Ganoderma lucidum new strain for producing high-quality raw materials and cultivation method thereof

Abstract

The application discloses a new strain of Ganoderma lucidum for producing high-quality raw materials and a cultivation method thereof. The new strain of Ganoderma lucidum is Ganoderma lucidum ZK-1, which was preserved in the China General Microbiological Culture Collection Center on December 27, 2023, and the preservation number is CGMCC No. 41075. The cultivation method is segment wood cultivation or material replacement cultivation. The segment wood cultivation includes mother strain propagation, original strain propagation, cultivation strain preparation, cultivation and fruiting body management. The material replacement cultivation includes mother strain propagation, original strain propagation, cultivation strain preparation and cultivation. The strain of Ganoderma lucidum in the application is a new strain with excellent yield, good cultivation characteristics, and the content of important effective substances in the produced fruiting bodies and spore powder is significantly higher than that of common strains. The produced spores are full and robust, and there are very few spores with shell retention and poor development, so the strain can be used for producing high-quality Ganoderma spore powder products.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of edible fungus cultivation, in particular to a new strain of Ganoderma lucidum producing high-quality raw materials and a cultivation method thereof. BACKGROUND

[0002] Ganoderma lucidum is a traditional medicinal fungus in China, and its application history in China can be traced back to more than 6800 years ago. There are more than one hundred species of Ganoderma lucidum in China, and the main cultivated species in China is Ganoderma lucidum. Since the Institute of Microbiology of the Chinese Academy of Sciences successfully cultivated Ganoderma lucidum for the first time in 1958-1959, and obtained the world's first Ganoderma lucidum spore powder sample in 1969-1970, the Ganoderma lucidum industry in China has developed rapidly, and has now developed into a large industry with an output value of more than 100 billion yuan. Ganoderma lucidum has been included in the Chinese Pharmacopoeia and the United States Pharmacopoeia, and has wide application value in the world.

[0003] Strains are the basis for producing medicinal fungus raw materials, and the breeding of excellent strains for producing Ganoderma lucidum raw materials is crucial. In recent years, with the development of the Ganoderma lucidum industry, the industry has put forward higher requirements for Ganoderma lucidum raw materials, not only in yield but also in quality. Product development is increasingly focusing on the active substance content indicators in Ganoderma lucidum raw materials, such as Ganoderma lucidum polysaccharides, Ganoderma lucidum acid substances, Ganoderma lucidum spore oil, and ergosterol.

[0004] At present, most of the Ganoderma lucidum varieties used in the main producing areas of China, such as Zhejiang, Anhui, and Shandong, are selected and used with the yield of fruiting bodies or spore powder as the target, and there is no excessive attention to the effective component content requirements of the produced raw materials. In the face of the current situation that the Ganoderma lucidum industry has increasingly high requirements for the quality of raw materials, the existing varieties are increasingly unable to meet the production requirements. For example, Ganoderma lucidum strains on the market have different degrees of strain vigor degradation, poor disease and pest resistance, low yield, and poor quality of raw materials during long-term use. Although some of the currently used varieties have high yield of spore powder, the developed spore powder is poor, has many shell-retained spores, and has low effective substances such as spore powder polysaccharides and spore oil, which cannot meet the demand for producing high-quality spore powder products. Therefore, breeding new Ganoderma lucidum strains producing high-quality fruiting bodies, especially high-quality spore powder raw materials, is an urgent problem faced by the industry, but currently there is a lack of work in this area. SUMMARY

[0005] The present application aims to provide a new strain of Ganoderma lucidum producing high-quality raw materials and a cultivation method thereof, which can produce high-quality Ganoderma lucidum raw materials.

[0006] In one aspect of the present application, a new Ganoderma lucidum strain for producing high-quality raw materials is provided. According to an embodiment of the present application, the new Ganoderma lucidum strain is Ganoderma lucidum ZK-1, which is obtained by isolating a series of original strains from wild Ganoderma lucidum fruiting bodies and then repeatedly domesticating and systematically breeding. The strain was deposited with the China General Microbiological Culture Collection Center on December 27, 2023, at the address of No. 1, Beichen West Road, Haidian District, Beijing, China, with the postal code of 100101, and the deposit number of CGMCC No. 41075.

[0007] In addition, the new Ganoderma lucidum strain for producing high-quality raw materials according to the above-mentioned embodiments of the present application can also have the following additional technical features:

[0008] In some embodiments of the present application, the ITS gene sequence of the new Ganoderma lucidum strain is shown in the sequence table step_1.

[0009] In another aspect of the present application, a cultivation method of the new Ganoderma lucidum strain for producing high-quality raw materials is provided. According to an embodiment of the present application, the cultivation method is segment wood cultivation or material cultivation.

[0010] In addition, the cultivation method of the new Ganoderma lucidum strain for producing high-quality raw materials according to the above-mentioned embodiments of the present application can also have the following additional technical features:

[0011] In some embodiments of the present application, the segment wood cultivation includes mother strain propagation, original strain propagation, cultivation strain preparation, cultivation, and fruiting body management.

[0012] In some embodiments of the present application, the mother strain propagation includes the following steps: inoculating the new Ganoderma lucidum strain on a mother strain culture medium, and culturing at 22-28°C for 5-13 days to obtain the mother strain of the new Ganoderma lucidum strain.

[0013] The original strain propagation includes the following steps: inoculating the mother strain propagation new Ganoderma lucidum strain on an original strain culture medium, culturing in the dark at a temperature of 20-25°C for 25-40 days, ventilating for 1-2 hours every day, increasing the ventilation volume in the later period, timely selecting the contaminated and mycelium-unfilled bags in the early period, and placing the bags horizontally in the later period, adjusting the edges of the bags every 3 days until the mycelium is full (the original strain mycelium growth period is about 30 days), and sterilizing the culture room with ozone for 1-2 hours every day during the culture period.

[0014] The cultivation species preparation comprises the following steps: inoculating the original species propagation strain on a cultivation species culture medium, and culturing in dark at 20-28 DEG C for 25-40 days; the cultivation comprises the following steps: inoculating the cultivation species obtained by the cultivation species preparation on a segment wood, inoculating on a single head or two heads under sterile conditions, spreading the strain on the cross section, tightening the bag opening, moving the inoculated segment wood into a culture room for light-proof culture at 15-28 DEG C for 90-110 days; ventilating in time during the culture period, and controlling the air humidity at 60-80%. When the surface of the segment wood appears light yellow mycelium, small primordia are formed, light pressure has elasticity, and the mycelium between the segment woods is not loose when the segment wood is rubbed, the segment wood can be removed. The segment wood is selected from broad-leaved trees except pine, fir, camphor, eucalyptus and other trees containing oil, aromatic stimulating odor and toxic tree species, and the trunk is cut into 15-30 cm segment wood, which is sterilized in a plastic bag and used.

[0015] The ganoderma lucidum management comprises the following steps: when the ganoderma lucidum primordium has not been formed and during the young ganoderma lucidum growth period, the carbon dioxide concentration is kept at 1000-3000 PPM, the air humidity is kept at 75-85%, and the light intensity is kept at 300-500 Lx; after the ganoderma lucidum fruiting body is fully opened, the ventilation is increased, the carbon dioxide concentration in the air is kept at 400-600 PPM, the air humidity is kept at 80-90%, and the light intensity is controlled at 400-4000 Lx; during the ganoderma lucidum fruiting body tends to mature to the spore emission period, the air humidity is kept at 75-80%, and the light intensity is less than 100 Lx; 7 days before the ganoderma lucidum fruiting body is harvested or the spore powder is collected in a sleeve, water spraying should be stopped; the temperature during the ganoderma lucidum management is kept at 25-32 DEG C.

[0016] In some embodiments of the present application, the mother culture medium comprises the following components: oak leaf ultrafine powder 50-200 g, millet ultrafine powder 50-200 g, agar 15-20 g, and water 1000 ml.

[0017] In some embodiments of the present application, the original culture medium comprises the following components: wood chips 30%-40%, cotton seed hulls 30%-40%, rice chaff 5%-15%, bran 5%-15%, barley 3%-8%, corn flour 1%-8%, and gypsum 1%-2%, and water accounting for 50%-55% of the total amount of dry materials is added.

[0018] In some embodiments of the present application, the cultivation species culture medium comprises the following components in percentage by mass: wood chips 30%-40%, cotton seed hulls 30%-40%, rice chaff 5%-15%, bran 5%-15%, and gypsum 1%-2%; or corn cob powder or wood chips 75%-90%, wheat bran 5%-20%, soybean meal 0-5%, sucrose or glucose 0-1.5%, quicklime 0-2%, and gypsum 0-2%, and water accounting for 55%-60% of the total amount of dry materials is added.

[0019] In some embodiments of the present application, the artificial cultivation comprises mother culture propagation, original culture propagation, cultivation species preparation, and cultivation.

[0020] In some embodiments of the present application, the mother culture propagation comprises the following steps: inoculating the Ganoderma lucidum new strain on a mother culture medium, and culturing in dark at 22-26℃ for 6-10 days to obtain the mother culture of the Ganoderma lucidum new strain.

[0021] The original culture propagation comprises the following steps: inoculating the mother culture of the Ganoderma lucidum new strain on an original culture medium, and culturing in dark at 22-26℃ for 25-30 days.

[0022] The cultivation species preparation comprises the following steps: inoculating the strain propagated from the original culture on a cultivation species medium, and culturing at 22-26℃ for 25-30 days.

[0023] The cultivation comprises the following steps: inoculating the cultivation species on a bag culture medium, and culturing in dark at 22-28℃ for 20-30 days until the bag is full; after the bag is full, the fungus stick is moved to a fruiting room, the two ends of the fungus bag are cut open, and after 15-20 days, Ganoderma lucidum starts to fruit; the temperature is kept at 26-28℃, the air humidity is kept at 85%-90%, and the ventilation is performed 3-4 times per day, each time for 30 minutes; after Ganoderma lucidum grows for 30-40 days, the spore powder spraying stage is entered, and the spore powder of Ganoderma lucidum sprayed is collected by using non-woven fabric. The raw material of the bag culture medium is the same as the component of the cultivation species medium for cultivation species preparation.

[0024] In some embodiments of the present application, the mother culture medium comprises the following components: 100-200g peeled potatoes, 15-30g glucose, 15-20g agar, and 1000ml water; the original culture medium comprises the following components in mass percentage: 98-99% wheat grains, 0.5-1.5% gypsum, and 0.5-1.5% lime; and the cultivation species medium comprises the following components in mass percentage: 75%-90% corn cob powder or sawdust, 5%-20% wheat bran, 0-5% soybean meal, 0-1.5% sucrose or glucose, 0-2% quicklime, and 0-2% gypsum.

[0025] Compared with the prior art, the present application has the following beneficial effects:

[0026] The Ganoderma lucidum strain in the present application is a new strain with excellent yield, good cultivation traits, and significantly higher content of important effective substances in the produced fruiting bodies and spore powder than common species and original strains; the produced spores are full and robust, and few of them are in shell and underdeveloped, which can be used for producing high-quality Ganoderma lucidum spore powder products. The strain in the present application is a new Ganoderma lucidum strain with great development prospect, and the cultivation method in the present application can be used for producing high-quality Ganoderma lucidum raw materials. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is a photomicrograph of spores produced by the new Ganoderma strain ZK-1 in Example 2 and 4 of the present application;

[0028] Figure 2 is a photomicrograph of spores produced by the comparative strain "Ganoderma lucidum (Shandong)" in Example 4 of the present application (the arrow points to the developmentally abnormal spores with closed shells) ;

[0029] Figure 3 is the cultivation effect of the new Ganoderma strain ZK-1 in Example 2 of the present application;

[0030] Figure 4 is the appearance of the fruiting bodies and spore powder produced by the new Ganoderma strain ZK-1 in Example 2 of the present application. DETAILED DESCRIPTION

[0031] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0032] Example 1

[0033] A new Ganoderma strain producing high-quality raw materials, wherein the new Ganoderma strain is Ganoderma lucidum ZK-1, which is obtained by repeatedly domesticating and systematically breeding a series of original strains isolated from wild Ganoderma fruiting bodies. Specifically, the following steps are included

[0034] (1) The strain is collected from the Funiu Mountain in Henan Province, and an original pure strain is obtained by tissue isolation and purification. The original pure strain is identified as Ganoderma lucidum by morphological and molecular biological identification.

[0035] (2) The original strain is first cultivated on a substitute material in a laboratory condition to grow mushrooms. Pure strains are obtained by tissue isolation from the mushroom-growing strains with fast growth rate, strong mycelium, strong anti-bacterial ability, high yield of fruiting bodies and spore powder, and good quality of fruiting bodies. The cycle cultivation is continued to breed strains with fast growth rate, strong anti-bacterial ability, high yield, and stable quality.

[0036] (3) The above strains are used as raw materials to continue the cultivation experiment in the field greenhouse by the method of material cultivation. Under the condition of material cultivation, the strains are cultivated in the field greenhouse with harsh conditions to guide the strains to adapt to the planting environment of large-scale cultivation in sequence, so as to further domesticate the strains, improve the resistance of the strains and produce high-quality raw materials. The strains with fast growth rate, strong mycelium, strong resistance to mixed bacteria, high yield of fruiting bodies and spore powder and good quality fruiting bodies are selected for purification to obtain pure strains.

[0037] (4) The above strains are used as raw materials to continue the cultivation experiment in the field greenhouse by the method of material cultivation. Under the condition of material cultivation, the strains are cultivated in the field greenhouse with harsh conditions to guide the strains to adapt to the planting environment of large-scale cultivation in sequence, so as to further domesticate the strains, improve the resistance of the strains and produce high-quality raw materials. The strains with fast growth rate, strong mycelium, strong resistance to mixed bacteria, high yield of fruiting bodies and spore powder and good quality fruiting bodies are selected for purification to obtain pure strains.

[0038] The strain is preserved in the China General Microbiological Culture Collection Center on December 27, 2023, and the preservation number is CGMCC No. 41075.

[0039] The ITS gene sequence of the new strain of Ganoderma lucidum is as follows:

[0040] 5'-TATGGCTTTCCGGTAGGTGACCTGCGGAAGGATCATTATCGAGTTTTGACCG GGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGATTGTGAGGCACGCTCTTTACCGGGCTTGCGGAGCATATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTATCGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCTCGGTGTGATAACGTCTACGCCGCGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCTTATAAGACAGCTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAATGA-3'

[0041] Example 2

[0042] The segment wood soil covering cultivation method of Ganoderma lucidum strain ZK-1 comprises the following steps:

[0043] (1) Mother strain propagation: Ganoderma lucidum strain ZK-1 is inoculated on a mother strain culture medium and cultured at 23°C for 10 days to obtain the mother strain of Ganoderma lucidum strain ZK-1. The mother strain culture medium comprises 100 g of oak leaf ultrafine powder, 100 g of millet ultrafine powder, 20 g of agar and 1000 ml of water.

[0044] (2) Master strain propagation: inoculate the Ganoderma lucidum strain ZK-1 on the mother culture medium above on the master culture medium, and cultivate in the dark at 23°C for about 30 days. The relative humidity of the indoor air is not less than 55%, and the window is ventilated for 1.5 hours every day. The ventilation volume is increased in the later period, and the contaminated and mycelium-unfilled bags are selected in time in the early period. The bags are placed horizontally in the later period, and the bags are adjusted every 3 days until the mycelium is full. The cultivation period of the master strain is about 30 days (the cultivation room needs to be sterilized by ozone for 1 hour every day during the cultivation period). The master culture medium comprises 36% sawdust, 36% cotton seed hulls, 10% rice chaff, 10% bran, 5% barley, 2% corn flour, and 1% gypsum. The dry materials are mixed uniformly, and then water with a total amount of 55% of the dry materials is added.

[0045] (3) Cultivation strain preparation: inoculate the master strain in step (2) on the cultivation strain culture medium, and cultivate in the dark at 23°C for 35 days. The cultivation strain culture medium comprises 90% corn cob powder, 5% wheat bran, 3% soybean meal, 1% sucrose or glucose, and 1% quicklime. The dry materials are mixed uniformly, and then water with a total amount of 55% of the dry materials is added.

[0046] (4) Log cultivation: inoculate the cultivation strain in step (3) on logs, inoculate both ends under sterile conditions, and the strain is spread on the cross section with a thickness of about 1 cm, and the bag opening is tied tightly. The inoculated logs are moved into a culture room for light-free cultivation at 25°C for 105 days. The air humidity is controlled at 65% during the cultivation period. When the surface of the logs appears a light yellow mycelium, small primordia are formed, the logs are elastic when pressed, and the mycelium does not loosen when the logs are rubbed, the logs can be picked. The logs are selected from oak trees with an age of more than 15 years, and the logs are cut into logs with a length of 30 cm, sterilized in plastic bags, and then used.

[0047] (5) Management of Ganoderma lucidum: when the Ganoderma lucidum primordia are not formed and the young Ganoderma lucidum grows, the carbon dioxide concentration is maintained at 2000PPM, the air humidity is preferably maintained at 80%, and the light intensity is maintained at 400Lx. After the Ganoderma lucidum fruiting body is fully opened, the ventilation volume is increased, the carbon dioxide concentration in the air should be maintained at 500PPM, the air humidity is maintained at 85%, and the light intensity is controlled at 1500Lx. When the Ganoderma lucidum fruiting body tends to mature to the spore emission period, the air humidity is preferably maintained at 78%, and the light intensity is less than 100Lx. Water spraying is stopped 7 days before the Ganoderma lucidum fruiting body is harvested or the spore powder is collected in a sleeve. The temperature during the management of the Ganoderma lucidum is maintained at 26°C. The harvested Ganoderma lucidum fruiting body and spore powder are used for the detection of subsequent efficacy components.

[0048] Example 3

[0049] The method for cultivating the strain ZK-1 of Ganoderma lucidum comprises the following steps:

[0050] (1) Master strain propagation: inoculate Ganoderma strain ZK-1 on a master strain culture medium, and cultivate in the dark at 25°C for 7 days to obtain the master strain of Ganoderma strain ZK-1. The master strain culture medium comprises: potato (peeled) 200 g, glucose 20 g, agar 20 g, and water 1000 ml.

[0051] (2) Propagation of original strain: inoculate Ganoderma strain ZK-1 on the master strain culture medium above on an original strain culture medium, and cultivate in the dark at 25°C for 25 days. The original strain culture medium comprises: wheat grain 98.5%, gypsum 1%, and lime 0.5%.

[0052] (3) Production of cultivation strain: inoculate the original strain in step (2) on a cultivation strain culture medium, and cultivate in the dark at 26°C for 28 days. The cultivation strain culture medium comprises: corn cob powder 87%, wheat bran 8%, soybean meal 2%, sucrose 0.5%, lime 1.5%, and gypsum 1%.

[0053] (4) Cultivation: inoculate the cultivation strain on a bag-type cultivation material, and cultivate in the dark at 26°C for 28 days until the bag is full. After the bag is full, move the fungus stick to a fruiting room, cut open both ends of the fungus bag, and after 16 days, Ganoderma starts to fruit. Maintain the temperature at 26°C and the air humidity at 86%, and ventilate 3 times a day for 30 minutes each time. After Ganoderma grows for 36 days, start the spore powder spraying stage, and use non-woven fabric to collect the sprayed Ganoderma spore powder. Collect the spore powder and fruiting body for subsequent analysis and detection of active ingredients. The raw material of the bag-type cultivation material is the same as the cultivation strain culture medium in step (3).

[0054] Example 4

[0055] Compare the microscopic photograph of the spore powder produced by ZK-1 strain with the control variety:

[0056] Take the spore powder produced by the new Ganoderma strain ZK-1 in Example 2, add an appropriate amount of distilled water, vortex for 1 minute, take an appropriate amount of suspension on a glass slide, and observe the spore microscopic state under a 100x oil immersion lens.

[0057] The control strain is the Ganoderma lucidum variety widely cultivated and used in Shandong area, locally known as "Ganoderma lucidum", referred to herein as "Ganoderma lucidum (Shandong)", and the spore powder raw material produced by it is observed under the same conditions as above. The yield of Ganoderma produced by this strain accounts for more than 40% of the national total, and the use of the Ganoderma lucidum (Shandong) variety produced in this area for a long time as a control will have more practical significance.

[0058] As Figure 1As shown, the microscopic observation of spore powder produced by the new Ganoderma lucidum strain ZK-1 reveals the following: spores are elliptical to oval, with one end truncated, plump, and containing one oil droplet in the center. They are 9.54–10.57 μm long and 5.74–6.70 μm wide. The spores are plump, robust, and uniform in size, with a spore development rate of 100%.

[0059] like Figure 2 As shown, the microscopic morphological observation of spore powder from the control variety "Ganoderma lucidum (Shandong)" shows that the spores are elliptical to oval, with one end truncated and containing a single oil droplet in the middle. They are 7.54–11.48 μm long and 5.52–7.29 μm wide. Under the microscope, many spores (indicated by the pointed end) are found to be encased or poorly developed, and the spores are uneven in size, indicating poor quality. Based on the number of spores in the field of view, the spore development rate is only 80%.

[0060] Example 5

[0061] Comparison of spore oil content in the spore powder produced by the new strain with that of the control strain:

[0062] Accurately weigh 15 grams of dried Ganoderma lucidum spore powder from Example 2 into a sealed container, add 500 ml of n-hexane, and ultrasonically extract for 45 minutes. Filter to obtain the supernatant, remove the n-hexane by rotary evaporation, and dry the extract at 80°C to dry weight. The resulting oily extract is the extracted Ganoderma lucidum spore oil. The weight of the spore oil was determined by the weight loss method. Spore powders produced by control strains (Yunle Chizhi No. 2, Hu Nong No. 1, Yunle Chizhi No. 3, and Zizhi) were used as controls. Specific values ​​are shown in the table below:

[0063] Table 1. Yield of Ganoderma lucidum spore oil extracted from Ganoderma lucidum spore powder.

[0064] Strain Spore powder weight (g) Spore oil weight (g) Spore oil yield ZK-1 (Example 3) 15 5.68 37.87％ ZK-1 (Example 3) 15 5.45 36.30％ ZK-1 original strain 15 4.16 27.73％ Yunle Chizhi No. 2 15 4.59 30.60％ Yunle Chizhi No. 2 15 4.68 31.20％ Shunong No. 1 15 4.72 31.47％ Shunong No. 1 15 4.62 30.80％ Yunle Chizhi No. 3 15 4.68 31.20％ Yunle Chizhi No. 3 15 4.69 31.27％ Purple Ganoderma 15 4.68 31.20％

[0065] In the table above, ZK-1, Yunle Ganoderma lucidum No. 2, Hu Nong No. 1, and Yunle Ganoderma lucidum No. 3 all underwent two sets of replicate experiments. As shown in the table, the spore powder produced by strain ZK-1 in Example 3 had a spore oil content of over 36%, reaching a maximum of 37.87%, which is more than 6% higher than that of traditional strains and more than 10% higher than that of the original strain. The spore oil yield was greatly improved, indicating that the strain of this invention can produce Ganoderma lucidum spore powder with high spore oil yield. Based on the estimated national spore powder production of approximately 10,000 tons, if all of it were used to extract spore oil, it would provide the spore oil market with an additional 600 tons of Ganoderma lucidum spore oil. Calculated at a unit price of 120 yuan / gram for spore oil, the spore powder produced using this strain could generate approximately 72 billion yuan in additional profit from spore oil, resulting in a significant increase in economic benefits.

[0066] Example 6

[0067] Comparison of alcohol extract content in spore powder produced by the new strain with that of the control strain:

[0068] Take 15 grams of dried spore powder to dry weight, after removing oil by extraction of Example 5, add 500 ml of ethanol and ultrasonic extraction for 45 minutes, filter to obtain supernatant, after removing ethanol by rotary evaporation, the extract is dried at 80℃ to dry weight, the obtained extract is the alcohol extract. The weight of the alcohol extract is determined by weight loss method. The spore powder produced by the comparative strain is used as a control. The specific values are shown in the following table:

[0069] Table 2 Alcohol extract content of spore powder produced by strains

[0070] Strain Spore powder weight (g) Alcohol extract weight (g) Alcohol extract yield ZK-1 (Example 2) 15 0.42 2.80％ ZK-1 original strain 15 0.26 1.73％ Yunle Chizhi No. 2 15 0.25 1.67％ Shunong No. 1 15 0.22 1.47％ Purple Ganoderma 15 0.31 2.07％ Yunle Chizhi No. 3 15 0.29 1.93％

[0071] The yield of alcohol extract of spore powder produced by the strain of the present application reaches 2.80%, which is much higher than that in other varieties and the original strain. The alcohol extract of Ganoderma lucidum is mainly effective substances of ganoderma triterpenes, indicating that the spores of the produced spore powder are full and the content of available effective ingredients is high, and the effect is good, which is a new variety of Ganoderma lucidum for developing high-quality spore powder products.

[0072] Example 7

[0073] Comparison of polysaccharide content in spore powder produced by new strain and comparative strains:

[0074] Take 0.5g of dried spore powder to dry weight, add 10ml of pure water, extract at 98℃ for 2 hours, dilute the supernatant 20 times, and determine the polysaccharide content by anthrone-sulfuric acid method, the results are shown in the following table:

[0075] Table 3 Polysaccharide content of spore powder produced by strains

[0076]

[0077]

[0078] The polysaccharide content in spore powder produced by the strain under different cultivation modes reaches 4.44%~5.73%, compared with the original strain before selection, it can be known that the polysaccharide content in spore powder produced by the new strain after systematic selection is significantly improved. Compared with the control strain, the content is also much higher than that of other control strains. The polysaccharide content in spore powder is an important indicator for evaluating the quality of spore powder, which indicates that high-quality spore powder raw materials can be produced by using the strain.

[0079] Example 8

[0080] Comparison of ergosterol content in fruiting bodies produced by new strain and comparative strains:

[0081] Take the mature stage fruiting bodies produced by different strains, crush them, take 0.3g of powder, ultrasonic extract with 6ml of methanol for 45 minutes, make up the weight loss, and the supernatant is used for ergosterol detection.

[0082] HPLC determination condition of ergosterol:

[0083] Chromatographic column: Agilent Extend-C18, 4.6mm*250mm, 5um. Eluted by 100% methanol, flow rate 1.0mL / min, injection volume 10ul, column temperature 30℃, detection wavelength 276nm.

[0084] Table 4: Ergosterol content in fruiting bodies produced by strains

[0085] Strain Ergosterol content % ZK-1 (Example 3) 0.243 Yunle Chizhi No. 2 0.067 Yunle Chizhi No. 3 0.082 Shunong No. 1 0.152 "Chizhi (Shandong)" 0.117

[0086] The ergosterol content in the fruiting bodies produced by the strain of the present application reaches 0.243%, which is much higher than that of the control strain. Ergosterol is one of the important life substances of Ganoderma lucidum, can be converted into vitamin D2, and has the effects of antioxidant, antibacterial, etc. In recent years, the attention of Ganoderma lucidum industry is getting higher and higher. It is proved that the strain ZK-1 of the present application can be used to produce fruiting bodies raw materials with high content of ergosterol.

[0087] The above is only an example and description of the present application, and those skilled in the art can make various modifications or supplements to the described specific embodiments or use similar ways to replace, as long as the modifications or supplements do not deviate from the structure of the present application or exceed the scope defined by the present claims, and should belong to the protection scope of the present application.

Claims

1. A new strain of Ganoderma lucidum producing high-quality raw materials, characterized by: The new Ganoderma lucidum strain is Ganoderma lucidum ZK-1, which was preserved in the China General Microbiological Culture Collection Center on December 27, 2023, and the preservation number is CGMCC No. 41075.

2. Ganoderma lucidum new strain for producing high-quality raw materials according to claim 1, characterized in that: The ITS gene sequence of the new Ganoderma lucidum strain is shown in the sequence table step_1.

3. A method for cultivating Ganoderma lucidum new strain for producing high-quality raw materials according to claim 1, characterized in that: The cultivation method is segment cultivation or feed cultivation.

4. The method for cultivating Ganoderma lucidum new strain for producing high-quality raw materials according to claim 3, characterized in that: The segment cultivation includes mother strain propagation, original strain propagation, cultivation strain preparation, cultivation, and fruiting body management.

5. The cultivation method of the new Ganoderma lucidum strain for producing high-quality raw materials according to claim 4, characterized in that: The mother strain propagation includes the following steps: inoculating the new Ganoderma lucidum strain on a mother strain culture medium, and culturing at 22-28°C for 5-13 days to obtain the mother strain of the new Ganoderma lucidum strain; The original strain propagation includes the following steps: inoculating the mother strain propagation new Ganoderma lucidum strain on an original strain culture medium, and culturing in the dark at a temperature of 20-25°C for 25-40 days; The cultivation strain preparation includes the following steps: inoculating the original strain propagation strain on a cultivation strain culture medium, and culturing in the dark at a temperature of 20-28°C for 25-40 days; The cultivation includes the following steps: inoculating the cultivation strain obtained by the cultivation strain preparation on a segment, inoculating single or double heads under sterile conditions, covering the cross section with the strain, tightening the bag opening, moving the inoculated segment into a culture room for light-free cultivation, and culturing at a temperature of 15-28°C for 90-110 days; The fruiting body management includes the following steps: when the Ganoderma lucidum primordium has not yet formed and during the growth period of the young fruiting body, the carbon dioxide concentration is maintained at 1000-3000 PPM, the air humidity is maintained at 75%-85%, and the light intensity is maintained at 300-500 Lx; after the Ganoderma lucidum fruiting body fully opens, the ventilation is increased, the carbon dioxide concentration in the air should be maintained at 400-600 PPM, the air humidity is maintained at 80%-90%, and the light intensity is controlled at 400-4000 Lx; during the spore emission period, the air humidity is preferably maintained at 75%-80%, and the light intensity is less than 100 Lx; water spraying should be stopped 7 days before harvesting the Ganoderma lucidum fruiting body or collecting spore powder; and the temperature during the fruiting body management is maintained at 25-32°C.

6. The method for cultivating Ganoderma lucidum new strain for producing high-quality raw materials according to claim 5, characterized in that, The mother strain culture medium includes the following components: oak leaf ultra-fine powder 50-200 g, millet ultra-fine powder 50-200 g, agar 15-20 g, and water 1000 ml; The original strain culture medium includes the following components by mass percentage: sawdust 30%-40%, cottonseed hulls 30%-40%, rice bran 5%-15%, wheat bran 5%-15%, barley 3%-8%, corn flour 1%-8%, and gypsum 1%-2%, and water is added to a total amount of 50%-60% of the dry materials.

7. The method for cultivating Ganoderma lucidum new strain for producing high-quality raw materials according to claim 5, characterized in that, The cultivation medium comprises the following components: sawdust 30%-40%, cotton seed hulls 30%-40%, rice chaff 5%-15%, bran 5%-15%, gypsum 1%-2%; or corn cob powder or sawdust 75%-90%, wheat bran 5%-20%, soybean meal 0-5%, sucrose or glucose 0-1.5%, quicklime 0-2%, gypsum 0-2%, and water accounting for 50%-60% of the total amount of dry materials.

8. The method for cultivating Ganoderma lucidum new strain for producing high-quality raw materials according to claim 3, characterized in that: The material cultivation comprises mother strain propagation, original strain propagation, cultivation medium preparation, and cultivation.

9. The method according to claim 8, wherein: The mother strain propagation comprises the following steps: inoculating the new Ganoderma lucidum strain on a mother strain culture medium, and culturing in darkness at 22-26 ℃ for 6-10 days to obtain a mother strain of the new Ganoderma lucidum strain; The original strain propagation comprises the following steps: inoculating the mother strain of the new Ganoderma lucidum strain on an original strain culture medium, and culturing in darkness at 22-25 ℃ for 25-30 days; The cultivation medium preparation comprises the following steps: inoculating the original strain propagation strain on a cultivation medium, and culturing at 22-26 ℃ for 25-30 days; The cultivation comprises the following steps: inoculating the cultivation medium on a bag material cultivation material, and culturing in darkness at 22-28 ℃ for 20-50 days until the bag is full; after the bag is full, the fungus stick is moved to a fruiting room, the two ends of the fungus bag are cut open, and after 15-20 days, Ganoderma lucidum starts to fruit; the temperature is maintained at 26-28 ℃, the air humidity is 85%-90%, and ventilation is performed 3-4 times per day, each time for 30 minutes; after Ganoderma lucidum grows for 30-40 days, a spore powder spraying stage is entered, and non-woven fabric is used to collect the sprayed Ganoderma lucidum spore powder.

10. The method according to claim 9, wherein: The mother strain culture medium comprises the following components: 100-200 g of peeled potatoes, 10-30 g of glucose, 15-20 g of agar, and 1000 ml of water; The original strain culture medium comprises the following components in mass percentage: 98%-99% of wheat grains, 0.5%-1.5% of gypsum, and 0.5%-1.5% of lime; The cultivation medium comprises the following components in mass percentage: corn cob powder or sawdust 75%-90%, wheat bran 5%-20%, soybean meal 0-5%, sucrose or glucose 0-1.5%, quicklime 0-2%, and gypsum 0-2%.

Images