Application of SHA1 protein in regulating nitrogen transport and absorption in rice

By introducing the SHA1 protein gene into rice, regulating nitrogen transport and absorption, the problem of low nitrogen utilization efficiency in rice is solved, and efficient nitrogen utilization and environmentally friendly rice breeding are achieved.

CN118440984BActive Publication Date: 2025-07-22CHINA AGRI UNIV SANYA RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410716485.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-04
Publication Date
2025-07-22
Estimated Expiration
2044-06-04

AI Technical Summary

Technical Problem

In the prior art, rice nitrogen utilization efficiency is low, resulting in waste of resources and environmental pollution, and lack of rice varieties that are efficient in nitrogen utilization.

Method used

The gene encoding SHA1 protein is introduced into rice, the expression and activity of SHA1 protein are increased, and the nitrogen transport and absorption process in rice is regulated through transgene or gene editing technology.

Benefits of technology

It significantly improves the nitrogen transport rate and absorption rate of genetically modified rice, reduces the nitrogen transport rate and absorption rate of gene-edited rice, promotes efficient nitrogen utilization, and reduces environmental pressure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118440984B_ABST
    Figure CN118440984B_ABST
Patent Text Reader

Abstract

The present invention provides an application of the SHA1 protein in regulating nitrogen transport and absorption in rice. Experimental verification of the present invention shows that by introducing the gene encoding the SHA1 protein into the target rice to obtain transgenic plants overexpressing the target gene, it is found that the transgenic plants have a higher inhibition rate under the influence of chlorate, and the transport rate and absorption rate of N<supgt;15< / supgt; in the transgenic plants are significantly increased. In addition, by using gene editing technology to knockout the target gene to obtain gene-edited plants, it is found that the gene-edited plants have a lower inhibition rate under the influence of chlorate, and the transport rate and absorption rate of N<supgt;15< / supgt; in the gene-edited plants are significantly decreased. The present invention has great application and popularization value for cultivating rice with high nitrogen use efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of SHA1 protein in regulating nitrogen transport and absorption in rice. Background Art

[0002] Rice is one of the important food crops in the world, and more than half of the world's population takes rice as the staple food. With the continuous increase in population, it is imperative to increase rice production. The use of nitrogen fertilizer is one of the effective measures to increase rice production. However, the large amount of nitrogen used not only reduces the nitrogen use efficiency, but also causes a series of environmental problems such as waste of resources and eutrophication of water bodies. Therefore, cultivating rice with high nitrogen use efficiency is of great significance for reducing the pressure on the environment caused by fertilization and increasing the yield per unit area of rice.

[0003] Cultivated rice is domesticated from common wild rice, and the genetic diversity of cultivated rice is significantly reduced compared with that of wild rice. There are a large number of beneficial genes in wild rice. With the completion of the rice genome sequencing, some genes beneficial to rice variety improvement, such as high yield, disease resistance, insect resistance, drought tolerance, and cold tolerance, have been mapped and cloned from wild rice. Wild rice can be used as an important germplasm resource for excavating excellent genes in breeding, enriching the source of rice genetic information, and providing gene support for cultivating new rice varieties with high nitrogen use efficiency.

[0004] Nitrogen is one of the macronutrients essential for plant growth and development. It is a component of amino acids in the body and also a constituent of proteins, with an average content accounting for about 1.5% of the total dry weight of plants. In order to obtain sufficient nitrogen sources, plants must absorb various forms of available nitrogen elements from the soil, including nitrate nitrogen, ammonium nitrogen, amino acids, soluble polypeptides, and complex insoluble nitrogen-containing compounds. The nitrogen elements absorbed by plant roots need to undergo a series of metabolic processes to be transformed into forms that can be directly utilized by the plant body. Nitrogen is an important factor limiting the normal growth of plants. Exploring beneficial genes with high nitrogen use efficiency from germplasm resources can not only provide a scientific basis for cultivating varieties with high nitrogen utilization rate, but also have great and profound significance for ensuring food and environmental safety. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide the application of SHA1 protein in regulating nitrogen transport and absorption in rice in view of the deficiencies of the above-mentioned prior art. Introducing the gene encoding SHA1 protein into the target rice can improve the nitrogen transport rate and nitrogen absorption rate of rice, and has great application and popularization value for cultivating transgenic rice with high nitrogen use efficiency.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is:

[0007] The applications of the SHA1 protein are at least one of (S1)-(S3):

[0008] (S1) Improving the nitrogen transport rate of rice;

[0009] (S2) Improving the nitrogen absorption rate of rice;

[0010] (S3) Cultivating transgenic rice with high nitrogen use efficiency;

[0011] The SHA1 protein is (a1) or (a2) or (a3) or (a4):

[0012] (a1) The protein shown in Sequence 1 in the sequence listing;

[0013] (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1;

[0014] (a3) A protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the protein shown in Sequence 1;

[0015] (a4) A protein derived from rice, having more than 98% identity with the protein shown in Sequence 1 and being related to the rice nitrogen utilization trait.

[0016] The present invention also provides the applications of the gene encoding the SHA1 protein, which are at least one of (S1)-(S3):

[0017] (S1) Improving the nitrogen transport rate of rice;

[0018] (S2) Improving the nitrogen absorption rate of rice;

[0019] (S3) Cultivating transgenic rice with high nitrogen use efficiency;

[0020] The gene encoding the SHA1 protein is (b1) or (b2) or (b3) or (b4):

[0021] (b1) A DNA molecule whose coding region is shown in Sequence 2 in the sequence listing;

[0022] (b2) The DNA molecule shown in Sequence 3 in the sequence listing;

[0023] (b3) A DNA molecule derived from rice, having more than 95% identity with (a1) or (a2) and encoding the said protein;

[0024] (b4) A DNA molecule that hybridizes with the nucleotide sequence defined by (a1) or (a2) under stringent conditions and encodes the said protein.

[0025] The present invention also provides a method for cultivating the transgenic rice, comprising the following steps: introducing the gene encoding the SHA1 protein into the target rice to increase the expression level and / or activity of the SHA1 protein, thereby obtaining the transgenic rice; compared with the target rice, the nitrogen transport rate and / or absorption rate of the transgenic rice is increased.

[0026] Due to the adoption of the above technical solutions, the present invention has remarkable technical effects:

[0027] 1. Through transgenic experiments, the present invention has confirmed that by introducing the gene encoding the SHA1 protein into the target rice to obtain transgenic plants overexpressing the target gene, and using the method of chlorate affecting the absorption or assimilation of nitrate, it is found that the transgenic plants have a higher inhibition rate; N 15 absorption experiments show that the N 15 transport rate and absorption rate of the transgenic plants are significantly increased. In addition, using gene editing technology, with 'agtgggtggagaactactgctgg' as the target, gene-edited plants are obtained, and using the method of chlorate affecting the absorption or assimilation of nitrate, it is found that the gene-edited plants have a lower inhibition rate; N 15 absorption experiments show that the N 15 transport rate and absorption rate of the gene-edited plants are significantly decreased.

[0028] 2. The present invention has great application and popularization value for cultivating rice with high nitrogen use efficiency.

[0029] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Phenotypes of Teqing, transgenic plants with empty vector and transgenic plants under 0 mmol / L and 1 mmol / L KCLO3 treatments in Example 1.

[0031] Figure 2 Statistical results of inhibition rates of Teqing, transgenic plants with empty vector and transgenic plants under KCLO3 treatment in Example 1.

[0032] Figure 3 N 15 transport efficiency statistical results of Teqing, transgenic plants with empty vector and transgenic plants in Example 1.

[0033] Figure 4 N 15 absorption rate statistical results of Teqing, transgenic plants with empty vector and transgenic plants in Example 1.

[0034] Figure 5Phenotypes of Zhonghua 11 and gene-edited plants under 0 mmol / L and 1 mmol / L KCLO3 treatments in Example 2.

[0035] Figure 6 Statistical results of the inhibition rates of Zhonghua 11 and gene-edited plants in Example 2 under KCLO3 treatment.

[0036] Figure 7 For Zhonghua 11 and gene-edited plants in Example 2, N 15 Transport efficiency statistical results.

[0037] Figure 8 For Zhonghua 11 and gene-edited plants in Example 2, N 15 Absorption rate statistical results. Detailed implementation methods

[0038] Example 1

[0039] Materials: Indica rice variety Teqing, abbreviated as rice Teqing; Common wild rice Yuanjiang, abbreviated as rice Yuanjiang. The gene encoding the SHA1 protein in rice Yuanjiang was extracted and introduced into rice Teqing to obtain transgenic plants, and the effect of the SHA1 protein on nitrogen transport and absorption in rice was verified.

[0040] The SHA1 protein in rice Yuanjiang is shown as Sequence 1 (390 aa) in the sequence listing. The open reading frame encoding the SHA1 protein in the cDNA of rice Yuanjiang is shown as Sequence 2 (1173 bp) in the sequence listing. The full-length gene encoding the SHA1 protein in the genomic DNA of rice Yuanjiang is shown as Sequence 3 (6569 bp) in the sequence listing (nucleotides at positions 3477 - 4310 and 5174 - 5512 are exons).

[0041] I. Construction of recombinant plasmid

[0042] The DNA molecule shown in Sequence 3 of the sequence listing was inserted between the EcoRⅠ and XbaI restriction enzyme cleavage sites of vector pCAMBIA1300 to obtain recombinant plasmid pCAMBIA1300 - SHA1.

[0043] II. Obtaining of SHA1 transgenic rice

[0044] 1. The recombinant plasmid pCAMBIA1300 - SHA1 was introduced into Agrobacterium tumefaciens LB4404 to obtain recombinant Agrobacterium.

[0045] 2. Co-culture the recombinant Agrobacterium with the callus of mature embryos of rice Teqing, and then conduct three rounds of resistance screening (the first round of resistance screening uses hygromycin at a concentration of 30 mg / L, the second round of resistance screening uses hygromycin at a concentration of 40 mg / L, and the third round of resistance screening uses hygromycin at a concentration of 40 mg / L), and then sequentially conduct pre-differentiation, differentiation, and rooting to obtain T0 generation regenerated plants.

[0046] 3. Take the leaves of the T0 generation regenerated plants, extract genomic DNA, and perform PCR amplification using the genomic DNA as a template. The primer pair composed of HYG-F and HYG-R is used for PCR amplification. The target sequences of HYG-F and HYG-R are located in the hygromycin resistance gene of the recombinant plasmid pCAMBIA1300-SHA1. If an amplification product of approximately 947 bp is obtained, the plant is a transgenic plant. If an amplification product of approximately 947 bp cannot be obtained, the plant is a non-transgenic plant.

[0047] The nucleotide sequences of primers HYG-F and HYG-R are as follows:

[0048] HYG-F: 5′-TACTTCTACACAGCCATC-3′

[0049] HYG-R: 5′-CGTCTGTCGAGAAGTTTC-3′;

[0050] 4. Cultivate the T0 generation transgenic plants, self-cross and harvest the seeds;

[0051] 5. Cultivate the seeds obtained in step 4 into plants, which are the T1 generation plants.

[0052] 6. Take the leaves of the T1 generation plants, extract genomic DNA, and perform PCR amplification using the genomic DNA as a template. The primer pair composed of HYG-F and HYG-R is used for PCR amplification of transgenic plants. If an amplification product of approximately 947 bp is obtained, the plant is a transgenic plant. If an amplification product of approximately 947 bp cannot be obtained, the plant is a non-transgenic plant.

[0053] III. Obtaining of plants transformed with empty vector

[0054] Use the vector pCAMBIA1300 to replace the recombinant plasmid pCAMBIA1300-SHA1 and operate according to step II.

[0055] IV. Identification

[0056] Test plants: T1 generation transgenic plants obtained in step II, T1 generation plants transformed with empty vector obtained in step III, and rice Teqing plants.

[0057] Test site: Beijing Shangzhuang Experimental Station.

[0058] In early June, the test plant seedlings were transplanted into paddy fields and managed normally.

[0059] After the plants set seeds and the grains matured, plump grains on the plants were harvested, and the seeds were dried in an oven at 50 °C for later use.

[0060] For the harvested rice seeds Teqing, transgenic plants with empty vector, and transgenic plants, 500 seeds were taken from each. The seeds were soaked in 20% NaClO for 30 minutes, then rinsed with deionized water more than 5 times until the disinfectant residue was completely removed; then the seeds were soaked in deionized water and placed in an oven at 37 °C for 2 days, with the deionized water changed daily; the germinated seeds were placed one by one in a 96-well PCR plate with the bottom cut off in advance, then placed in a seedling cultivation box filled with deionized water, and then placed in a light incubator with a temperature of 28 °C, 16-hour light cultivation / 8-hour dark cultivation, and the deionized water was changed daily; when the roots of the seedlings grew to about 3 cm, Kimura complete nutrient solution was applied, and when the seedlings grew for 1 week and 2 weeks, the next experiment was carried out.

[0061] Using the method of chlorate affecting the absorption or assimilation of nitrate, the seedlings grown for 1 week were cultured in normal nutrient solution (0 mmol / L KCLO3) and nutrient solution supplemented with 1 mmol / L KCLO3 for another week. The lengths of the treated seedlings were measured to calculate the relative inhibition rate (relative inhibition rate = (average seedling length of seedlings in normal nutrient solution - seedling length treated with 1 mmol / L KCLO3) / average seedling length of seedlings in normal nutrient solution). The phenotypes of the treated seedlings are shown in Figure 1 , where the left pictures in the three groups of pictures of Teqing, transgenic plants with empty vector, and transgenic plants are normal nutrient solution (0 mmol / L KCLO3), and the right pictures are nutrient solution supplemented with 1 mmol / L KCLO3. It can be seen that the growth of rice seedlings of Teqing, transgenic plants with empty vector, and transgenic plants cultured with nutrient solution supplemented with KCLO3 was significantly inhibited. The calculation results of the inhibition rate are shown in Figure 2 (3 replicates for each treatment, 20 rice seedlings for each replicate), as can be seen from the figure, the inhibition rates of Teqing and transgenic plants with empty vector were about 37%, while the inhibition rate of transgenic plants was about 49%, and the inhibition rate of transgenic plants increased extremely significantly.

[0062] For the seedlings grown for 2 weeks, an experiment on N 15 absorption rate was carried out. The seedlings were placed in the nutrient solution for 2 hours, then the roots of the seedlings were rinsed clean with deionized water, and then the seedlings were transferred to a solution containing N 15- In the nutrient solution containing -KNO3 for 3 hours. After 3 hours, soak the roots of rice seedlings in 0.1 mmol / L CaSO4 for 2 minutes to remove nitrate ions on the root surface, separate the roots and shoots, dry them in an oven at 70 °C, and then grind them into powder for subsequent detection. The nitrogen transport rate is calculated according to the following formula: The transport rate from roots to shoots = the proportion of N content in shoots / the proportion of N content in roots. 15 The proportion of content / the proportion of N 15 content in roots. It can be seen from Figure 3 that the nitrogen transport rate of transgenic plants is extremely significantly higher than that of Teqing and transgenic plants with empty vectors. The nitrogen absorption rate is calculated according to the following formula: The absorption rate of N 15 = (the proportion of N content in shoots 15 + the proportion of N content in roots 15 content) / (dry weight of roots × 3 hours). It can be seen from Figure 4 that the nitrogen absorption rate of transgenic plants is extremely significantly higher than that of Teqing and transgenic plants with empty vectors.

[0063] The results show that: compared with rice Teqing and transgenic plants with empty vectors, transgenic plants have a higher inhibition rate in the potassium chlorate experiment and higher nitrogen transport and absorption rates in the N 15 absorption experiment.

[0064] Example 2

[0065] Materials: The japonica rice variety is Zhonghua 11, abbreviated as rice Zhonghua 11. The common wild rice Yuanjiang, abbreviated as rice Yuanjiang. Introduce the gene knockout vector into rice Zhonghua 11 to obtain gene-edited plants and verify the nitrogen transport and absorption effects of rice after knocking out the SHA1 protein gene.

[0066] The SHA1 protein in rice Yuanjiang is shown as Sequence 1 (390 aa) in the sequence list, the open reading frame encoding the SHA1 protein in the cDNA of rice Yuanjiang is shown as Sequence 2 (1173 bp) in the sequence list, and the full-length gene encoding the SHA1 protein in the genomic DNA of rice Yuanjiang is shown as Sequence 3 (6569 bp) in the sequence list (nucleotides at positions 3477 - 4310 and 5174 - 5512 are exons).

[0067] I. Construction of the gene knockout vector

[0068] Select the target on the CDS sequence 2 of the SHA1 gene. In the present invention, the snoRNA promoter used is the rice U3 promoter, and its transcription start site is A (U6 is G). Generally, the target site selected for CRISPR / Cas9 is 23 bp in length. Therefore, the target site needs to satisfy AN20GG. Considering the RNA secondary structure of the 20 bp spacer plus its gRNA backbone, the present invention selects the following 1 target site, and the target sequence: 'agtgggtggagaactactgctgg', specifically the 338th - 361st positions of sequence 2. Subsequently, primers are designed, and the restriction enzyme site Bsa I is added to the front end of the primers. The sgRNA backbone + OsU3 promoter is used as the template for amplification. The amplified product is digested with Bsa I and recovered. After mixing the recovered fragments, they are ligated with the large fragment of the Bsa I-digested vector pBWA(V)H-cas9i2 backbone using T4 ligase to obtain the CRISPR-Cas9 gene knockout vector, which is named CRISPR-Cas9-SHA1 after correct sequencing.

[0069] II. Obtaining of SHA1 transgenic rice

[0070] 1. Introduce the gene knockout vector CRISPR-Cas9-SHA1 into Agrobacterium tumefaciens LB4404 to obtain recombinant Agrobacterium.

[0071] 2. Co-culture the recombinant Agrobacterium with the mature embryo callus of rice Zhonghua 11, and then conduct three rounds of resistance screening (the first round of resistance screening uses hygromycin at a concentration of 40 mg / L, the second round of resistance screening uses hygromycin at a concentration of 50 mg / L, and the third round of resistance screening uses hygromycin at a concentration of 50 mg / L), and then conduct pre-differentiation, differentiation, and rooting in sequence to obtain T0 generation regenerated plants.

[0072] 3. Take the leaves of the T0 generation regenerated plants, extract genomic DNA, and use the genomic DNA as a template for PCR amplification. The primer pair composed of Cas9-F and Cas9-R is used for PCR amplification. The target sequences of Cas9-F and Cas9-R are located in the rice genome. If an amplification product of approximately 374 bp is obtained, sequence this sequence. If the measured sequence is different from that of the parental Zhonghua 11, this plant is a gene-edited plant; if it is the same as the parental Zhonghua 11, it is a non-edited plant.

[0073] The nucleotide sequences of primers Cas9-F and Cas9-R are as follows:

[0074] Cas9-F: 5′-AGACGCTCATCCTCATCACC-3′

[0075] Cas9-R: 5′-CCGCTCCATCGTCCAGTAC-3′.

[0076] 4. Cultivate T0 generation transgenic plants, self-cross them and harvest seeds;

[0077] 5. Cultivate the seeds obtained in step 4 into plants, which are the T1 generation plants.

[0078] 6. Take the leaves of T1 generation plants, extract genomic DNA, and perform PCR amplification using the genomic DNA as a template. For gene-edited plants, the primer pair composed of Cas9-F and Cas9-R is used for PCR amplification. The target sequences of Cas9-F and Cas9-R are located in the rice genome. If an amplification product of about 374 bp is obtained, sequence this sequence. If the measured sequence is different from that of the parental Zhonghua 11, this plant is a gene-edited plant; if it is the same as that of the parental Zhonghua 11, it is a non-edited plant.

[0079] III. Identification

[0080] Test plants: Gene-edited plants obtained in step 2, and Zhonghua 11 rice plants.

[0081] Test site: Shangzhuang Experimental Station in Beijing.

[0082] In early June, transplant the seedlings of the test plants into paddy fields and conduct normal management.

[0083] After the plants bear fruit and the grains are mature, collect the plump grains on the plants and dry the seeds in an oven at 50 °C for later use.

[0084] For the collected Zhonghua 11 rice seeds and gene-edited plants, take 500 seeds each. Soak the seeds in 20% NaClO for 30 minutes, then rinse them with deionized water more than 5 times until the disinfectant residue is completely removed; then soak the seeds in deionized water in a 37 °C oven for 2 days, changing the deionized water every day; place the germinated seeds one by one in a 96-well PCR plate with the bottom cut off in advance, then place it in a seedling-raising box filled with deionized water, and then place it in a light incubator at 28 °C with a 16-hour light culture / 8-hour dark culture, changing the deionized water every day; when the roots of the seedlings grow to about 3 cm, apply Kimura complete nutrient solution, and when the seedlings grow for 1 week and 2 weeks, conduct the next experiment.

[0085] Using the method of chlorate affecting the absorption or assimilation of nitrate, cultivate the seedlings grown for 1 week in normal nutrient solution and nutrient solution added with 1 mmol / L KCLO3 for another week. Measure the seedling length of the treated seedlings to calculate the relative inhibition rate. The phenotypes of the treated seedlings are shown in Figure 5, where the left pictures in the two groups of pictures of Zhonghua 11 and gene-edited plants are normal nutrient solution (0 mmol / L KCLO3), and the right pictures are nutrient solutions added with 1 mmol / L KCLO3. It can be seen that the growth of rice seedlings of Zhonghua 11 and gene-edited plants cultured with nutrient solutions added with KCLO3 is significantly inhibited. The calculation results of the inhibition rate are shown in Figure 6 (3 replicates for each treatment, 20 rice seedlings for each replicate). As can be seen from the figure, the inhibition rate of Zhonghua 11 is about 48%, while the inhibition rate of gene-edited plants is about 28%, and the inhibition rate of gene-edited plants decreases significantly.

[0086] The seedlings grown for 2 weeks were subjected to the experiment of N 15 absorption rate. The seedlings were placed in the nutrient solution for 2 hours, and then the roots of the seedlings were rinsed clean with deionized water. After that, the seedlings were transferred to the nutrient solution containing N 15 -KNO3 for 3 hours. After 3 hours, the roots of the rice seedlings were soaked in 0.1 mmol / L CaSO4 for 2 minutes to remove the nitrate ions on the root surface. The roots and shoots were separated, dried in an oven at 70 °C, and then ground into powder for subsequent detection. From Figure 7 it can be known that the nitrogen transport rate of gene-edited plants is extremely significantly lower than that of Zhonghua 11. From Figure 8 it can be known that the nitrogen absorption rate of gene-edited plants is extremely significantly lower than that of Zhonghua 11.

[0087] The results show that: compared with Zhonghua 11 of rice, gene-edited plants have a lower inhibition rate in the potassium chlorate experiment and lower nitrogen transport rate and absorption rate in the N 15 absorption experiment.

[0088] The above is only a preferred embodiment of the present invention and does not impose any limitation on the present invention. Any simple modification, change, and equivalent change made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. Application of the SHA1 protein, characterized in that, is at least one of (S1)-(S3): (S1) enhancing the nitrogen transport rate of rice; (S2) enhancing the nitrogen absorption rate of rice; (S3) cultivating transgenic rice with high nitrogen use efficiency; The SHA1 protein is (a1) or (a2): (a1) the protein shown in Sequence 1 in the sequence listing; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1.

2. Use of the gene encoding the SHA1 protein, characterized in that, is at least one of (S1)-(S3): (S1) enhancing the nitrogen transport rate of rice; (S2) enhancing the nitrogen absorption rate of rice; (S3) cultivating transgenic rice with high nitrogen use efficiency; The gene encoding the SHA1 protein is a DNA molecule whose coding region is shown in Sequence 2 in the sequence listing.

3. A method for cultivating transgenic rice, characterized in that, comprises the following steps: introducing the gene encoding the SHA1 protein into the target rice to increase the expression level and / or activity of the SHA1 protein, obtaining transgenic rice; compared with the target rice, the nitrogen transport rate and / or absorption rate of the transgenic rice is increased; The gene encoding the SHA1 protein is a DNA molecule whose coding region is shown in Sequence 2 in the sequence listing.

Citation Information

Patent Citations

  • Application of SHA1 protein in enhancing rice root system

    CN118546987A