Molecular markers and applications of heat shock protein 70 in Litopenaeus vannamei related to cold resistance traits

Abstract

This invention discloses a molecular marker for heat shock protein 70 in Litopenaeus vannamei, which is associated with cold tolerance. The markers include molecular markers A-F located on the heat shock cognate 70 gene sequence (Sequence 1) and molecular markers G-W located on the hsp70-binding protein 1 gene sequence (Sequence 3). These molecular markers are significantly correlated with cold tolerance in Litopenaeus vannamei and can serve as functional markers for cold tolerance, improving the efficiency of cold-tolerant breeding and allowing for the selection of cold-resistant individuals for subsequent genetic breeding. The heat shock protein 70 molecular markers for cold tolerance in Litopenaeus vannamei are amplified and sequenced using genomic DNA from Litopenaeus vannamei muscle tissue as a template. The genotypes of molecular markers A-W are then identified to screen for individuals with dominant genotypes.

Description

Technical Field

[0001] This invention belongs to the field of Litopenaeus vannamei breeding technology, specifically relating to a molecular marker of heat shock protein 70 in Litopenaeus vannamei related to cold resistance and its application. Background Technology

[0002] South American white shrimp ( Litopenaeus vannamei The Pacific white shrimp (Litopenaeus vannamei), scientifically known as Litopenaeus vannamei, is characterized by its large size, rapid growth, and high yield. After its introduction to my country, it was quickly bred entirely artificially and its cultivation was rapidly promoted nationwide, making it the highest-yielding shrimp species in China. Under artificial cultivation conditions, the Pacific white shrimp adapts to water temperatures of 16–38℃. Below 15℃, it essentially stops feeding, and below 10℃, it exhibits lateral lying and mortality. In northern my country, the suitable cultivation period for Pacific white shrimp is relatively short each year. Furthermore, in the south, some shrimp farmers raise shrimp in winter to pursue higher prices during the Spring Festival, but they face the risk of large-scale shrimp mortality due to sudden drops in water temperature caused by cold waves. Therefore, the breeding of cold-resistant varieties has become an urgent need for the Pacific white shrimp farming industry in both northern and southern my country.

[0003] Heat-shock proteins (HSPs), also known as heat shock proteins, are a type of protein first discovered in fruit flies (Drosophila melanogaster). Drosophila melanogaste Heat shock proteins are stress-resistance proteins found in Litopenaeus vannamei. Based on molecular weight and amino acid sequence similarity, heat shock proteins can be broadly classified into five classes: HSP110, HSP90, HSP70, HSP60, and small heat shock proteins (sHsps). Studies have shown that the expression of heat shock proteins is closely related to an organism's cold or heat resistance. Therefore, heat shock proteins are highly likely to become biomarkers for studying the cold resistance of Litopenaeus vannamei.

[0004] Traditional breeding methods are inefficient and time-consuming. The development of modern biotechnology and genetics has made molecular marker technology, based on trait-related functional genes, a crucial technique in aquatic genetic breeding. Single nucleotide polymorphisms (SNPs), with their advantages of large numbers, wide distribution, strong representativeness, good genetic stability, and ease of high-throughput and highly automated detection and analysis, have been widely used in the construction of animal and plant genetic maps, QTL mapping, and functional gene analysis. However, there are few reports on the application of SNPs in the breeding of cold-resistant varieties of Litopenaeus vannamei. Summary of the Invention

[0005] To address the aforementioned shortcomings, this invention discloses a molecular marker for heat shock protein 70 in Litopenaeus vannamei, which is associated with cold resistance. Based on screening two protein structures of heat shock protein 70 (structural Hsc70 and inducible Hsp70), a molecular marker associated with cold resistance is obtained. This molecular marker is then used as a functional marker for the cold resistance of Litopenaeus vannamei and is used to breed new Litopenaeus vannamei varieties with cold resistance.

[0006] This invention is achieved using the following technical solution:

[0007] A molecular marker for heat shock protein 70 in Litopenaeus vannamei related to cold resistance, comprising molecular markers A to W;

[0008] The molecular marker A is located at the 1454 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1454 T>C. The base at this site is C or T, and the mutation type is C / T heterozygous or T / T homozygous.

[0009] The molecular marker B is located at the 1472 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.1472 G>A. The base at this site is either A or G, and the mutation type is A / G heterozygous or G / G homozygous.

[0010] The molecular marker C is located at the 1601 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.1601 C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0011] The molecular marker D is located at the 1724 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.1724 C>A. The base at this site is A or C, and the mutation type is A / C heterozygous or C / C homozygous.

[0012] The molecular marker E is located at the 1778 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.1778 C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0013] The molecular marker F is located at the 1782 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.1782 C>T. The base at this site is C or T, and the mutation type is C / C homozygous or C / T heterozygous.

[0014] The molecular marker G is located at the 1166 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1166 C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0015] The molecular marker H is located at the 1189 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1189 T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0016] The molecular marker I is located at the 1201 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1201 T>C. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0017] The molecular marker J is located at the 1211 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1211 C>A. The base at this site is A or C, and the mutation type is A / C heterozygous or C / C homozygous.

[0018] The molecular marker K is located at the 1243 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1243 G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous.

[0019] The molecular marker L is located at the 1262 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1262 C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0020] The molecular marker M is located at the 1289 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1289 G>A. The base at this site is either A or G, and the mutation type is A / G heterozygous or G / G homozygous.

[0021] The molecular marker N is located at the 1303 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1303 T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0022] The molecular marker O is located at the 1310 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1310 C>A. The base at this site is A or C, and the mutation type is A / A homozygous, A / C heterozygous, or C / C homozygous.

[0023] The molecular marker P is located at the 1544 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1544 G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous.

[0024] The molecular marker Q is located at the 1564 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1564 A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0025] The molecular marker R is located at the 1595 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1595 G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous.

[0026] The molecular marker S is located at the 1604 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1604 A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0027] The molecular marker T is located at the 1653 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1653 T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0028] The molecular marker U is located at the 1687 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1687 T>C. The base at this site is C or T, and the mutation type is C / T heterozygous or T / T homozygous.

[0029] The molecular marker V is located at the 1695 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1695 A>T. The base at this site is A or T, and the mutation type is A / A homozygous or A / T heterozygous.

[0030] The molecular marker W is located at the 1730 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1730 T>C. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous.

[0031] Sequence 1 in the sequence listing is the mRNA sequence of the heat shock cognate 70 gene.

[0032] The nucleotide sequence described in sequence 2 of the sequence listing is the nucleotide sequence of the gene hsp70-binding protein 1.

[0033] The application of the heat shock protein 70 molecular markers of Litopenaeus vannamei related to the cold resistance trait involves using the molecular markers A to W for the selective breeding of Litopenaeus vannamei with the cold resistance trait. Specifically, genomic DNA is first extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then the obtained genomic DNA is used as a template for PCR amplification. The amplified products are purified and sequenced to determine the genotypes of the molecular markers A to W.

[0034] When the genotype of molecular marker A is the dominant TT genotype, that individual should be selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker B is the dominant AG genotype, that individual should be selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker C is the inferior TT or CT genotype, that individual should be avoided as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker D is the inferior AC genotype, that individual should be avoided as a backup parent for breeding Litopenaeus vannamei.When the genotype of molecular marker E is the inferior genotype CT or TT, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker F is the inferior genotype CC, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker G is the dominant genotype CT or TT, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker H is the inferior genotype AA or AT, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker I is the inferior CC or CT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker J is the inferior AA or AC genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker K is the dominant AA or AG genotype, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker L is the dominant CT or TT genotype, select this individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker M is the inferior AA or AG genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker N is the inferior AA or AT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker O is the inferior AA or AC genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker P... When the genotype of molecular marker Q is the inferior AA or AG genotype, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker Q is the inferior AT or TT genotype, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker R is the dominant AA or AG genotype, select that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker S is the inferior AT or TT genotype, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker T is the dominant AA genotype, select that individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker U is the inferior CC or CT genotype, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker V is the dominant AT genotype, select that individual as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker W is the inferior CC or CT genotype, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei.

[0035] This invention involves extracting DNA from the appendage muscle tissue of Litopenaeus vannamei, which does not significantly affect the shrimp's body. Breeding can be carried out using molecular-assisted breeding methods, such as obtaining varieties by treating molecular markers using gene knockout or gene editing methods.

[0036] During the PCR amplification process, the primer set used to detect molecular markers A to F associated with the heat shock cognate 70 gene and cold resistance trait in Litopenaeus vannamei includes primer FA and primer RA. The sequence of primer FA is ACTGTTGCTGTTGGACGTG (Sequence 3 in the sequence listing), and the sequence of primer RA is TTCTGCTTGTGCTCATACTC (Sequence 4 in the sequence listing).

[0037] The amplification system for detecting molecular markers A–F associated with the heat shock cognate 70 gene and cold tolerance in Litopenaeus vannamei consisted of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FA at a concentration of 10 μmol / L, 2 μL of primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O. The amplification reaction procedure included the following steps:

[0038] S11. Pre-denaturate at 94℃ for 3 min;

[0039] S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s.

[0040] S13, extend at 72℃ for 10 minutes.

[0041] During the PCR amplification process, the primer set used to detect the molecular markers G-W associated with the cold resistance trait of the hsp70-binding protein 1 gene in Litopenaeus vannamei includes primer FB and primer RB. The sequence of primer FB is CGCCGAGCCTTTCTGGAGGAA (Sequence 5 in the sequence listing), and the sequence of primer RB is CAATATACGACTCATTGTTTCTG (Sequence 6 in the sequence listing).

[0042] The amplification system for detecting molecular markers G-W associated with the hsp70-binding protein 1 gene and cold resistance trait in Litopenaeus vannamei consisted of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FB at a concentration of 10 μmol / L, 2 μL of primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0043] Meanwhile, the amplification reaction procedure includes the following steps:

[0044] S21. Pre-denaturate at 94℃ for 3 min;

[0045] S22. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 58℃ for 30s, and extension at 72℃ for 45s.

[0046] S23, extend at 72℃ for 10 minutes.

[0047] Compared with existing technologies, this technical solution has the following advantages:

[0048] This invention, based on the analysis and screening of the heat shock cognate 70 gene and hsp70-binding protein 1 gene in Litopenaeus vannamei, provides SNP molecular markers closely related to the cold-resistance trait of Litopenaeus vannamei. These markers are significantly correlated with cold-resistance and can serve as functional markers for cold-resistance ability, improving the efficiency of cold-resistance breeding and enabling the screening of shrimp individuals with cold-resistance characteristics for subsequent genetic breeding. The heat shock protein 70 molecular marker related to the cold-resistance trait in Litopenaeus vannamei is amplified and sequenced using genomic DNA from Litopenaeus vannamei muscle tissue as a template. The genotypes of the molecular markers A to W are identified, thereby screening for individuals with dominant genotypes. The results are accurate, have strong application value, and can efficiently breed Litopenaeus vannamei varieties with strong cold resistance and stress tolerance. Attached Figure Description

[0049] Figure 1These are partial sequences of the product obtained from amplifying the heat shock cognate 70 gene in Example 1. 'a' represents positions 124-130, showing the CT and TT peaks at the D.1454 T>C site; 'b' represents positions 142-148, showing the AG and GG peaks at the D.1472 G>A site; 'c' represents positions 271-277, showing the CC, CT, and TT peaks at the D.1601 C>T site; 'd' represents positions 394-400, showing the AC and CC peaks at the D.1724 C>A site; 'e' represents positions 448-454, showing the CC, CT, and TT peaks at the D.1778 C>T site; and 'f' represents positions 452-458, showing the CC and CT peaks at the D.1782 C>T site.

[0050] Figure 2 These are partial sequences of the product obtained from amplifying the hsp70-binding protein 1 gene in Example 2. a represents positions 163-169, showing the CC, CT, and TT peaks at the D.1166 C>T site; b represents positions 186-192, showing the AA, AT, and TT peaks at the D.1189 T>A site; c represents positions 198-204, showing the CC, CT, and TT peaks at the D.1201 T>C site; d represents positions 208-214, showing the AC and CC peaks at the D.1211 C>A site; e represents positions 240-246, showing the AA, AG, and GG peaks at the D.1243 G>A site; and f represents positions 259-265, showing the CC, CT, and TT peaks at the D.1262 C>T site.

[0051] Figure 3 This is a partial sequence of the product obtained from amplifying the hsp70-binding protein 1 gene in Example 2. g represents positions 286-292, showing the AG and GG peaks at the D.1289 G>A site; h represents positions 300-306, showing the AA, AT, and TT peaks at the D.1303 T>A site; i represents positions 307-313, showing the AA, AC, and CC peaks at the D.1310 C>A site; j represents positions 541-547, showing the AA, AG, and GG peaks at the D.1544 G>A site; k represents positions 561-567, showing the AA, AT, and TT peaks at the D.1564 A>T site; and l represents positions 592-598, showing the AA, AG, and GG peaks at the D.1595 G>A site.

[0052] Figure 4 This is a partial sequence of the product obtained from amplifying the hsp70-binding protein 1 gene in Example 2. m represents positions 601-607, showing the peak values ​​of AA, AT, and TT at the D.1604 A>T site; n represents positions 650-656, showing the peak values ​​of AA, AT, and TT at the D.1653 T>A site; o represents positions 684-691, showing the peak values ​​of CT and TT at the D.1687 T>C site; p represents positions 692-698, showing the peak values ​​of AA and AT at the D.1695 A>T site; and q represents positions 727-733, showing the peak values ​​of CC, CT, and TT at the D.1730 T>C site. Detailed Implementation

[0053] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0054] Example 1: The screening process for molecular markers A to F related to the heat shock cognate 70 gene of Litopenaeus vannamei and cold resistance traits described in this invention is as follows:

[0055] (1) 120 white shrimp weighing about 3 grams were selected and temporarily kept for 2 days. Then, a cold resistance experiment was conducted under the stress conditions of 9.5-10.5℃. The first 40 shrimp that died were designated as the low temperature sensitive group, and the last 40 shrimp that survived were designated as the low temperature tolerant group.

[0056] (2) Five white shrimp were randomly selected from the low temperature sensitive group and the low temperature tolerant group, muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-chloroform method, and the obtained genomic DNA was stored at -20 °C for later use.

[0057] (3) Primers FA and RA were designed based on the mRNA sequence of the heat shock cognate 70 gene of Litopenaeus vannamei. Then, SNP sites located in the heat shock cognate 70 gene were amplified and screened.

[0058] The sequence of primer FA is: ACTGTTGCTGTTGGACGTG;

[0059] The sequence of primer RA is: TTCTGCTTGTGCTCATACTC.

[0060] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FA at a concentration of 10 μmol / L, 2 μL of primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0061] The PCR amplification reaction procedure includes the following steps:

[0062] S11. Pre-denaturate at 94℃ for 3 min;

[0063] S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s.

[0064] S13, Extend at 72℃ for 10 min;

[0065] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis, to screen for relevant SNP sites. The PCR amplification product sequence of one sample is shown below:

[0066] ;

[0067] The 127th position is D.1454 T>C, the 145th position is D.1472 G>A, the 274th position is D.1601 C>T, the 397th position is D.1724 C>A, the 451st position is D.1778 C>T, and the 455th position is D.1782 C>T.

[0068] (5) Based on the selected SNP sites, the Litopenaeus vannamei in the sensitive group and the tolerant group were detected and genotyped according to the above method. The samples of different SNP sites in the sensitive group and the tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Table 1.

[0069] Analysis based on Table 1 shows that genotypic polymorphism at each molecular marker locus has a significant impact on the cold tolerance trait of Litopenaeus vannamei: Individuals with the TT genotype of molecular marker A exhibit better cold tolerance than those with the CT genotype, with the preferred selection locus D.1454 T>C indicating TT genotype individuals; individuals with the AG genotype of molecular marker B exhibit better cold tolerance than those with the GG genotype, with the preferred selection locus D.1472 G>A indicating AG genotype individuals; individuals with the CT and TT genotypes of molecular marker C exhibit worse cold tolerance than those with the CC genotype, with the preferred selection locus D.1601 C>T indicating CT and TT genotype individuals; individuals with the AC genotype of molecular marker D exhibit better cold tolerance than those with the CC genotype, with the preferred selection locus D.1724 C>A indicating AC genotype individuals; individuals with the CT and TT genotypes of molecular marker E exhibit worse cold tolerance than those with the CC genotype, with the preferred selection locus D.1778 C>T indicating CT and TT genotype individuals; individuals with the CC genotype of molecular marker F exhibit better cold tolerance than those with the CT genotype, with the preferred selection locus D.1782 C>T indicating CC genotype individuals.

[0070] Table 1 shows the results of the chi-square analysis of the sites.

[0071]

[0072] Example 2: The screening process for molecular markers G-W related to the cold resistance trait of the Litopenaeus vannamei hsp70-binding protein 1 gene described in this invention is as follows:

[0073] (1) 120 white shrimp weighing about 3 grams were selected and temporarily kept for 2 days. Then, a cold resistance experiment was conducted under the stress conditions of 9.5-10.5℃. The first 40 shrimp that died were designated as the low temperature sensitive group, and the last 40 shrimp that survived were designated as the low temperature tolerant group.

[0074] (2) Five white shrimp were randomly selected from the low temperature sensitive group and the low temperature tolerant group, muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-chloroform method, and the obtained genomic DNA was stored at -20 °C for later use.

[0075] (3) Primers FB and RB were designed based on the nucleotide sequence of the hsp70-binding protein 1 gene of Litopenaeus vannamei. Then, SNP sites located in the hsp70-binding protein 1 gene were amplified and screened.

[0076] The sequence of the primer FB is: CGCCGAGCCTTTCTGGAGGAA;

[0077] The sequence of primer RB is: CAATATACGACTCATTGTTTCTG;

[0078] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FB at a concentration of 10 μmol / L, 2 μL of primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0079] The PCR amplification reaction procedure includes the following steps:

[0080] S1. Pre-denaturate at 94℃ for 3 min;

[0081] S2. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 58℃ for 30s, and extension at 72℃ for 45s.

[0082] S3, extend at 72℃ for 10 minutes;

[0083] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis, to screen for relevant SNP sites. The PCR amplification product sequence of one sample is shown below:

[0084] ;

[0085] The 166th position is D.1166 C>T, the 189th position is D.1189 T>A, the 201st position is D.1201 T>C, the 211th position is D.1211 C>A, the 243rd position is D.1243 G>A, the 262nd position is D.1262 C>T, the 289th position is D.1289 G>A, the 303rd position is D.1303 T>A, the 310th position is D.1310 C>A, the 544th position is D.1544 G>A, the 564th position is D.1564 A>T, the 595th position is D.1595 G>A, the 604th position is D.1604 A>T, the 653rd position is D.1653 T>A, and the 687th position is D.1687. T>C, the 695th bit is D.1695 A>T, the 730th bit is D.1730 T>C;

[0086] (5) Based on the selected SNPs, the Litopenaeus vannamei in the sensitive group and the tolerant group were detected and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Tables 2 to 4.

[0087] Analysis based on Table 2 shows that genotypic polymorphism at each molecular marker locus has a significant impact on the cold resistance trait of Litopenaeus vannamei:

[0088] Individuals with the dominant cold-resistance trait of molecular marker G have the CT and TT genotypes. These individuals were selected as reserve parents for breeding of Litopenaeus vannamei varieties.

[0089] Individuals with the cold-resistance trait of molecular marker H have the AA and AT genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0090] Individuals with inferior cold resistance traits due to molecular marker I have the CC and CT genotypes. These individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0091] Individuals with the cold-resistance trait of molecular marker J have the AA and AC genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0092] Individuals with the dominant cold-resistance trait of molecular marker K have the AA and AG genotypes. These individuals were selected as reserve parents for breeding of Litopenaeus vannamei varieties.

[0093] Individuals with the dominant cold-resistance trait of molecular marker L have the CT and TT genotypes. These individuals were selected as reserve parents for breeding of Litopenaeus vannamei varieties.

[0094] Individuals with the cold-resistance trait of molecular marker M have the AA and AG genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0095] Individuals with the cold-resistance trait of molecular marker N have the AA and AT genotypes, and these individuals should be avoided as backup parents for breeding of Litopenaeus vannamei varieties.

[0096] Individuals with the cold-resistance trait of molecular marker O have the AA and AC genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0097] Individuals with the cold-resistance trait of molecular marker P have the AA and AG genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0098] Individuals with the cold-resistance trait of molecular marker Q have the AT or TT genotypes, and these individuals should be avoided as backup parents for breeding of Litopenaeus vannamei varieties.

[0099] Individuals with the dominant cold-resistance trait of molecular marker R have the AA and AG genotypes. These individuals were selected as reserve parents for breeding of Litopenaeus vannamei varieties.

[0100] Individuals with the cold-resistance trait of molecular marker S have the AT or TT genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0101] The individual with the dominant cold-resistance trait of molecular marker T has the AA genotype. This individual was selected as a backup parent for breeding of Litopenaeus vannamei varieties.

[0102] Individuals with the cold-resistance trait of molecular marker U have the CC and CT genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0103] The individual with the dominant cold-resistance trait of molecular marker V is the AT genotype. This individual was selected as a backup parent for breeding of Litopenaeus vannamei varieties.

[0104] Individuals with the cold-resistance trait of molecular marker W have the CC and CT genotypes, and these individuals should be avoided as backup parents for breeding Litopenaeus vannamei varieties.

[0105] Table 2. Chi-square analysis results for some sites

[0106]

[0107] Table 3. Chi-square analysis results for some sites

[0108]

[0109] Table 4. Chi-square analysis results for some sites

[0110]

[0111] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. The application of a molecular marker for heat shock protein 70 in Litopenaeus vannamei, which is associated with cold resistance traits, characterized in that: The heat shock protein 70 molecular markers of Litopenaeus vannamei include molecular markers A, B, D, E, F, G, H, I, K, L, N, O, P, Q, R, S, T, V, and W. The molecular marker A is located at the 1454 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1454T>C. The base at this site is C or T, and the mutation type is C / T heterozygous or T / T homozygous. The molecular marker B is located at the 1472 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1472G>A. The base at this site is either A or G, and the mutation type is A / G heterozygous or G / G homozygous. The molecular marker D is located at the 1724 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1724C>A, where the base is A or C, and the mutation type is A / C heterozygous or C / C homozygous. The molecular marker E is located at the 1778 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1778C>T, where the base is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The molecular marker F is located at the 1782 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 1782C>T. The base at this site is C or T, and the mutation type is C / C homozygous or C / T heterozygous. The molecular marker G is located at the 1166 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1166C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The molecular marker H is located at the 1189 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1189T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker I is located at the 1201 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1201T>C. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The molecular marker K is located at the 1243 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1243G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous. The molecular marker L is located at the 1262 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1262C>T. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The molecular marker N is located at the 1303 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1303T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker O is located at the 1310 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1310C>A. The base at this site is A or C, and the mutation type is A / A homozygous, A / C heterozygous, or C / C homozygous. The molecular marker P is located at the 1544 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1544G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous. The molecular marker Q is located at the 1564 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1564A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker R is located at the 1595 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1595G>A. The base at this site is A or G, and the mutation type is A / A homozygous, A / G heterozygous, or G / G homozygous. The molecular marker S is located at the 1604 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.1604A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker T is located at the 1653 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1653T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker V is located at the 1695 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1695A>T. The base at this site is A or T, and the mutation type is A / A homozygous or A / T heterozygous. The molecular marker W is located at the 1730 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.1730T>C. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The application involves using the heat shock protein 70 molecular marker of Litopenaeus vannamei, which is associated with the cold-resistance trait, for the selective breeding of Litopenaeus vannamei with the cold-resistance trait. Specifically, genomic DNA is first extracted from the muscle tissue of the Litopenaeus vannamei to be tested. Then, the obtained genomic DNA is used as a template for PCR amplification. The amplified product is purified and sequenced to determine the genotype of the heat shock protein 70 molecular marker of Litopenaeus vannamei associated with the cold-resistance trait. When the genotype of molecular marker A is the dominant TT genotype, that individual should be selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker B is the dominant AG genotype, that individual should be selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker D is the inferior AC genotype, that individual should be avoided as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker E is the inferior CT or TT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker F is the inferior CC genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker G is the dominant CT or TT genotype, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker H is the inferior AA or AT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker E is the inferior AA or AT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker E is the inferior CT or TT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker H is the inferior AA or AT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker E is the inferior CT or TT .... When marker I has a genotype of the inferior CC or CT, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei. When marker K has a genotype of the dominant AA or AG, select that individual as a backup parent for breeding Litopenaeus vannamei. When marker L has a genotype of the dominant CT or TT, select that individual as a backup parent for breeding Litopenaeus vannamei. When marker N has a genotype of the inferior AA or AT, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei. When marker O has a genotype of the inferior AA or AC, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei. When marker P... When the genotype of molecular marker Q is the inferior AA or AG genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker Q is the inferior AT or TT genotype, avoid selecting this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker R is the dominant AA or AG genotype, select this individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker S is the inferior AT or TT genotype... When the molecular marker T has the dominant genotype AA, select that individual as a backup parent for breeding Litopenaeus vannamei. When the molecular marker V has the dominant genotype AT, select that individual as a backup parent for breeding Litopenaeus vannamei. When the molecular marker W has the inferior genotype CC or CT, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei.

2. The application of the heat shock protein 70 molecular marker related to the cold resistance trait in Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primer set used to detect molecular markers A, B, D, E, and F includes primers FA and RA. The sequence of primer FA is ACTGTTGCTGTTGGACGTG, and the sequence of primer RA is TTCTGCTTGTGCTCATACTC. The amplification system for detecting molecular markers A, B, D, E, and F consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FA at a concentration of 10 μmol / L, 2 μL of primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O. The amplification reaction procedure includes the following steps: S11. Pre-denaturate at 94℃ for 3 min; S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s. S13, extend at 72℃ for 10 minutes.

3. The application of the heat shock protein 70 molecular marker related to the cold resistance trait in Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primer set used to detect molecular markers G, H, I, K, L, N, O, P, Q, R, S, T, V, and W includes primers FB and RB. The sequence of primer FB is CGCCGAGCCTTTCTGGAGGAA, and the sequence of primer RB is CAATATACGACTCATTGTTTCTG. The amplification system for detecting molecular markers G, H, I, K, L, N, O, P, Q, R, S, T, V, and W consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer FB at a concentration of 10 μmol / L, 2 μL of primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O. Meanwhile, the amplification reaction procedure includes the following steps: S21. Pre-denaturate at 94℃ for 3 min; S22. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 58℃ for 30s, and extension at 72℃ for 45s. S23, extend at 72℃ for 10 minutes.

Images