A CasRx interfering with plant viruses and its preparation method, recombinant expression vector, and recombinant bacteria

Abstract

The present invention relates to the technical field of plant antiviral breeding, and in particular to a CasRx interfering with plant viruses and a preparation method thereof, a recombinant expression vector, and a recombinant bacterium. The present invention provides a CasRx interfering with plant viruses, wherein the nucleotide sequence of the CasRx is edited as shown in SEQ ID NO: 1; it is obtained by fusing a modified zmCasRx sequence and a modified ntCasRx sequence through a connecting peptide; the present invention also provides a screening method for a plant antiviral crRNA efficient target sequence based on CasRx, which relies on the transient expression evaluation process of the test target of CasRx transgenic Nicotiana benthamiana, greatly reducing the breeding risk caused by invalid or inefficient targets, and accelerating the process of plant antiviral breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant antiviral breeding, and in particular to a CasRx that interferes with plant viruses, a preparation method thereof, a recombinant expression vector, and a recombinant bacterium. Background Art

[0002] Plant viruses exploit host cell organelles to replicate and spread. Due to their diverse diversity, rapid reproduction, and widespread transmission pathways, coupled with the lack of effective control agents and measures, they are often referred to as "plant cancers." Although plants have evolved innate and adaptive immune mechanisms to defend themselves during their long interactions with pathogens, most viruses can still mitigate or evade host defenses, causing irreversible damage to host cells. Compared to eukaryotic organisms like animals and plants, bacteria and archaea possess more advanced defenses against viruses such as bacteriophages, including the classic restriction-modification system and the clustered regularly interspaced short palindromic repeat (CRISPR) and associated proteins (Cas) system. The CRISPR / Cas system is a more sophisticated and specific adaptive immune system. Bacteria utilize Cas nucleases and CRISPR clusters to rapidly detect invading foreign nucleic acids and specifically target and cleave them. Their specificity lies in the ability of these prokaryotes to capture short motifs on the phage genome and then integrate them into their own CRISPR sequence clusters in the form of spacer sequences as genetic memory of foreign invaders, thereby forming acquired immunity to foreign nucleic acids such as phages that have previously infected them. Therefore, if this exquisite viral immunity mechanism of bacteria is "transplanted" into plants, it will greatly improve the plant's viral resistance, thereby reducing the economic losses caused by viruses to crops at a lower cost. Utilizing the viral defense mechanisms of prokaryotes to develop eukaryotic antiviral immune systems is also a breakthrough direction that many researchers are currently focusing on.

[0003] Currently, some studies have used this strategy to attempt breeding improvements against specific viruses. Specifically, the RNA-targeted CRISPR / Cas13 system is required to stably transform crops and obtain transgenic plants to ensure that they are resistant to invading viruses throughout the crop's growth cycle. However, stable genetic transformation often requires a large amount of manpower, material resources, and time costs to achieve, so efficient viral targets are crucial to the success of antiviral crop breeding. The efficiency of the target is related to the properties of the target itself (such as secondary structure characteristics, etc.), as well as factors such as the viral genome structure and the selected pathogenic genes. In recent years, there have been reports of studies using RNA-targeted Cas13 family nucleases to perform antiviral interference in animals and plants, but these studies have mostly been somewhat random in the selection of specific crRNA targets. Efficient targets are crucial for effective defense against specific viruses. In particular, when using Cas13 to breed and improve plants for antiviral resistance, it relies on transgenic technology to stably integrate the CRISPR / Cas13 system into the plant genome, which requires caution in target selection, otherwise a large amount of labor and time costs will be wasted. Therefore, it is urgent and necessary to establish a screening system for rapid evaluation of target efficacy. Summary of the Invention

[0004] The present invention aims to provide a CasRx that interferes with plant viruses, a preparation method thereof, a recombinant expression vector, and a recombinant bacterium. It also provides a method for screening efficient plant antiviral crRNA target sequences based on CasRx. This method, which relies on the transient expression evaluation process of the test target in CasRx transgenic Nicotiana benthamiana, greatly reduces the breeding risk caused by ineffective or inefficient targets and accelerates the plant antiviral breeding process.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a CasRx that interferes with plant viruses, and the nucleotide sequence of the edited CasRx is shown in SEQ ID NO: 1.

[0007] The present invention also provides a method for preparing the CasRx, comprising the steps of: fusing the modified zmCasRx sequence and the modified ntCasRx sequence via a connecting peptide;

[0008] The modification method of the zmCasRx sequence is as follows: fusing localization peptides at both ends of the zmCasRx sequence and fusing a tag protein at the N-terminus to obtain a modified zmCasRx sequence;

[0009] The zmCasRx sequence is shown in SEQ ID NO: 2;

[0010] The positioning peptide is NLS; the tag is a Flag tag;

[0011] The sequence of the localization peptide NLS is shown in SEQ ID NO: 3; the sequence of the tag Flag is shown in SEQ ID NO: 4;

[0012] The modification method of the ntCasRx sequence is as follows: fusing localization peptides at both ends of the ntCasRx sequence and fusing a tag protein at the C-terminus to obtain a modified ntCasRx sequence;

[0013] The ntCasRx sequence is shown in SEQ ID NO: 5;

[0014] The positioning peptide is NES; the tag is HA tag;

[0015] The sequence of the positioning peptide NES is shown in SEQ ID NO: 6; the sequence of the tag HA is shown in SEQ ID NO: 7;

[0016] The connecting peptide is a 2A connecting peptide.

[0017] The present invention also provides a recombinant expression vector, comprising the edited CasRx nucleotide sequence and an empty vector;

[0018] The empty vector is pSuper1300.

[0019] The present invention also provides a recombinant bacterium, comprising editing the nucleotide sequence of CasRx and an empty vector bacterium;

[0020] The empty bacteria are Agrobacterium.

[0021] In the present invention, the Agrobacterium is Agrobacterium LBA4404.

[0022] The present invention also provides the use of the CasRx, the recombinant expression vector or the recombinant bacteria in constructing a transgenic Nicotiana benthamiana for screening efficient plant antiviral crRNA targets.

[0023] The present invention also provides a method for constructing transgenic Nicotiana benthamiana for screening efficient plant antiviral crRNA targets, comprising the following steps: transforming the CasRx, the recombinant expression vector or the recombinant bacteria into Nicotiana benthamiana, screening positive strains, and obtaining transgenic Nicotiana benthamiana.

[0024] The present invention also provides the use of transgenic Nicotiana benthamiana constructed by the construction method in screening efficient plant antiviral crRNA targets.

[0025] The present invention also provides a method for screening plant antiviral crRNA efficient target sequences based on CasRx, comprising the following steps:

[0026] (1) Integrating the expression sequence of the detection target into the crRNA expression vector to obtain a target vector;

[0027] (2) transforming the target vector into a host bacterium, collecting a bacterial solution with an OD value of 0.4 to 0.6, and obtaining a solution to be inoculated;

[0028] (3) injecting the inoculated solution into transgenic Nicotiana benthamiana to obtain transgenic Nicotiana benthamiana containing the target site;

[0029] (4) inoculating the target virus into the transgenic Nicotiana benthamiana containing the target site, observing the severity of viral disease symptoms in the transgenic Nicotiana benthamiana inoculated with the target virus and measuring the virus content, and selecting a target site with high interference efficiency with the target virus as a target sequence;

[0030] In step (3), the transgenic Nicotiana benthamiana is the transgenic Nicotiana benthamiana constructed by the construction method.

[0031] Preferably, the expression sequence of the detection target includes a spacer sequence and a reverse complementary sequence of the detection target;

[0032] The spacer sequence is shown in SEQ ID NO: 8;

[0033] The detection target is a 22 or 30 nt sequence rich in U at the 5' end of the viral coat protein gene or viral functional gene region, with the number of consecutive Us being ≥4;

[0034] The crRNA expression vector was constructed as follows: using the gene editing vector as the skeleton, deleting the Cas9 expression cassette on the gene editing vector and the sgRNA-scaffold in the sgRNA expression cassette, retaining the AtU6-26 promoter and the AtU6-29 terminator, to obtain the pAtU6-crRNA expression vector. The sequence of the pAtU6-crRNA expression vector is shown in SEQ ID NO: 9.

[0035] The present invention also provides the application of the screening method in screening plant antiviral crRNA targets.

[0036] Beneficial effects of the present invention:

[0037] The present invention has developed a method for screening targets suitable for plant viruses. This method involves creating transgenic Nicotiana benthamiana plants with different subcellular localizations, synthesizing target sequences, constructing target vectors, injecting the target vectors into the plants, inoculating the target virus, and comparing systemic symptoms and viral particle content. This method allows for rapid and efficient target identification. This process, which relies on transient expression and evaluation of target targets in transgenic Nicotiana benthamiana plants, significantly reduces breeding risks associated with ineffective or inefficient targets and accelerates the advancement of plant antiviral breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The invention relates to a target screening method for plant viruses, wherein A is a modified zmCasRx sequence, B is a modified ntCasRx sequence, C is a biCasRx sequence, D is a pAtU6-crRNA expression vector, E is a crRNA DNA double-stranded expression sequence obtained by annealing forward and reverse primers carrying residual bases of a BsaⅠ restriction site, F is an injection range of the inoculated solution and the viral infectious clone, a is an injection range of the inoculated solution, and b is an injection range of the viral infectious clone;

[0039] Figure 2 This is the plasmid map of the binary expression vector pSuper-biCasRx;

[0040] Figure 3 Comparison of systemic symptoms of viral interference efficiency at nine target sites in Example 2;

[0041] Figure 4 The qRT-PCR viral content detection results comparing the interference efficiency of the nine targets on TuMV in Example 2;

[0042] Figure 5 The Western-blot test results of the virus content are compared for the interference efficiency of the nine targets on TuMV in Example 2;

[0043] Figure 6 The qRT-PCR viral content detection results comparing the interference efficiency of the four targets on PVY in Example 3;

[0044] Figure 7 This is a comparison of the systemic disease symptoms of the four targets in Example 3 comparing their interference efficiency with PVY virus. DETAILED DESCRIPTION

[0045]

[0046] The present invention also provides a method for preparing the CasRx, comprising the steps of: fusing the modified zmCasRx sequence and the modified ntCasRx sequence via a connecting peptide;

[0047] The modification method of the zmCasRx sequence is as follows: fusing localization peptides at both ends of the zmCasRx sequence and fusing a tag protein at the N-terminus to obtain a modified zmCasRx sequence;

[0048]

[0049] The positioning peptide is NLS; the tag is a Flag tag;

[0050] The sequence of the localization peptide NLS is shown in SEQ ID NO: 3: CCCAAGAAGAAGAGAAAGGTG; the sequence of the tag Flag is shown in SEQ ID NO: 4: ATGGATTACAAGGACCACGACGGGGATTACAAGGACCACGACATTGATTACAAGGATGATGAT GACAAG;

[0051] The modification method of the ntCasRx sequence is as follows: fusing localization peptides at both ends of the ntCasRx sequence and fusing a tag protein at the C-terminus to obtain a modified ntCasRx sequence;

[0052]

[0053] The positioning peptide is NES; the tag is HA tag;

[0054] The sequence of the localization peptide NES is shown in SEQ ID NO: 6: CTGTATCCTGAGCGGCTGCGGCGGATCCTGACC; the sequence of the tag HA is shown in SEQ ID NO: 7: TACCCATATGATGTTCCTGATTATGCCTACCCGTACGACGTGCCGGACTACAGCCATGCGCACC ACGTCCCCGACCATACA;

[0055] The connecting peptide is a 2A connecting peptide.

[0056] In the present invention, the zmCasRx sequence is obtained by optimizing the CasRx sequence of the Ruminococcus flavefaciens XPD3002 strain (NCBI Reference Sequence: NZ_FPJT01000005.1, Cas13d gene 4911-7814) for maize codons.

[0057] The ntCasRx sequence was obtained by optimizing the tobacco codons based on the CasRx sequence of Ruminococcus flavefaciens XPD3002 (NCBI Reference Sequence: NZ_FPJT01000005.1, Cas13d gene 4911-7814).

[0058] The present invention also provides a recombinant expression vector, comprising the edited CasRx nucleotide sequence and an empty vector;

[0059] The empty vector is pSuper1300.

[0060] The present invention also provides a recombinant bacterium, comprising editing the nucleotide sequence of CasRx and an empty vector bacterium;

[0061] The empty bacteria are Agrobacterium.

[0062] The present invention also provides the use of the CasRx, the recombinant expression vector or the recombinant bacteria in constructing transgenic tobacco for screening efficient plant antiviral crRNA targets.

[0063] The present invention also provides a method for constructing transgenic tobacco for screening efficient plant antiviral crRNA targets, comprising the following steps: transforming the CasRx, the recombinant expression vector or the recombinant bacteria into Nicotiana benthamiana, screening positive strains, and obtaining transgenic tobacco.

[0064] The present invention also provides the use of transgenic tobacco constructed by the construction method in screening efficient plant antiviral crRNA targets.

[0065] The present invention also provides a method for screening target sequences of plant antiviral crRNA based on CasRx, comprising the following steps:

[0066] (1) Integrating the expression sequence of the detection target into the crRNA expression vector to obtain a target vector;

[0067] (2) transforming the target vector into a host bacterium, collecting a bacterial solution with an OD value of 0.4 to 0.6, and obtaining a solution to be inoculated;

[0068] (3) injecting the inoculated solution into transgenic tobacco to obtain transgenic tobacco containing the target site;

[0069] (4) inoculating the target virus into the transgenic tobacco containing the target site, observing the severity of viral disease symptoms in the transgenic tobacco inoculated with the target virus and measuring the virus content, and selecting a target site with high interference efficiency with the target virus as a target sequence;

[0070] In step (3), the transgenic cigarette is the transgenic cigarette constructed by the construction method.

[0071] In the present invention, the OD value is preferably 0.5.

[0072] In the present invention, the expression sequence of the detection target includes a spacer sequence and a reverse complementary sequence of the detection target;

[0073] The spacer sequence is shown in SEQ ID NO: 8: AACCCCTACCAACTGGTCGGGGTTTGAAAC;

[0074] The detection target is a 22 or 30 nt sequence rich in U at the 5' end of the viral coat protein gene or viral functional gene region, with the number of consecutive Us being ≥4;

[0075]

[0076] The gene editing vector is pHSE401.

[0077] In the present invention, in the present invention, in step (1), before being integrated into the crRNA expression vector, the expression sequence needs to be synthesized into a double-stranded DNA fragment, and the synthesis method is as follows: using the expression sequence as a template to design forward and reverse primers, the forward and reverse primers are mixed and placed in a 90°C metal bath for 10 minutes, and cooled to 25°C to synthesize a double-stranded DNA fragment;

[0078] When synthesizing double-stranded DNA fragments, the expression sequence needs to add residual bases of the BsaⅠ restriction site at both ends of the sequence in order to be inserted into the crRNA expression vector.

[0079] In the present invention, in step (1), the detection target or the expression sequence is integrated into the crRNA expression vector through two BsaⅠ restriction sites between the promoter and the terminator.

[0080] In the present invention, in step (2), the host bacteria is Agrobacterium LBA4404;

[0081] The inoculated solution needs to be left standing for 4 to 6 hours, preferably 5 hours; the standing temperature is 20 to 30°C, preferably 25°C.

[0082] In the present invention, in step (4), the method of inoculating the target virus is infectious cloning or friction inoculation;

[0083] If the target virus has an infectious clone, it is preferred to use the infectious clone for injection; if the target virus does not have an infectious clone, it is preferred to use friction inoculation for vaccination;

[0084] The position for inoculating the virus is within the range of the injection of the inoculation solution; the position for injecting the inoculation solution is the back of the leaves of the transgenic tobacco.

[0085] The present invention also provides the application of the screening method in screening plant antiviral crRNA targets

[0086] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0087] Example 1

[0088] (1) The CasRx sequence from Ruminococcus flavefaciens XPD3002 (NCBI Reference Sequence: NZ_FPJT01000005.1, Cas13d gene 4911-7814) was codon-optimized to obtain the zmCasRx sequence; the nuclear localization signal peptide NLS was fused to both ends of the zmCasRx, and a 3×Flag tag was fused to the N-terminus to obtain the optimized zmCasRx sequence, as shown in FIG. Figure 1 As shown in A;

[0089] (2) The CasRx sequence from Ruminococcus flavefaciens XPD3002 (NCBI Reference Sequence: NZ_FPJT01000005.1, Cas13d gene 4911-7814) was optimized for tobacco codons to obtain the ntCasRx sequence; the nuclear localization signal peptide NES was fused to both ends of ntCasRx, and the HA tag was fused to the C-terminus to obtain the optimized ntCasRx sequence, as shown in FIG. Figure 1 As shown in B;

[0090] (3) A plant virus-interfering CasRx was obtained by fusing the modified zmCasRx sequence and the modified ntCasRx sequence through a 2A linker peptide, and was named biCasRx, such as Figure 1 As shown in C;

[0091] (2) The nucleotide sequence of biCasRx was constructed into the pUC57-simple plasmid (purchased from GenScript Biotech Co., Ltd.) to obtain a recombinant plasmid. The recombinant plasmid was inserted into the multiple cloning site of the pSuper1300 expression vector (from China Agricultural University) through the restriction endonuclease sites XbaⅠ and SacⅠ carried by the recombinant plasmid to construct the binary expression vector pSuper-biCasRx for plant transformation. Figure 2 As shown;

[0092] (3) The recombinant expression vector (binary expression vector pSuper-biCasRx) was transformed into Agrobacterium tumefaciens LBA4404, and then transformed into Nicotiana benthamiana using Agrobacterium-mediated genetic transformation technology. Transformation-positive strains were obtained through resistance screening and transgenic positive identification, and pSuper-biCasRx transgenic Nicotiana benthamiana was obtained.

[0093] Example 2 High-efficiency target screening for Turnip mosaic virus (TuMV)

[0094] Turnip mosaic virus (TuMV) is a positive-sense, single-stranded virus of the genus Potyvirus. Compared to other viruses, TuMV has a broad host range. Under artificial inoculation, it has been found in at least 318 dicotyledonous plant species, excluding the Brassicaceae, belonging to 43 families and 156 genera, including Asteraceae, Solanaceae, Chenopodiaceae, Amaranthaceae, Fabaceae, and Caryophyllaceae. Under natural conditions, its main hosts include Chinese cabbage, rapeseed, mustard greens, cabbage, cauliflower, mustard, carrots, and other cruciferous plants.

[0095] (1) Detection target sequence selection and expression sequence synthesis

[0096] The 22 nt U-rich sequences at the 5' end of three protein-coding genes of Turnip Mosaic Virus (NCBI Reference Sequence: NC_002509.2) were selected as detection target sequences. Three detection targets were selected for each gene, for a total of nine detection targets, as shown in Table 1.

[0097] The above 9 detection target sequences were reverse-complemented and then the spacer sequence was added to obtain the expression sequence, that is, the expression sequence was: AACCCCTACCAACTGGTCGGGGTTTGAAAC+22nt detection target reverse-complement sequence; the residual bases of BsaⅠ were added after the expression sequence, and the forward and reverse primers were designed using the expression sequence as a template. The forward and reverse primer sequences are shown in Tables 1 and Figure 1 As shown in E.

[0098] Table 1 TuMV detection target sequence and forward and reverse primer sequences

[0099]

[0100]

[0101] The above 9 pairs of forward and reverse primer sequences were annealed separately to obtain 9 double-stranded DNA fragments. The specific steps are as follows: 10 μL of TuMV-Hc-T1F and TuMV-Hc-T1R dissolved into 100 μM were taken respectively and mixed, placed in a 95°C metal bath for 10 minutes, and then the metal bath was turned off and allowed to cool naturally to 25°C to obtain the double-stranded DNA fragment TuMV-Hc-T1. According to the above method, the other double-stranded DNA fragments were obtained in sequence: TuMV-Hc-T2, TuMV-Hc-T3, TuMV-NIb-T1, TuMV-NIb-T2, TuMV-NIb-T3, TuMV-CI-T1, TuMV-CI-T2, and TuMV-CI-T3.

[0102] (2) Construction of target vector

[0103] The gene editing vector pHSE401 (from China Agricultural University) was used as the backbone, and the Cas9 expression cassette and the sgRNA-scaffold in the sgRNA expression cassette on the gene editing vector were deleted, while the AtU6-26 promoter and AtU6-29 terminator were retained to obtain the pAtU6-crRNA expression vector, as shown in FIG. Figure 1 As shown in D;

[0104] The crRNA expression vector was digested with BsaⅠ to obtain a digestion product, and the digestion product was subjected to electrophoresis detection, which was consistent with expectations; the digestion product was placed in a 65°C metal bath for 20 minutes to inactivate the BsaⅠ digestion, thereby obtaining an inactivated digestion product; 1 μL of the inactivated digestion product was taken and connected with the DNA double-stranded fragments of the 9 expression vectors in step (1) to obtain ligation products pAT-TuMV-Hc-T1, pAt-TuMV-Hc-T2, pAt-TuMV-Hc-T3, pAt-TuMV-NIb-T1, pAt-TuMV-NIb-T2, pAt-TuMV-NIb-T3, pAt-TuMV-CI-T1, pAt-TuMV-CI-T2, and pAt-TuMV-CI-T3; the 9 digestion products were screened on LB solid culture plates containing 100 mg / L kanamycin, identified by colony PCR, and confirmed by plasmid sequencing to obtain 9 successfully constructed target vectors;

[0105] The system and procedure of colony PCR are as follows:

[0106] System: 1 μL of 10 μM forward and reverse primer mix, 10 μL of Taq mix, 19 μL of ddH2O. Dip a small amount of colony into the tip of the pipette and dissolve it in the reaction system as a template.

[0107] Program: 95°C, 10 min-(95°C, 15 s-60°C, 15 s-72°C, 30 s) × 30 rounds-72°C, 5 min-16°C, forever.

[0108] (3) Preparation of transgenic tobacco seedlings for testing

[0109] T2 generation pSuper-biCasRx transgenic Nicotiana benthamiana described in Example 1 was used as the test material; the Nicotiana benthamiana seedlings for the test were sown in advance and cultured in a light incubator at 25° C., 16 h / 8 h photoperiod, light intensity of 20,000 Lux, and relative humidity of 60% (to avoid interference from aphids and other virus transmission).

[0110] (4) Target vector injection

[0111] The 9 target vectors successfully constructed in step (2) were transformed into Agrobacterium LBA4404 respectively, and the positive clones were screened by PCR identification of the colonies; 50 mL of the positive clones were cultured at 28°C overnight with shaking, and the OD value of the bacterial solution was 600 = 1, centrifuge the bacterial solution at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacteria in Agrobacterium infection buffer (10 mM MES, 10 mM MgCl2, 150 μM acetosyringone) to adjust the OD of the bacterial solution to 600 The inoculum was set to 0.5 to obtain the inoculum. After allowing the inoculum to rest for 6 hours, 400 μL of the inoculum was injected into the undersides of leaves of pSuper-biCasRx transgenic Nicotiana benthamiana plants using a sterile 1 mL disposable syringe with the needle removed. This yielded transgenic tobacco plants containing the target site. Five transgenic tobacco plants were injected into each target site, with one leaf per plant. A wild-type Nicotiana benthamiana control was also included and injected with the target site as described above.

[0112] (5) Virus inoculation

[0113] Two days after the target vector was injected, the infectious cloning vector (TuMV-GFP, the infectious cloning vector was fused with GFP protein at the Hc-pro fusion end, so the systemic infection of the virus particles could be indicated by the distribution of green fluorescent protein) was transformed into Agrobacterium. 50 μL of Agrobacterium transformed with the infectious cloning vector was cultured at 28°C overnight with shaking. The bacterial solution OD 600 = 1, centrifuge the bacterial solution at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacteria in Agrobacterium infection buffer (10 mM MES, 10 mM MgCl2, 150 μM acetosyringone) to adjust the OD of the bacterial solution to 600The concentration of the virus was 0.25, and the suspension was allowed to stand for 6 hours to obtain a suspension of TuMV virus infectious clones. The suspension of TuMV virus infectious clones was injected into the target vector-injected leaves. The injection range was within the target vector injection range. The injection volume was 200 μL. Figure 1 As shown in F; wild-type Nicotiana benthamiana seedlings were used as a control and inoculated with the same dose of virus-infectious clone solution.

[0114] (6) Systemic symptom observation and virus content detection

[0115] The transgenic tobacco seedlings and wild-type N. benthamiana seedlings after virus inoculation were cultured in a light incubator at 25°C, 16h / 8h photoperiod, 20,000 Lux of light intensity, and 60% relative humidity, and the systemic disease of the plants was observed.

[0116] After 5 days of culture, the wild type showed symptoms of virus disease. Real-time fluorescence quantitative PCR and western-blot were used to detect the virus particle content in the top system leaves of all transgenic tobacco injected with target sites. The test results are as follows: Figures 3-5 As shown, Figure 3 It is a systematic comparison of the symptom symptoms of virus interference efficiency at 9 targets. Figure 4 This is the qRT-PCR virus content detection result comparing the interference efficiency of 9 targets on TuMV. Figure 5 The figure shows the Western-blot test results of the virus content, comparing the interference efficiency of 9 targets on TuMV.

[0117] from Figures 3-5 As can be seen from the results, among the nine targets, TuMV-CI-T3, TuMV-NIb-T2, and TuMV-NIb-T1 exhibited higher interference efficiencies, with TuMV-CI-T3 showing the highest viral interference efficiency. In summary, through the above process, the optimal viral crRNA target, TuMV-CI-T3, was successfully identified, laying a practical foundation for the subsequent stable transgenic creation of crop varieties specifically resistant to TuMV.

[0118] Example 3 High-efficiency target screening of potato virus Y (PVY)

[0119] (1) Detection target sequence selection and expression sequence synthesis

[0120] The 30 nt sequence rich in U at the 5' end was selected from the sequence of potato virus Y (NCBI GenBank: NC_001616.1) as the detection target sequence, and four detection targets were selected, as shown in Table 2;

[0121] The above four detection target sequences were reverse-complemented and then a spacer sequence was added to obtain the expression sequence, that is, the expression sequence was: AACCCCTACCAACTGGTCGGGGTTTGAAAC+30nt detection target reverse-complement sequence; the residual bases of BsaⅠ were added after the expression sequence, and the forward and reverse primers were designed using the expression sequence as a template. The forward and reverse primer sequences are shown in Table 2.

[0122] Table 2 PVY detection target sequence and forward and reverse primer sequences

[0123]

[0124] The four pairs of forward and reverse primer sequences were annealed separately to obtain four double-stranded DNA fragments. The specific steps were as follows: 10 μL of PVY-T1F and PVY-T1R dissolved in 100 μM were mixed and placed in a 95°C metal bath for 10 minutes. The metal bath was then closed and the mixture was allowed to cool naturally to 25°C to obtain the double-stranded DNA fragment PVY-T1. The other double-stranded DNA fragments: PVY-T2, PVY-T3, and PVY-T4 were obtained in sequence according to the above method.

[0125] (2) Construction of target vector

[0126] The gene editing vector pHSE401 (from China Agricultural University) was used as the backbone. The Cas9 expression cassette and the sgRNA-scaffold in the sgRNA expression cassette on the gene editing vector were deleted, while the AtU6-26 promoter and AtU6-29 terminator were retained to obtain the pAtU6-crRNA expression vector.

[0127] The crRNA expression vector was digested with BsaⅠ to obtain digestion products, which were detected by electrophoresis and met expectations; the digestion products were placed in a 65°C metal bath for 20 min to inactivate the BsaⅠ digestion, thereby obtaining inactivated digestion products; 1 μL of the inactivated digestion products were taken and ligated with the DNA double-stranded fragments of the four expression vectors in step (1) to obtain ligation products pAT-PVY-T1, pAt-PVY-T2, pAt-PVY-T3, and pAt-PVY-T4; the four digestion products were screened on LB solid culture plates containing 100 mg / L kanamycin, identified by colony PCR, and confirmed by plasmid sequencing to obtain four successfully constructed target vectors;

[0128] The system and procedure of colony PCR are as follows:

[0129] System: 1 μL of 10 μM forward and reverse primer mix, 10 μL of Taq mix, 19 μL of ddH2O. Dip a small amount of colony into the tip of the pipette and dissolve it in the reaction system as a template.

[0130] Program: 95°C, 10 min-(95°C, 15 s-60°C, 15 s-72°C, 30 s) × 30 rounds-72°C, 5 min-16°C, forever.

[0131] (3) Preparation of transgenic tobacco seedlings for testing

[0132] T2 generation pSuper-biCasRx transgenic Nicotiana benthamiana described in Example 1 was used as the test material; the Nicotiana benthamiana seedlings for the test were sown in advance and cultured in a light incubator at 25° C., 16 h / 8 h photoperiod, light intensity of 20,000 Lux, and relative humidity of 60% (to avoid interference from aphids and other virus transmission).

[0133] (4) Target vector injection

[0134] The four target vectors successfully constructed in step (2) were transformed into Agrobacterium LBA4404 respectively, and the positive clones were screened by PCR identification of the colonies; 50 mL of the positive clones were cultured at 28°C overnight with shaking, and the OD value of the bacterial solution was 0. 600 = 1, centrifuge the bacterial solution at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacteria in Agrobacterium infection buffer (10 mM MES, 10 mM MgCl2, 150 μM acetosyringone) to adjust the OD of the bacterial solution to 600 The inoculum was set to 0.5 to obtain the inoculum. After the inoculum was allowed to stand for 6 hours, 400 μL of the inoculum was injected into the undersides of leaves of pSuper-biCasRx transgenic Nicotiana benthamiana seedlings using a sterile 1 mL disposable syringe with the needle removed. This yielded transgenic tobacco plants containing the target site. Five transgenic tobacco plants were injected into each target site, with one leaf per plant. A wild-type Nicotiana benthamiana control (WT) was also included and injected with the target site as described above.

[0135] (5) Virus inoculation

[0136] PVY virus was inoculated by friction inoculation. In this case, the modified PVY virus PVY-Ros1 (which accumulates on systemic leaves as rose-red spots after infecting plants) was used as the target virus.

[0137] Two days after target vector injection, a friction inoculation solution containing PVY-Ros1 toxin was prepared. One gram of PVY-Ros1-infected common tobacco leaves was ground into a sterile mortar with 30 mL of PBS buffer (pH 6.8) to form a slurry. The slurry was then filtered through gauze to remove tissue debris, obtaining the filtrate for friction inoculation. A small amount of corundum was sprinkled on the front of pSuper-biCasRx transgenic Nicotiana benthamiana leaves injected with the target crRNA vector. Then, 100 μL of the filtrate was pipetted onto the front of the leaves injected with the target crRNA vector and gently applied with the index fingertip for a fixed number of times (5 times) with the same force, ensuring that the friction range was within the target vector injection range.

[0138] (6) Systemic symptom observation and virus content detection

[0139] The transgenic tobacco seedlings and wild-type N. benthamiana seedlings after virus inoculation were cultured in a light incubator at 25°C, 16h / 8h photoperiod, 20,000 Lux light intensity, and 60% relative humidity.

[0140] After 14 days of culture, the virus particle content in the top system leaves of all transgenic tobacco seedlings injected with target sites was detected by real-time fluorescence quantitative PCR. Three transgenic tobacco seedlings were randomly tested for each target site. The test results are as follows: Figure 6 After 21 days of cultivation, the systemic disease of the plants was observed, as shown in Figure 7 As shown;

[0141] from Figures 6-7 It can be seen that 21 days after inoculation with PVY-Ros1, the systemic leaves of wild-type Nicotiana benthamiana curled strongly, and viruses accumulated near the central growth point of the new leaves and indicative red spots appeared. After injection of the target crRNA vector, the transgenic Nicotiana benthamiana of pSuper-biCasRx only showed slight curling of the systemic leaves without obvious red spots. The targets PVY-T1, PVY-T2, PVY-T3, and PVY-T4 all showed high interference efficiency, especially the targets PVY-T1, PVY-T2, and PVY-T3. Therefore, the best viral crRNA targets were successfully screened as PVY-T1, PVY-T2, and PVY-T3, laying a practical foundation for the subsequent stable transgenic creation of crop varieties specifically resistant to PVY virus.

[0142] As can be seen from the above examples, the present invention provides a CasRx that interferes with plant viruses, a preparation method thereof, a recombinant expression vector, and a recombinant bacterium. It also provides a method for screening efficient plant antiviral crRNA target sequences based on CasRx. This process relies on the transient expression evaluation of the test target in CasRx transgenic Nicotiana benthamiana, which greatly reduces the breeding risk caused by invalid or inefficient targets and accelerates the plant antiviral breeding process.

[0143] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for screening target sequences of plant antiviral crRNA based on CasRx, characterized in that: The steps include: (1) Integrating the expression sequence of the detection target into the crRNA expression vector to obtain a target vector; (2) transforming the target vector into a host bacterium, collecting a bacterial solution with an OD value of 0.4 to 0.6, and obtaining a solution to be inoculated; (3) injecting the inoculated solution into transgenic tobacco to obtain transgenic tobacco containing the target site; (4) inoculating the target virus into the transgenic tobacco containing the target site, observing the severity of the viral disease symptoms of the transgenic tobacco inoculated with the target virus and measuring the virus content, and selecting the target site with high interference efficiency with the target virus as the target site sequence; The method for constructing transgenic tobacco comprises the following steps: transforming the recombinant bacteria into Nicotiana benthamiana, screening positive strains, and obtaining transgenic tobacco; The recombinant bacteria include the nucleotide sequence of editing CasRx and empty bacteria; The empty-load bacteria are Agrobacterium; The nucleotide sequence of the editing CasRx is shown in SEQ ID NO: 1; The preparation method of CasRx comprises the following steps: fusing the modified zmCasRx sequence and the modified ntCasRx sequence through a connecting peptide; The modification method of the zmCasRx sequence is as follows: fusing localization peptides at both ends of the zmCasRx sequence and fusing a tag protein at the N-terminus to obtain a modified zmCasRx sequence; The zmCasRx sequence is shown in SEQ ID NO: 2; The localization peptide is NLS; the tag is a Flag tag; The sequence of the localization peptide NLS is shown in SEQ ID NO: 3; the sequence of the tag Flag is shown in SEQ ID NO: 4; The modification method of the ntCasRx sequence is as follows: fusing localization peptides at both ends of the ntCasRx sequence and fusing a tag protein at the C-terminus to obtain a modified ntCasRx sequence; The ntCasRx sequence is shown in SEQ ID NO: 5; The positioning peptide is NES; the tag is HA tag; The sequence of the positioning peptide NES is shown in SEQ ID NO: 6; the sequence of the tag HA is shown in SEQ ID NO: 7; The connecting peptide is a 2A connecting peptide.

2. The screening method according to claim 1, characterized in that The expression sequence of the detection target includes a spacer sequence and a reverse complementary sequence of the detection target; The spacer sequence is shown in SEQ ID NO: 8; The detection target is a 22-30 nt sequence rich in U at the 5' end of the viral coat protein gene or the viral functional gene region, and the number of consecutive Us is ≥4; The crRNA expression vector is constructed as follows: using the gene editing vector as a skeleton, deleting the Cas9 expression cassette on the gene editing vector and the sgRNA-scaffold in the sgRNA expression cassette, retaining the AtU6-26 promoter and the AtU6-29 terminator, and obtaining the crRNA expression vector.

3. Application of the screening method according to claim 1 or 2 in screening targets of plant antiviral crRNA.

Images