein Y is T or C; the fifth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.5, wherein Y is C or T; the sixth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.6, wherein S is C or G; the seventh SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.7, wherein R is G or A; the eighth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.8, wherein R is A or G; the ninth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.9, wherein Y is T or C; the tenth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO. As shown in NO.10, wherein R is G or A.

[0136] Each SNP molecular marker corresponds to a SNP site. The first SNP molecular marker corresponds to SNP1 (0_2901252), the second SNP molecular marker corresponds to SNP2 (0_14226366), the third SNP molecular marker corresponds to SNP3 (1_14362496), the fourth SNP molecular marker corresponds to SNP4 (2_4994100), the fifth SNP molecular marker corresponds to SNP5 (5_1788218), the sixth SNP molecular marker corresponds to SNP6 (6_17181155), the seventh SNP molecular marker corresponds to SNP7 (9_19862480), the eighth SNP molecular marker corresponds to SNP8 (14_831466), the ninth SNP molecular marker corresponds to SNP9 (14_18238473), and the tenth SNP molecular marker corresponds to SNP10 (16_922059)

[0137] Each SNP site corresponds to the corresponding SNP primer shown in Table 4.

[0138] This makes it possible to simply and accurately identify different kiwifruit varieties under different environments, different periods and different growing seasons.

[0139] Example 6

[0140] A kit for identifying superior kiwifruit strains, the kit comprising the following molecular marker combination:

[0141] The first SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.1, wherein Y is C or T; the second SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.2, wherein Y is C or T; the third SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.3, wherein W is A or T; the fourth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.4, wherein Y is T or C; the fifth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.5, wherein Y is C or T; the sixth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.6, wherein S is C or G; the seventh SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.7, wherein R is G or A; the eighth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.8, wherein R is A or G; the ninth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO.9, wherein Y is T or C; the tenth SNP molecular marker, whose nucleotide sequence is shown in SEQ ID NO. As shown in NO.10, wherein R is G or A.

[0142] Each SNP molecular marker corresponds to a SNP site. The first SNP molecular marker corresponds to SNP1 (0_2901252), the second SNP molecular marker corresponds to SNP2 (0_14226366), the third SNP molecular marker corresponds to SNP3 (1_14362496), the fourth SNP molecular marker corresponds to SNP4 (2_4994100), the fifth SNP molecular marker corresponds to SNP5 (5_1788218), the sixth SNP molecular marker corresponds to SNP6 (6_17181155), the seventh SNP molecular marker corresponds to SNP7 (9_19862480), the eighth SNP molecular marker corresponds to SNP8 (14_831466), the ninth SNP molecular marker corresponds to SNP9 (14_18238473), and the tenth SNP molecular marker corresponds to SNP10 (16_922059)

[0143] Each SNP site corresponds to the corresponding SNP primer shown in Table 4.

[0144] This makes it possible to simply and accurately identify different superior kiwifruit plants under different environments, different periods and different growing seasons.

Claims

1. A PCR amplification primer pair combination of a SNP molecular marker combination for kiwifruit variety identification, comprising: SNP1-F: TGGCCATGGAGATCCAGCTA, SNP1-R:ACCTTTTGTAGGGTGCATGGT; SNP2-F: GAGTGCCTCGTGCATTCCTT, SNP2-R: TGATGGTAGCTGAACTCTCGG; SNP3-F:TAGAAGCACCGTCAAGTGGG, SNP3-R: TCACTGCCCTAGCACTTTCA; SNP4-F: AGAGCAGATTAGGGCTGGGA, SNP4-R:AAGCCACCGGATGATGTCAG; SNP5-F: TACGTCGACAAGGGCCAAAA, SNP5-R: CGCATTTAGTGCGTGTGAGG; SNP6-F: GGCCCTGAAAAGGAGTGAGA, SNP6-R: TGGAACCGAACCGTAAAACCA; SNP7-F: AAGCAGAAGGTGCCGAATGA, SNP7-R: TCGACGTGTCACTGTTTTGGT; SNP8-F:CCCACTGGGTCACTTGTTGA, SNP8-R:TTTCGCGGAGGGACAGAAAA; SNP9-F:ATCCCAGCAACGGTCAACAA, SNP9-R: TGACTGATGCTCCTTCGGAC; SNP10-F: GGGACAGAGGCTGGGAAAAA, SNP10-R:CTCACTTAACCACCCACCC; The kiwifruit varieties are "Chuhong", "Donghong", "Hongshier", "Hongyang", "Jintao", "Jinyan", "Mantianhong", "Jinkui", "Xuxiang", "Moshan Xiong No. 2", "Moshan No. 4", "Guihai No. 4 Xiong", "Cuiyu" and "Wuzhi No. 3".

2. A PCR amplification primer pair combination of a SNP molecular marker combination for identifying superior kiwifruit plants, comprising: SNP1-F: TGGCCATGGAGATCCAGCTA, SNP1-R:ACCTTTTGTAGGGTGCATGGT; SNP2-F: GAGTGCCTCGTGCATTCCTT, SNP2-R: TGATGGTAGCTGAACTCTCGG; SNP3-F:TAGAAGCACCGTCAAGTGGG, SNP3-R: TCACTGCCCTAGCACTTTCA; SNP4-F: AGAGCAGATTAGGGCTGGGA, SNP4-R:AAGCCACCGGATGATGTCAG; SNP5-F: TACGTCGACAAGGGCCAAAA, SNP5-R: CGCATTTAGTGCGTGTGAGG; SNP6-F: GGCCCTGAAAAGGAGTGAGA, SNP6-R: TGGAACCGAACCGTAAAACCA; SNP7-F: AAGCAGAAGGTGCCGAATGA, SNP7-R: TCGACGTGTCACTGTTTTGGT; SNP8-F:CCCACTGGGTCACTTGTTGA, SNP8-R:TTTCGCGGAGGGACAGAAAA; SNP9-F: ATCCCAGCAACGGTCAACAA, SNP9-R: TGACTGATGCTCCTTCGGAC; SNP10-F: GGGACAGAGGCTGGGAAAAA, SNP10-R:CTCACTTAACCACCCACCC; The varieties of superior kiwifruit plants are "Chuhong", "Donghong", "Hongshier", "Hongyang", "Jintao", "Jinyan", "Mantianhong", "Jinkui", "Xuxiang", "Moshan Xiong No. 2", "Moshan No. 4", "Guihai No. 4 Xiong", "Cuiyu" and "Wuzhi No. 3".

Images