A method for efficiently screening and identifying gene-edited plant mutants

By combining Bsl I endonuclease and CAPS labeling technology, specific primers were designed for PCR amplification and enzyme cleavage, which solved the problems of high cost, expensive equipment and low sensitivity of gene-edited plant mutants screening and identification in the prior art, and achieved low cost and efficient mutant screening and identification.

CN118421766BActive Publication Date: 2025-08-05YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410469367.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-18
Publication Date
2025-08-05
Estimated Expiration
2044-04-18

AI Technical Summary

Technical Problem

The prior art has problems such as high cost, expensive equipment, complex operation and low sensitivity in the screening and identification of gene-edited plant mutants, and it is difficult to efficiently distinguish homozygous mutations, heterozygous mutations and chimeric mutants.

Method used

Bsl I endonuclease combined with CAPS and dCAPS labeling technology was used to design specific primers for PCR amplification and enzyme cleavage, and the PCR product band was analyzed by electrophoresis. The Bsl I cleavage site CCNNNNNNNGG was used to identify the Indel variant near the PAM site, and combined with Sanger sequencing verification results.

Benefits of technology

It realizes low-cost, fast and efficient gene-edited plant mutant screening, which can distinguish homozygous, heterozygous and chimeric mutants, and is suitable for high-throughput screening, with high sensitivity and no expensive equipment required.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118421766B_ABST
    Figure CN118421766B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for efficiently screening and identifying gene-edited plant mutants. The present invention discloses a simple, economical, rapid and efficient method for screening and identifying plant gene-edited mutants by using a restriction endonuclease Bsl I in combination with CAPS and dCAPS marker technologies. It has been verified that this method has good detection accuracy. The present invention can be widely applied to the screening and identification of gene-edited animals, plants and microorganisms, and has broad practicality and market promotion value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for efficiently screening and identifying gene-edited plant mutants. Background Art

[0002] CRISPR-Cas9 is the third-generation gene editing technology, following the introduction of ZFNs, TALENs, and other gene editing technologies. In just a few years, CRISPR-Cas9 has taken the world by storm, becoming one of the most efficient, simplest, lowest-cost, and most accessible technologies for gene editing and modification, and becoming the most mainstream gene editing system today. CRISPR-Cas9 gene editing technology uses artificially designed sgRNA (guide RNA) to identify target genomic sequences and direct the Cas9 protease to effectively cleave double-stranded DNA, creating double-strand breaks. The subsequent repair of these breaks can result in gene knockout or knockin, ultimately modifying genomic DNA.

[0003] Plant gene editing technology often requires the use of plant genetic transformation methods, such as electroporation and Agrobacterium-mediated genetic transformation, to achieve editing purposes such as insertion, deletion, and replacement of specific sites in the plant genome, thereby quickly obtaining varieties with specific target traits and accelerating breeding.

[0004] Considering the limitations of gene editing technology and genetic transformation methods, a large number of mutant plants with different genotypes are often produced during the genetic transformation process, most of which have single or multiple base insertions or deletions, which poses a challenge to the rapid identification and detection of edited plants.

[0005] Currently, plant genome editing mutation detection methods mainly include PCR / RE, T7EI mismatch cleavage, critical annealing temperature PCR (ACT-PCR), Sanger sequencing, and next-generation sequencing (NGS). However, these methods all have certain limitations. The PCR / RE method requires the design of a target site containing a restriction endonuclease site, but it is often difficult to find a suitable restriction endonuclease site; T7EI cannot distinguish between homozygous mutants and wild types, or between heterozygous mutants and biallelic mutants, and is prone to false positives; ACT-PCR has extremely high requirements for PCR reaction conditions and cannot detect heterozygous mutations; Sanger sequencing and NGS are relatively expensive, especially for large populations. Summary of the Invention

[0006] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.

[0007] In view of the above problems existing in the above and / or the prior art, the present invention is proposed.

[0008] Therefore, the object of the present invention is to overcome the deficiencies in the prior art and provide a method for efficiently screening and identifying gene-edited plant mutants.

[0009] To solve the above technical problems, the present invention provides the following technical solutions: A method for efficiently screening and identifying gene-edited plant mutants, comprising:

[0010] Design a forward primer and a reverse primer respectively upstream and downstream of the PAM site;

[0011] Extract genomic DNA of wild-type and transgenic plants using the CTAB method;

[0012] Using the extracted genomic DNA of wild-type plants and transgenic plants as templates, perform PCR amplification using primer F, primer R, and Taq polymerase;

[0013] Mix the PCR product with Bsl I endonuclease and perform an enzymatic digestion reaction;

[0014] After electrophoresis, compare the bands of the enzymatic digestion product with the bands of the PCR product of wild-type plants.

[0015] As a preferred embodiment of the method of the present invention, it includes: extracting genomic DNA of each gene-edited transformed plant using the CTAB method, and obtaining leaf discs of the same size with a punch.

[0016] As a preferred embodiment of the method of the present invention, it includes: designing specific primers upstream and downstream of the PAM site.

[0017] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for designing sgRNA primers for screening and identifying gene-edited mutants.

[0018] As a preferred embodiment of the primer design method of the present invention, it includes: the primer design method is any one of the following:

[0019] (1) The sgRNA target sequence - PAM sequence N1N2N3N4N5N6N7N8N9N in the CRISPR-Cas9 vector 10 N 11 N 12 N13N 14 N 15 N 16 N 17 N 18 N 19 N 20 N 21G 22 G 23 In it, N 13 = C, and N 14 = C. Design a forward primer and a reverse primer respectively upstream and downstream of the PAM site, and ensure that the PCR product does not contain other BslI restriction sites except the N 13 -G 23 site, with a length of 100 - 1000 bp. The wild type can be digested by Bsl I to produce a band that is significantly different in size from the undigested PCR product after electrophoresis;

[0020] (2) If N 13 = C and N 14 = C are not satisfied simultaneously, then design the forward primer (primer F) with a length of 25 - 35 nt, located upstream of the PAM, that is, 9 - 19 bases upstream of the sgRNA target sequence plus N1N2N3N4N5N6N7N8N9N 10 N 11 N 12 CCN 15 N 16 , and the reverse primer (primer R) is a reverse complementary sequence within 100 - 200 bp downstream of the PAM, and ensure that the PCR product does not contain BslI restriction sites except the CCN 15 N 16 N 17 N 18 N 19 N 20 N 21 G 22 G 23 site.

[0021] As a preferred scheme of the method described in the present invention, it includes: the reaction system of the PCR amplification is 20 μl, including 1 μl of template, 10 μl of 2×TaqMasterMix, 0.5 μl of each of the upstream and downstream primers (10 μM), and the balance is water.

[0022] As a preferred scheme of the method described in the present invention, it includes: the reaction program of the PCR amplification includes pre - denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 30 s, 40 cycles; extension at 72 °C for 5 min.

[0023] As a preferred scheme of the method described in the present invention, it includes: the reaction system of the restriction digestion is 10 μl, including 5 μl of PCR product; 0.1 μl of Bsl I enzyme; 1 μl of rCutsmart Buffer.

[0024] As a preferred embodiment of the method of the present invention 10 N 11 N 12 N 13 N 14 N 15 N 16 N 17 N 18 N 19 N 20 N 21 G22G 23 The program of the restriction enzyme digestion reaction is 55°C for 1 h; after the reaction is completed, it is stored at 4°C.

[0025] As a preferred embodiment of the identification method of the present invention, it includes: the genotype with the same band as the PCR-restriction enzyme digestion product of the wild-type plant is wild-type; the genotype with different restriction enzyme digestion bands from the wild-type is one of homozygous mutation, heterozygous mutation, chimera, and biallelic mutation; the one with both the same band and different bands as the wild-type appears is heterozygote or chimera; the restriction enzyme digestion band with a different size from the wild-type band is homozygous mutation or biallelic mutation.

[0026] Advantages of the present invention:

[0027] 1. The method provided by the present invention is low-cost, mainly involving the processes of PCR and restriction enzyme digestion. In PCR, only ordinary Taq polymerase is required, without the use of high-fidelity DNA polymerase. In restriction enzyme digestion, only one unit (0.1 μl) / each sample of Bsl I endonuclease is required in conventional identification to meet the detection needs.

[0028] 2. The method provided by the present invention has a simple process and does not involve expensive instruments and specific devices such as quantitative PCR instruments, only requiring steps of PCR, restriction enzyme digestion, and electrophoresis.

[0029] 3. The method provided by the present invention has high sensitivity and strong precision, and Sanger sequencing is used to prove the feasibility of this method.

[0030] 4. The method provided by the present invention is fast and efficient. Starting from PCR, the whole process only takes 3 - 5 hours to obtain the detection result, and at the same time, it can be widely and efficiently applied to high-throughput screening and identification of gene editing mutants with low editing efficiency.

[0031] [[ID=4

[0032] 6. Most of the present disclosure can not only be applied to the screening and identification of gene-edited plant mutants, but also can be used for the screening and identification of gene-edited animal or microbial mutants. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings. Among them:

[0034] Figure 1 It is the nucleotide sequence near the sgRNA target site of AtBSK2 in Example 1.

[0035] Figure 2 It is the screening and identification of AtBSK2 CRISPR-Cas9 gene-edited mutants in Example 1. Lane 1 is Col-0, and the electrophoresis situation after the PCR product (5 μl) is digested with Bsl I enzyme (0.1 μl) for 1 h is shown. Lanes 2-16 are the products of PCR and Bsl I digestion of the genomic DNA of the T1 generation CRISPR-Cas9 transgenic plants to be identified. The DNA samples of each plant are amplified by PCR with atbsk2IDF and atbsk2IDR as primers, and the electrophoresis results after the PCR product (5 μl) is digested with Bsl I enzyme (0.1 μl) at 55 °C for 1 h are shown. Lanes 4, 6, 7, and 13 are heterozygous / chimeric mutant types, and their PCR products can be digested, and bands the same as and different from the wild type are generated during electrophoresis; Lane 11 is a homozygous mutant / biallelic mutant type, and only bands different from the wild type are generated after the digestion electrophoresis of its PCR product.

[0036] Figure 3 It is the Sanger sequencing verification of AtBSK2 CRISPR-Cas9 gene-edited mutants in Example 1. Figure 3 a is the Sanger sequencing peak map near the AtBSK2 sgRNA target sequence of wild type Col-0 and two identified mutant plants (Plant 4 and Plant 11). The sequence shown within the red frame is the sgRNA target sequence, and the PAM sequence is underlined; Figure 3 b is the sequence information near the AtBSK2 sgRNA target sequence of the wild type and two mutants. The red annotation indicates the base insertion situation in the mutant.

[0037] Figure 4Electrophoresis results after digestion of AtBSK2 PCR products with different amounts of Bsl I enzyme in Example 1. Lane 1 is Col-0, showing the electrophoresis result after digestion of its PCR product (5 μl) with Bsl I enzyme (0.1 μl) for 1 h. Lanes 2 - 6 represent the electrophoresis results after digestion of the PCR product of Col-0 with Bsl I enzyme at 0.4 μl (4 active units), 0.2 μl (2 active units), 0.1 μl (1 active unit), 0.05 μl (0.5 active unit), 0.025 μl (0.25 active unit), and 0.0125 μl (0.125 active unit) respectively at 55 °C for 1 h.

[0038] Figure 5 Digestion results of Bsl I on AtBSK2 PCR products at different times in Example 1. The digestion reaction times of lanes 1, 2, 3, 4, and 5 are 0 min, 1 min, 5 min, 15 min, and 1 h respectively.

[0039] Figure 6 Bsl I digestion results after mixing AtBSK2 wild type and mutants in different ratios in Example 1. Lane 1 shows the electrophoresis result after treating the known Col-0 PCR product with 0.1 μl (i.e., 1 active unit) of Bsl I for 1 h. Lane 2 shows the electrophoresis result of the AtBSK2 PCR product of Col-0 without digestion. Lane 3 shows the electrophoresis result after treating the known atbsk2 mutant PCR product with 0.1 μl (i.e., 1 active unit) of Bsl I for 1 h. Lanes 4 - 7 show the electrophoresis results after PCR-Bsl I digestion of the mixtures of atbsk2 homozygote and Col-0 genomic DNA at ratios of 1:1, 1:4, 1:9, and 1:19 respectively.

[0040] Figure 7 Screening and identification of AtNRG1.3 gene-edited mutants in Example 2. Among them, a is the DNA sequence near the sgRNA target site of AtNRG1.3 and the information of identification primers. In b, lane 1 is Col-0, and lanes 2 - 11 are the T1 generation gene-edited plants to be identified, showing the electrophoresis results after digestion of their PCR products (5 μl) with Bsl I enzyme (0.1 μl) for 1 h.

[0041] Figure 8 Screening and identification of OsPYL5 gene-edited mutants in Example 3. Among them, a is the DNA sequence near the sgRNA target site of OsPYL5 and the information of identification primers. In b, lane 1 is Col-0, and lanes 2 - 11 are the T1 generation gene-edited plants to be identified, showing the electrophoresis results after digestion of their PCR products (5 μl) with Bsl I enzyme (0.1 μl) for 1 h.

[0042] Figure 9 Screening and identification of the AtPUB2 gene-editing mutants in Example 4. Among them, a is the DNA sequence near the sgRNA target site of AtPUB2 and the identification primers; in b, lane 1 is Col-0, and lanes 2-11 are the mixed samples of leaves of every six T1 generation gene-editing single plants to be identified. The electrophoresis of the PCR products (5 μl) after digestion with Bsl I enzyme (0.1 μl) for 1 h is shown. 2-11 are the mixed samples of plants 1-6, 7-12, 13-18, 19-24, 25-30, 31-36, 37-42, 43-48, 49-54, 55-60 respectively; in c, lane 1 is Col-0, and lanes 2-7 are the 13-18th T1 generation gene-editing single plants to be identified. The electrophoresis of the PCR products (5 μl) after digestion with Bsl I enzyme (0.1 μl) for 1 h is shown. Detailed implementation manners

[0043] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention will be given in combination with the embodiments of the specification.

[0044] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below. Secondly, the so-called "one embodiment" or "embodiment" herein refers to a specific feature, structure or characteristic that may be included in at least one implementation manner of the present invention. The "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor is it a separate or selectively exclusive embodiment from other embodiments.

[0045] Raw materials and reagents used in the present invention: Bsl I restriction enzyme (NEB), rCutsmart Buffer (NEB), 2×TaqMasterMix (Vazyme), CTAB, isopropanol, 75% ethanol, TAE electrophoresis buffer, nucleic acid dye, etc.

[0046] Unless otherwise stated, the experimental methods disclosed in the present invention all adopt the conventional molecular biology and related conventional techniques in the technical field.

[0047] Example 1:

[0048] The gene-editing receptor material is Arabidopsis thaliana Col-0. Select a suitable sgRNA target sequence with a Bsl I restriction site, such as Figure 1As shown, the selected target site has the corresponding sequence of GCTCCAAACAAACCAGAATC from 5' to 3' in the gene, and the corresponding PAM is AGG. The CRISPR-Cas9 vector was constructed using the Golden Gate Assembly strategy, and Col-0 was transformed by the method of soaking pistils mediated by Agrobacterium. The T0 seeds were screened by hygromycin, and the T1 generation hygromycin-positive CRISPR-Cas9 transgenic plants were obtained.

[0049] 1. Primer Design

[0050] Primer bsk21DF (nucleotide sequence as shown in SEQ ID NO.2): ATTTCGTGTATAGTACCGAGG, Tm = 55°C was designed at 441 nt upstream of the target site GCTCCAAACAAACCAGAATC of the AtBSK2 gene (nucleotide sequence as shown in SEQ ID NO.1); primer bsk21DR (nucleotide sequence as shown in SEQ ID NO.3): GTTAGGGTTTGTGAAAGGCTT, Tm = 55°C was designed at 132 nt downstream.

[0051] 2. DNA Extraction

[0052] Put fresh leaves into a 1.5 mL centrifuge tube and grind the leaves. Then add 500 μl of CTAB extraction buffer, incubate in a water bath at 65°C for 1 h, and invert and mix every 15 min. Add 500 μl of chloroform, let stand for 2 min, centrifuge, transfer the upper aqueous phase to a new centrifuge tube, add 330 μl of isopropanol, precipitate at -20°C for 1 h. Centrifuge. Discard the supernatant, add 500 μl of 75% ethanol to wash the precipitate, centrifuge for 1 min, and discard the supernatant. Repeat once. Dry at room temperature for 20 min, add 80 μl of TE, let stand for 5 min, centrifuge, and store at -20°C.

[0053] 3. PCR of the Target Gene

[0054] PCR reaction system: 1 μl of template, 10 μl of 2×Taq Master Mix, 0.5 μl each of atbsk2IDF and atbsk2IDR primers with a concentration of 10 μM, and add water to make up to 20 μl. Reaction procedure: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, 40 cycles; extension at 72°C for 5 min. Store at 4°C for later use.

[0055] 4. Screening and Identification of Mutants

[0056] The restriction enzyme reaction system was prepared in a 250 μl centrifuge tube as follows: 5 μl of PCR product; 0.1 μl of Bsl I enzyme; 1 μl of rCutsmart Buffer, and the volume was made up to 10 μl with water. Reaction program: Incubate at 55 °C for 1 h. Electrophoresis was performed on the restriction enzyme-digested PCR products of each sample to obtain electrophoretic band information. The results are as Figure 2 shown. After electrophoresis, if there is only one band larger than the wild-type size, it is a homozygous mutant or a biallelic mutant. If two or more bands, identical and different from the wild-type, appear simultaneously, it is a heterozygote or a chimera. To further verify the feasibility of the method, Sanger sequencing was performed on the PCR products of the obtained homozygous mutant plants and wild-type plants. As Figure 3 shown in Figure 3 a is the sequencing peak map of the identified wild-type WT and homozygous mutant plants. The sequence circled by the red frame is the target sequence, and the PAM is underlined; Figure 3 b is the target sequence, and the base insertion at the sgRNA target site in the mutant is marked in red.

[0057] The electrophoresis results of the AtBSK2 PCR products digested with different amounts of Bsl I enzyme are as Figure 4 shown. Lane 1 is the known wild-type AtBSK2, and its PCR product can be digested by the enzyme; Lane 2 is the atbsk2 homozygous mutant, and its PCR product cannot be digested; In the restriction enzyme reactions represented by Lanes 3, 4, 5, 6, 7, and 8, the volumes of the restriction enzyme Bsl I are 0.4 μl (4 active units), 0.2 μl (2 active units), 0.1 μl (1 active unit), 0.05 μl (0.5 active unit), 0.025 μl (0.25 active unit), and 0.0125 μl (0.125 active unit), respectively. The preferred amount of Bsl I used is 0.05 μl (0.5 active unit).

[0058] The restriction enzyme digestion results of the AtBSK2 PCR products after treatment with Bsl I for different times are as Figure 5 shown. The restriction enzyme reaction times for Lanes 1, 2, 3, 4, and 5 are 0 min, 1 min, 5 min, 15 min, and 60 min, respectively. The preferred restriction enzyme digestion time is 15 min.

[0059] The Bsl I restriction enzyme digestion results of the mixtures of wild-type and mutant AtBSK2 at different ratios are as Figure 6As shown in the figure. Lane 1 is the digestion product of the known wild-type AtBSK2 Bsl I (0.1 μl, i.e., 1 active unit) after being treated with Bsl I for 1 h, and its PCR product can be completely digested by Bsl I; Lane 2 is the electrophoresis product of the PCR product of wild-type AtBSK2 without digestion; Lane 3 is the PCR-digestion product of the known atbsk2 mutant; Lanes 4-7 are the PCR and Bsl I digestion of the genomic DNA of the homozygous mutant and wild-type mixed at ratios of 1:1, 1:4, 1:9, and 1:19, respectively.

[0060] Example 2 The material to be screened and identified is the T1 generation CRISPR-Cas9 transgenic plants of Arabidopsis thaliana AtNRG1.3 gene.

[0061] 1. Primer design

[0062] Primer atnrg1DF (nucleotide sequence as shown in SEQ ID NO.5): AAGTTTAAGGAGATTGCGAGAGGCCA, Tm = 60 °C was designed at 12 nt upstream of the target site AGATCTTGCCTCTCGCAAT of the AtNRG1.3 gene (nucleotide sequence as shown in SEQ ID NO.4); primer atnrg1DR (nucleotide sequence as shown in SEQ ID NO.6): TGGACATGGCCTCATTTCTTGA, Tm = 58 °C was designed at 99 nt downstream.

[0063] 2. DNA extraction (same as Example 1)

[0064] 3. PCR of the target gene: The genomic DNA of Col-0 and the T1 generation transgenic plants of AtNRG1.3 CRISPR-Cas9 were used as templates. PCR reaction program: Pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 15 s, 40 cycles; extension at 72 °C for 5 min. Store at 4 °C.

[0065] 4. Screening mutants

[0066] The digestion reaction of the PCR product was carried out in a 1.5 ml centrifuge tube. Electrophoresis was performed on each digested PCR product to obtain electrophoretic band information.

[0067] The results showed that, as Figure 7 shown, after electrophoresis, those with only one electrophoretic band larger than the wild-type size were homozygous mutants or biallelic mutants, and those with two or more bands the same as and different from the wild-type were heterozygotes or chimeras.

[0068] Example 3 The material to be screened and identified is the T0 generation CRISPR-Cas9 transgenic rice plants of OsPYL5 gene

[0069] 1. Primer Design

[0070] At the target site 1 of the OsPYL5 gene (nucleotide sequence shown in SEQ ID NO.7): GCCGCAGAGGTACAAGCCGT, a primer ospyl5IDF (nucleotide sequence shown in SEQ ID NO.8): AGCGGCTGACGAACGGCTTGTACCTC, with Tm = 68°C was designed 12 nt upstream; a primer ospyl5IDR (nucleotide sequence shown in SEQ ID NO.9): TGGTTGATTGTATTGTTGGTGATGG, with Tm = 58°C was designed 99 nt downstream.

[0071] 2. DNA Extraction (same as Example 1)

[0072] 3. PCR of the Target Gene: PCR reaction program: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 69°C for 15 s, extension at 72°C for 15 s, 40 cycles; extension at 72°C for 5 min. Store at 4°C

[0073] 4. Screening for Mutants: Perform an enzymatic digestion reaction on the PCR products in a 1.5 ml centrifuge tube. Electrophorese each digested PCR product to obtain electrophoretic band information. As Figure 8 shown, after electrophoresis, those with only one electrophoretic band larger than the wild-type size are homozygous mutants or biallelic mutants, and those with two or more bands, including the same and different bands as the wild-type, are heterozygotes or chimeras.

[0074] In Example 4, the material to be screened and identified is the T1 generation CRISPR-Cas9 transgenic plant of Arabidopsis thaliana AtPUB2 gene.

[0075] 1. Primer Design

[0076] At the target site CATTGAATTGGTGAAGTTAG of the AtPUB2 gene (nucleotide sequence shown in SEQ ID NO.10), a primer atpub2IDF (nucleotide sequence shown in SEQ ID NO.11): CAGGAGTGCATTGAATTGGTCCA, with Tm = 60°C was designed 8 nt upstream; a primer atpub2IDR (nucleotide sequence shown in SEQ ID NO.12): TCGGCAATTTTCACCAGAACC, with Tm = 59°C was designed 97 nt downstream.

[0077] 2. DNA Extraction

[0078] For the T1 plants to be screened and identified, take leaf discs of the same area from every 6 plants using a hole punch, mix them, and extract genomic DNA using the CTAB method.

[0079] 3. PCR of the target gene

[0080] Use the genomic DNA of the mixed sample of every 6 plants as a template. PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 15 s, 40 cycles; extension at 72°C for 5 min. Store at 4°C.

[0081] 4. Screening mutants

[0082] Perform a digestion reaction on the PCR products in a 1.5 ml centrifuge tube. Electrophorese each digested PCR product to obtain electrophoretic band information. As Figure 8 shown in b, after electrophoresis, the sample with only one band larger than the wild-type size is a homozygous mutant or a biallelic mutant, and the sample with two or more bands the same as and different from the wild-type is a heterozygote or a chimera. Then, separately extract genomic DNA from each of the 6 plants in the third mixed sample (the mixed sample of plants No. 13 - 18) with a different band from the wild-type for PCR and digestion, and finally determine that the mutant plant is plant No. 17, which is an atpub2 heterozygote / chimera.

[0083] Comparative Example 1 Sequencing cost

[0084] Cost of Sanger sequencing:

[0085] For detecting 12 samples, the present invention costs approximately 20 yuan in total, and the cost of Sanger sequencing is approximately 120 yuan;

[0086] For detecting 96 samples, the present invention costs approximately 60 yuan in total, and the cost of Sanger sequencing is approximately 960 yuan.

[0087] The present invention provides a simple, economical and efficient method for screening and identifying mutants of diploid gene-edited plants. Based on the NGG sequence specificity of PAM, combined with CAPS marker technology and dCAPS marker technology, by designing specific primers, the wild-type PCR products can be specifically digested by Bsl I endonuclease, while the insertion or deletion of bases in the Bsl I recognition site CCNNNNNNGG results in the inability to be digested by Bsl I. After treatment with Bsl I endonuclease and electrophoresis, detect the digestion situation of the PCR products of each sample and the wild-type before and after digestion. After electrophoresis, the sample with only one digestion band different from the wild-type has a homozygous mutation or a biallelic mutation at the target site genotype; the sample with two or more bands the same as and different from the wild-type at the target site genotype is a heterozygous mutation or a chimera.

[0088] The Bsl endonuclease provided by the present invention recognizes CCNNNNNNNGG, and NGG appears in the PAM sequence. The vast majority of CRISPR-Cas9-induced gene mutations are located near the three bases upstream of the PAM site. Therefore, as long as the first two bases are CC, it can be recognized by Bsl I, and the probability is approximately 1 / 16. At the same time, this method also draws on the dCAPS marker technology. When designing primers, the corresponding positions (N13N14) of the sgRNA target sequence can be mutated to CC when they are not CC bases. The PCR product can be recognized and digested by Bsl I. Therefore, the selectivity for sgRNA is not strong and the applicability is wide. The Bsl I recognition site has 11 bases and can recognize the Indel caused by the PAM NGG base and the 8 bases upstream of it. Therefore, overall, this method can screen and identify most of the homozygous, heterozygous, chimeric, and biallelic mutations induced by CRISPR-Cas9. Most of the present disclosure can be not only applied to the screening and identification of gene-edited plant mutants, but also to the screening and identification of gene-edited animal or microbial mutants.

[0089] This method can also screen and identify some gene-edited transgenic plants with low gene editing efficiency by mixing the DNA of the leaves of multiple plants. Take 5-10 leaf discs with the same area of gene-edited single plants to be detected as a single mixed sample for extracting genomic DNA. After PCR, incubate with Bsl I enzyme at 55 °C for 1 h to terminate the reaction. After electrophoresis, compared with the wild type, if there are enzyme digestion bands different from the wild type in the mixed sample, there are gene-edited homozygous / heterozygous / chimeric / biallelic mutations. Extract the DNA of each single plant corresponding to the single mixed sample that has been identified as homozygous / heterozygous / chimeric / biallelic mutation, and screen and identify the mutant plants by PCR and Bsl I digestion.

[0090] Perform Sanger sequencing on the PCR products of the obtained homozygous mutant plants to confirm the feasibility of the method described in the present invention.

[0091] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A method for efficiently screening and identifying gene-edited plant mutants, characterized by: include, Design a specific forward primer and reverse primer respectively upstream and downstream of the PAM site; The genomic DNA of wild-type and transgenic plants was extracted using the CTAB method; The extracted genomic DNA of wild-type plants and transgenic plants was used as template to perform PCR amplification using forward primer F, reverse primer R and Taq polymerase; The PCR products were Bsl I endonuclease mixture, enzyme digestion reaction; Bsl The amount of endonuclease I was 0.05 μl; After electrophoresis, the enzyme digestion product bands were compared with the PCR product bands of the wild-type plant; The method for designing primers is any of the following: (1) sgRNA target sequence and PAM sequence N1N2N3N4N5N6N7 in CRISPR-Cas9 vector N8N9N 10 N 11 N 12 N 13 N 14 N 15 N 16 N 17 N 18 N 19 N 20 N 21 G 22 G 23 In, N 13 =C, and N 14 = C, design a forward primer and a reverse primer upstream and downstream of the PAM site, and ensure that the PCR product does not contain any residues other than N 13 -G 23 Other than sites Bsl I restriction enzyme site, length is 100-1000bp, the wild type can be Bsl Enzyme I cuts out a band that is obviously different in size from the uncut PCR product after electrophoresis; (2) sgRNA target sequence and PAM sequence in CRISPR-Cas9 vector N1N2N3N4N5N6N7N8N9N 10 N 11 N 12 N 13 N 14 N15N 16 N 17 N 18 N 19 N 20 N 21 G 22 G 23 In the case where N is not satisfied at the same time 13 =C,N 14 = C, then the forward primer should be 25-35 nt long and located upstream of PAM, so that the sgRNA target sequence is at the corresponding position N 13 N 14 If the base is not CC, it is mutated to CC. The reverse primer is a reverse complementary sequence within 100-200bp downstream of PAM, and ensure that the PCR product does not contain any base other than CCN. 15 N 16 N 17 N 18 N 19 N 20 N 21 G 22 G 23 Contains outside the site Bsl I restriction enzyme cutting site.

2. The method according to claim 1, wherein: The PCR amplification reaction system is 20 μL, including 1 μL of template, 10 μL of 2×Taq MasterMix, 0.5 μL of upstream and downstream primers, and the balance is water.

3. The method according to claim 1, wherein: The PCR amplification reaction procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds, 40 cycles; and extension at 72°C for 5 minutes.

4. The method according to claim 1, wherein: The enzyme digestion reaction procedure is: 55° C. for 1 h; after the reaction is completed, the mixture is stored at 4° C.

5. The method according to claim 1, wherein: Including, the genotype with the same band as the PCR-enzyme digestion product of the wild-type plant is the wild type; the genotype with different enzyme digestion bands from the wild type is one of homozygous mutations, heterozygous mutations, mosaics and biallelic mutations; the genotype with both the same band and different bands as the wild type is a heterozygote or mosaic; the genotype with enzyme digestion bands of different sizes from the wild type bands is a homozygous mutation or biallelic mutation.