Application of SaLDC protein and its related biomaterials in regulating flowering time and yield of plants

Abstract

The present invention discloses the application of SaLDC protein and related biological materials in regulating the flowering time and yield of plants. The present invention studies the flowering, pod setting and fruit pod phenotypes and yield-related traits of SaLDC transgenic Arabidopsis and wild-type Arabidopsis and finds that overexpression of SaLDC gene can not only promote early flowering of Arabidopsis and shorten the growth cycle, but also the fruit pod length, width, weight and thousand-grain weight of single plant are more advantageous than those of wild type, and the phenotypic traits and SaLDC gene expression amount are in a dose effect. The present invention first discovered that the protein SaLDC derived from the medicinal plant Sophora alopecuroides of the Leguminosae family has the function of regulating the flowering time, fruit pod growth and development and yield of plants, enriching the content of theoretical research on plant flowering regulation, not only providing new gene resources for breeding new varieties of high-yield legume crops, but also laying a foundation for further studying the function of SaLDC gene in other crops.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of SaLDC protein and related biological materials in regulating the flowering time and yield of plants. Background Art

[0002] Flowering is an important sign of the transition of plants from vegetative growth to reproductive growth. It is a very important period that determines the speed of plant growth and development, and plays a vital role in the accumulation of plant biomass and the level of crop yield.

[0003] However, flowering of plants is a complex trait that is affected by many factors, including plant nutritional status, environmental temperature and photoperiod, and plants perceive the impact of changes in these factors by regulating the expression changes of a series of genes in the body. Therefore, understanding the molecular mechanism of plant flowering regulation and then regulating the flowering period of plants through genetic improvement methods has become the focus and hotspot of current molecular biology and agricultural scientists.

[0004] It is reported that more than a hundred genes in plants respond to and regulate flowering pathways, but there are still many regulatory factors that have not been identified and their biological functions have not been resolved. Therefore, the mining of plant flowering-related functional genes has important application value for breeding new high-yield crop varieties. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to regulate the flowering time and yield of plants. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0006] In order to solve the above technical problems, the present invention first provides the use of a protein or a substance for regulating the content and / or activity of the protein in any of the following A1)-A6):

[0007] A1) Regulate the flowering time of plants;

[0008] A2) regulating the growth and development of plant pods;

[0009] A3) regulating plant yield;

[0010] A4) breeding plants with altered flowering time and / or pod development and / or yield;

[0011] A5) preparing products for cultivating plants with altered flowering time and / or pod growth and / or yield;

[0012] A6) Plant breeding;

[0013] The protein is called lysine decarboxylase (LDC), which is derived from the medicinal plant Sophora alopecuroides L., and is referred to as SaLDC. The SaLDC protein is any one of the following B1)-B4):

[0014] B1) The amino acid sequence is the protein shown in SEQ ID NO: 2;

[0015] B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2;

[0016] B3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2;

[0017] B4) A protein that has 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2 and has the same function.

[0018] In the protein described in B2) above, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0019] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0020] In the protein described in B4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the value of the identity (%) can be obtained. The identity includes amino acid sequences having 80% or more, or 85% or more, or 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in Sequence 2 of the present invention.

[0021] The protein described in B1) or B2) or B3) or B4) above can be artificially synthesized, or its encoding gene can be synthesized first and then obtained by biological expression.

[0022] In the above application, the substance that regulates the content and / or activity of the SaLDC protein includes a substance that increases the content and / or activity of the SaLDC protein or a substance that decreases the content and / or activity of the SaLDC protein.

[0023] Furthermore, the substance that increases the activity of the SaLDC protein may be a protein, polypeptide or small molecule compound that enhances or promotes the function of the SaLDC protein.

[0024] The substance that increases the content of SaLDC protein may be a substance that promotes the synthesis of SaLDC protein or inhibits the degradation of SaLDC protein or overexpresses SaLDC protein.

[0025] The substance that reduces the activity of the SaLDC protein may be a protein, polypeptide or small molecule compound that inhibits the function of the SaLDC protein.

[0026] The substance that reduces the content of SaLDC protein may be a substance that inhibits the synthesis of SaLDC protein or promotes the degradation of SaLDC protein or knocks down (knocks down) or knocks out the gene encoding SaLDC protein.

[0027] Furthermore, the substance for increasing the content of SaLDC protein is a recombinant expression vector that overexpresses the gene encoding the SaLDC protein.

[0028] In a specific embodiment of the present invention, the recombinant expression vector for overexpressing the SaLDC protein encoding gene is a vector obtained by replacing the DNA fragment between the NcoI and BstEII restriction sites of the pCAMBI3301 vector with the SaLDC encoding gene sequence shown in Sequence 1, while keeping the other sequences of the pCAMBI3301 vector unchanged.

[0029] In order to solve the above technical problems, the present invention also provides new uses of biological materials related to SaLDC protein.

[0030] The present invention provides the use of a biological material related to the SaLDC protein in any of the following A1)-A6):

[0031] A1) Regulate the flowering time of plants;

[0032] A2) regulating the growth and development of plant pods;

[0033] A3) regulating plant yield;

[0034] A4) breeding plants with altered flowering time and / or pod development and / or yield;

[0035] A5) preparing products for cultivating plants with altered flowering time and / or pod growth and / or yield;

[0036] A6) Plant breeding;

[0037] The biological material is any one of the following E1) to E5):

[0038] E1) a nucleic acid molecule encoding the above-mentioned SaLDC protein;

[0039] E2) a nucleic acid molecule for knocking down or knocking out the SaLDC protein encoding gene;

[0040] E3) an expression cassette containing the nucleic acid molecule described in E1) or E2);

[0041] E4) a recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3);

[0042] E5) A recombinant microorganism containing the nucleic acid molecule described in E1) or E2), or a recombinant microorganism containing the expression cassette described in E3), or a recombinant microorganism containing the recombinant vector described in E4).

[0043] In the above application, the nucleic acid molecule in E1) is any one of the following:

[0044] F1) DNA molecule shown in sequence 1;

[0045] F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and encoding the above-mentioned SaLDC protein.

[0046] A person skilled in the art can easily mutate the nucleotide sequence encoding the SaLDC protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the SaLDC nucleotide sequence isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the SaLDC protein and have the same function. The identity refers to the sequence similarity with the natural nucleic acid sequence, including nucleotide sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0047] The nucleic acid molecule described in E2) above may be gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA or antisense RNA.

[0048] Any of the above-mentioned nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0049] Any of the above-mentioned nucleic acid molecules can be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0050] Any of the above-mentioned expression cassettes may include a promoter, the nucleic acid molecule described in E1) or E2) above, and a terminator. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Furthermore, the expression cassette may also include an enhancer sequence.

[0051] Any of the above-mentioned vectors refers to a vector that can carry the nucleic acid molecule described in E1) or E2) into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid, viral vector (such as retrovirus (including lentivirus), adenovirus, adeno-associated virus, etc.).

[0052] Any of the above-mentioned recombinant vectors refers to a recombinant DNA molecule constructed by connecting the nucleic acid molecule described in E1) or E2) with the vector in vitro. The recombinant vector containing the nucleic acid molecule described in E1) or E2) can be constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Company), etc. The plant expression vector may also contain the 3′ non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylation to the 3′ end of the mRNA precursor, such as the Agrobacterium crown gall-inducing (Ti) plasmid gene (such as nopaline synthase gene Nos), plant genes (such as soybean storage protein gene) 3' end transcription of non Translation Area All have similar functions. When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are extensive and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0053] Any of the above-mentioned microorganisms may be bacteria, fungi, actinomycetes, protozoa, algae or viruses. Wherein, the bacteria may be from Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., etc., but not limited thereto, for example, the bacteria may be Escherichia coli, Bacillus subtilis or Bacillus pumilus. The fungus may be yeast, and the yeast may be from the genus Saccharomyces (such as Saccharomyces cerevisiae), the genus Kluyveromyces (such as Kluyveromyces lactis), the genus Pichia (such as Pichia pastoris), the genus Schizosaccharomyces (such as Schizosaccharomyces pombe), the genus Hansenula (such as Hansenula polymorpha), etc., but not limited thereto. The fungus may also be from the genus Fusarium (Fusarium sp.), the genus Rhizoctonia (Rhizoctonia sp.), the genus Verticillium (Verticillium sp.), the genus Penicillium (Penicillium sp.), the genus Aspergillus (Aspergillus sp.), the genus Cephalosporium (Cephalosporium sp.), etc., but not limited thereto. The actinomycetes may be from Streptomyces sp., Nocardia sp., Micromonospora sp., Streptosporangium sp., Actinoplanes sp., Thermoactinomyces sp., etc., but not limited thereto. The algae may be from Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., Boekelovia sp., etc., but not limited thereto. The virus may be rotavirus, herpes virus, influenza virus, adenovirus, etc., but not limited thereto.

[0054] Any of the above-mentioned recombinant microorganisms refers to the manipulation and modification of the genes of the target microorganism to obtain a functional A recombinant microorganism that can undergo a change, such as a recombinant microorganism obtained by introducing the above-mentioned recombinant vector into a target microorganism. The recombinant microorganism can be understood to refer not only to a specific recombinant microorganism, but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the offspring may not necessarily be completely identical to the original parent cell, but is still included in the scope of the recombinant microorganism.

[0055] In any of the above applications, the regulating the flowering time of plants is to advance the development of plants or delay the flowering of plants. The regulating the flowering time of plants is embodied in that: the higher the content and / or activity of SaLDC protein in plants, the earlier the flowering time of plants; the lower or missing the content and / or activity of SaLDC protein in plants, the delayed flowering time of plants.

[0056] In a specific embodiment of the present invention, when the expression level of the gene encoding the SaLDC protein in a plant is increased, the flowering time of the plant is advanced.

[0057] In any of the above applications, the regulation of plant pod growth and development is to promote plant pod growth and development or inhibit plant pod growth and development. The regulation of plant pod growth and development is embodied in regulating plant pod length and / or pod width and / or pod weight, and is further embodied in that: the higher the SaLDC protein content and / or activity in the plant, the longer the plant pod length, the wider the pod width, and the heavier the pod weight; the lower the SaLDC protein content and / or activity in the plant or the SaLDC protein function is missing, the shorter the plant pod length, the shorter the pod width, and the lighter the pod weight.

[0058] In a specific embodiment of the present invention, when the expression level of the gene encoding the SaLDC protein in the plant is increased, the length, width and weight of the pods of the plant are increased.

[0059] In any of the above applications, the regulation of plant yield is to increase plant yield or reduce plant yield. The regulation of plant yield is embodied in regulating the plant thousand-grain weight, which is further embodied in that: the higher the SaLDC protein content and / or activity in the plant, the higher the plant yield (thousand-grain weight); the lower the SaLDC protein content and / or activity in the plant or the loss of SaLDC protein function, the lower the plant yield (thousand-grain weight).

[0060] In a specific embodiment of the present invention, when the expression level of the SaLDC protein encoding gene in the plant is increased, the thousand-grain weight, an important yield indicator of the plant, increases.

[0061] In any of the above applications, the cultivated plants with altered flowering time and / or pod growth and / or yield are transgenic plants with early flowering time and / or increased pod length and / or increased pod width and / or increased pod weight and / or increased yield.

[0062] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic plants with early flowering time and / or increased fruit pod length and / or increased fruit pod width and / or increased fruit pod weight and / or increased yield.

[0063] The method for cultivating transgenic plants with early flowering time and / or increased fruit pod length and / or increased fruit pod width and / or increased fruit pod weight and / or increased yield provided by the present invention comprises the following steps: increasing the content and / or activity of SaLDC protein in the target plant to obtain transgenic plants with early flowering time and / or increased fruit pod length and / or increased fruit pod width and / or increased fruit pod weight and / or increased yield.

[0064] Furthermore, the method for increasing the content and / or activity of SaLDC protein in the target plant is to overexpress the SaLDC protein in the target plant.

[0065] Furthermore, the overexpression method is to introduce the nucleic acid molecule encoding the SaLDC protein into the target plant. The introduction includes but is not limited to: transfecting plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and cultivating the transfected plant cells or tissues into plants.

[0066] In a specific embodiment of the present invention, the nucleic acid molecule of the SaLDC protein is introduced into the target plant via the above-mentioned recombinant expression vector pCAMBI3301-SaLDC.

[0067] In any of the above applications or methods, the plant can be a dicotyledon or a monocotyledon, specifically including food crops such as rice, wheat, barley, corn, soybean, potato, bean, oat and millet, vegetable crops such as Arabidopsis, Chinese cabbage, radish, pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, zucchini, leek, onion and carrot, cash crops such as ginseng, tobacco, cotton, sesame, sugarcane, beet, wild sesame, peanut and rapeseed, and cash crops such as apple, pear, jujube, peach, etc. The invention relates to fruits including kiwi, grape, orange, persimmon, plum, apricot and banana, flowers including rose, gladiolus, gerbera, carnation, chrysanthemum, lily and tulip, fodder crops including ryegrass, red clover, orchard grass, alfalfa, tall butter grass and perennial ryegrass, woody plants for making wood including poplar, willow, birch, locust, elm, metasequoia, spruce, beech, maple, oak, chinaberry, ash, nasturtium, iron wire, red sandalwood, yellow sandalwood, teak, ash, maple, etc. Further, the dicotyledon is a cruciferous plant. Further, the cruciferous plant is Arabidopsis thaliana (such as Arabidopsis thaliana ecotype Col).

[0068] The present invention studies the flowering, pod setting and pod phenotypes and yield-related agronomic traits of SaLDC transgenic Arabidopsis and wild-type Arabidopsis and finds that overexpression of the SaLDC gene can not only promote early flowering of Arabidopsis and shorten the growth cycle, but also the length, width, weight and thousand-grain weight of the pod of a single plant are more advantageous than the wild type, and the phenotypic traits and the expression level of the SaLDC gene are in a dose effect, that is, in Arabidopsis, the higher the expression level of the SaLDC gene, the earlier the flowering and the higher the yield of the strain. The present invention first discovered that the protein SaLDC derived from the medicinal plant Sophora alopecuroides of the Leguminosae family has the function of regulating the flowering time, pod growth and development, and yield of the plant. The SaLDC protein is the first key enzyme in the synthesis pathway of quinolizidine alkaloids, the main medicinal active ingredient of Sophora alopecuroides, and its main biological function is to catalyze the decarboxylation of lysine to produce cadaverine. The present invention has discovered new functions of the SaLDC gene in leguminous medicinal plants, enriched the theoretical research on plant flowering regulation, and not only provided new gene resources for breeding new varieties of high-yield leguminous crops, but also laid a foundation for further studying the functions of the SaLDC gene in other crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 The electrophoresis diagram is the resistance screening of transgenic Arabidopsis and the PCR detection of T1 positive seedlings. Among them, M: DL2000; 1-11: transgenic resistant seedlings; WT: wild-type Arabidopsis.

[0070] Figure 2 for SaLDC Transgenic Arabidopsis SaLDC Relative expression detection.

[0071] Figure 3 This is the early flowering phenotype of SaLDC transgenic Arabidopsis.

[0072] Figure 4 This is the pod-setting phenotype of SaLDC transgenic Arabidopsis.

[0073] Figure 5 This is the fruit pod phenotype of SaLDC transgenic Arabidopsis thaliana.

[0074] Figure 6 Statistical results of yield-related traits of SaLDC transgenic Arabidopsis thaliana. DETAILED DESCRIPTION

[0075] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0076] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0077] The MS culture medium in the following examples was prepared according to the formula shown in Table 1 and Table 2. After preparation, the pH value was adjusted to 5.75-5.8 with Tris-Mes, and after high-pressure sterilization, it was placed on a clean bench for use.

[0078] Table 1. MS culture medium (1L)

[0079]

[0080] Table 2. MS medium mother solution formula

[0081]

[0082]

[0083] Example 1. Acquisition and identification of SaLDC transgenic Arabidopsis plants

[0084] 1. Obtaining SaLDC transgenic Arabidopsis plants

[0085] 1. Construction of recombinant expression vector

[0086] The DNA fragment between the NcoI and BstEII restriction sites of the pCAMBI3301 vector was replaced with the coding gene sequence of SaLDC shown in Sequence 1, and the other sequences of the pCAMBI3301 vector were kept unchanged to obtain the recombinant expression vector pCAMBI3301-SaLDC.

[0087] 2. Construction of recombinant bacteria

[0088] The recombinant expression vector pCAMBI3301-SaLDC was transformed into Agrobacterium GV3101 by freeze-thaw method, and the colony PCR identification was positive, indicating that the recombinant expression vector was successfully transformed into Agrobacterium.

[0089] 3. Obtaining transgenic Arabidopsis plants

[0090] Agrobacterium-mediated inflorescence infection method was used to infect wild-type Arabidopsis thaliana (Columbia ecotype) with Agrobacterium GV3101 containing the recombinant expression vector to obtain T0 generation transgenic Arabidopsis thaliana. The specific steps are as follows:

[0091] (1) Take out the Agrobacterium culture medium containing the recombinant expression vector, inoculate it into 5 mL of LB liquid culture medium containing antibiotics at a ratio of 1:100, and activate it at 28°C and 150 rpm for 1 to 2 days.

[0092] (2) The activated Agrobacterium culture solution was inoculated into 250 mL of LB liquid medium (containing antibiotics) at a ratio of 1:50 and cultured overnight at 28°C and 150 rpm.

[0093] (3) Centrifuge at 5000 rpm for 10 min, discard the culture medium, resuspend the cells in 500 mL of 5% sucrose solution (containing Silwet L-77 at a final concentration of 0.03%), prepare the transformation solution, mix well and set aside.

[0094] (4) Before transformation, water the Arabidopsis thoroughly and cut off the fruit pods. Immerse the inflorescence in the transformation solution and shake it gently. Remove it after immersion for 1 minute, shake off the excess transformation solution on the plant, wrap the plant with plastic wrap, place it sideways on a tray, and culture it in the dark for 24 hours. After removing the film, place it upright for culture and transform it again after about 7 days.

[0095] (5) Continue to cultivate Arabidopsis thaliana in the culture room, collect all mature seeds, record them as T0 generation, and store them in a refrigerator at 4°C after drying.

[0096] 4. Resistance screening of transgenic Arabidopsis

[0097] The T0 generation transgenic Arabidopsis thaliana was screened for resistance to obtain the T1 generation transgenic Arabidopsis thaliana with herbicide resistance. The specific steps are as follows:

[0098] (1) Take a small amount of T0 transgenic Arabidopsis seeds and spread them evenly in a culture medium that absorbs water well.

[0099] (2) After the Arabidopsis seedlings have emerged and grown to 4 true leaves, the herbicide basta (RZ0160, 20% active ingredient) is sprayed to screen for plants resistant to the herbicide.

[0100] (3) When using the herbicide, dilute it with water at a volume ratio of 5:10000 (mL) and spray it once every 7 days for 14 consecutive days.

[0101] (4) Select Arabidopsis thaliana with healthy growth and green leaves and transfer them to a new culture medium and culture them in an Arabidopsis thaliana culture room.

[0102] (5) When Arabidopsis seeds mature, collect all mature seeds from each plant and record them as the T1 generation.

[0103] The results of resistance screening of transgenic Arabidopsis thaliana are as follows Figure 1 shown.

[0104] 5. PCR identification of transgenic Arabidopsis

[0105] The genomic DNA of wild-type Arabidopsis thaliana (WT) and T1 transgenic Arabidopsis thaliana plants with herbicide resistance was extracted, and PCR detection was performed using primers F and R. The primer sequences are as follows:

[0106] F: TGATGTGATATCTCCACTGACGTA;

[0107] R: CACTTAACTGCATAGAAAGGTTGAA.

[0108] The results are as follows Figure 1 As shown, the results showed that no band was amplified in the negative control using wild-type Arabidopsis as a template, while a band of 393 bp was amplified in the transgenic Arabidopsis, indicating that the SaLDC gene has been integrated into the Arabidopsis genome.

[0109] The transgenic Arabidopsis thaliana identified as positive by PCR were screened repeatedly for 2-3 generations according to the above method until a homozygous strain was screened out for each strain.

[0110] 2. Detection of relative expression of SaLDC in SaLDC transgenic Arabidopsis plants

[0111] Total RNA was extracted from wild-type Arabidopsis thaliana (WT) and T3 SaLDC transgenic Arabidopsis thaliana homozygous lines SaLDC-OE2, SaLDC-OE4 and SaLDC-OE8, and then reverse transcribed into cDNA. Specific primers were used for fluorescence quantitative PCR detection, and Lectin gene was used as internal reference. -△△CTMethods The relative expression was calculated, the data were sorted using Microsoft Excel, the variance analysis was performed using SPASS software, and finally the graph was drawn using GraphPad Prism. The primer sequences are as follows:

[0112] QLDC-F:AACCTATCACGGGAGCCATC;

[0113] QLDC-R:ACCGCCACCAATGTCGAGT;

[0114] Lectin-F:GCATAAACTATAACGCTGCCACT;

[0115] Lectin-R:CTTGAGAATCCAACCCTGACC.

[0116] The results are as follows Figure 2 As shown, the results showed that: by fluorescence quantitative PCR analysis, it was found that the SaLDC gene was expressed in wild-type Arabidopsis (WT) and T3 generation SaLDC transgenic Arabidopsis homozygous lines SaLDC-OE2, SaLDC-OE4 and SaLDC-OE8. Among them, the relative expression level of SaLDC gene in the T3 generation SaLDC transgenic Arabidopsis homozygous line SaLDC-OE2 (131.0522) was the highest, the relative expression level of SaLDC gene in the T3 generation SaLDC transgenic Arabidopsis homozygous line SaLDC-OE8 (73.0457) was the second, and the relative expression level of SaLDC gene in the T3 generation SaLDC transgenic Arabidopsis homozygous line SaLDC-OE4 (47.3615) was the lowest. In addition, the relative expression levels of SaLDC genes in the three T3 generation SaLDC transgenic Arabidopsis homozygous lines were significantly higher than those in the wild type. Arabidopsis thaliana.

[0117] Example 2: Phenotypic analysis of SaLDC transgenic Arabidopsis plants

[0118] Seeds of wild-type Arabidopsis, T3 generation SaLDC transgenic Arabidopsis homozygous strains SaLDC-OE2, SaLDC-OE4 and SaLDC-OE8 with uniform size, full grains and no insect infestation were selected, and sterilized with 0.6% sodium hypochlorite solution for 15 minutes, during which they were repeatedly shaken and rinsed with sterile water for 3 to 5 times to obtain sterile seeds. After the sterile seeds were placed in a 4°C refrigerator for low temperature treatment for 3 days, the sterile Arabidopsis seeds were sown on MS solid culture medium with an agar concentration of 0.8% using a sterile pipette tip, and then placed in a 22°C light incubator for continuous light culture, with a light cycle of 16 hours of light / 8 hours of darkness. During the experiment, the position of the culture dish was changed every day to prevent uneven light exposure for each culture dish. After growing on MS culture medium for 7 days, the seedlings were transplanted into soil (vermiculite: nutrient soil is 1:1-1:2) for subsequent observation of flowering phenotype, pod setting and fruit pod phenotype, and measurement of yield-related trait indicators.

[0119] The flowering phenotype observation results are as follows Figure 3 As shown in the figure, the results showed that when the seedlings grown on MS medium for 7 days were transplanted into soil (vermiculite: nutrient soil was 1:1-1:2) and grown to 25 days, the T3 generation SaLDC transgenic Arabidopsis homozygous line SaLDC-OE2 (the line with the highest SaLDC gene expression) showed a flowering phenotype; followed by SaLDC transgenic Arabidopsis homozygous lines SaLDC-OE8 and SaLDC-OE4, and the wild-type Arabidopsis plants began to bloom at 32 days of growth. This shows that SaLDC protein can regulate the flowering time of Arabidopsis, and this phenotypic trait and SaLDC gene expression are in a dosage effect.

[0120] The observation results of pod and fruit pod phenotypes are as follows Figure 4 and Figure 5 The results showed that when the wild-type Arabidopsis strains grew to 2 months old, the number of branches, growth vigor and pod number were lower than those of the SaLDC transgenic Arabidopsis strains, among which the growth vigor of the SaLDC transgenic Arabidopsis strain SaLDC-OE2 was the most prominent. The statistical results of yield-related traits are shown in Tables 3, 4, 5, 6 and Figure 6 As shown in the figure, the results showed that the pod length, pod width, pod weight and 1000-grain weight of SaLDC transgenic Arabidopsis lines were significantly higher than those of wild-type Arabidopsis lines, among which the SaLDC transgenic Arabidopsis line SaLDC-OE2 had the highest indexes, followed by SaLDC-OE8 and finally SaLDC-OE4. This indicates that SaLDC protein can regulate the growth and development of plant pods and yield, and this phenotypic trait and SaLDC gene expression level are in a dosage effect.

[0121] Table 3. Analysis of variance of Arabidopsis pod length

[0122]

[0123] Table 4. ANOVA of Arabidopsis pod width

[0124]

[0125]

[0126] Table 5. Analysis of variance of Arabidopsis pod weight

[0127]

[0128] Table 6. Analysis of variance of 1000-grain weight of Arabidopsis thaliana

[0129]

[0130] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of the protein in any of the following A1)-A5): A1) Regulate the flowering time of plants; A2) regulating the growth and development of plant pods; A3) regulating plant yield; A4) breeding plants with altered flowering time and / or pod development and / or yield; A5) preparing products for cultivating plants with altered flowering time and / or pod growth and / or yield; The protein is the following B1) or B2): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; The plant is Arabidopsis thaliana.

2. Application of protein-related biomaterials in any of the following A1)-A5): A1) Regulate the flowering time of plants; A2) regulating the growth and development of plant pods; A3) regulating plant yield; A4) breeding plants with altered flowering time and / or pod development and / or yield; A5) preparing products for cultivating plants with altered flowering time and / or pod growth and / or yield; The protein is the following B1) or B2): B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2; The biological material is any one of the following E1) to E5): E1) a nucleic acid molecule encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); The plant is Arabidopsis thaliana.

3. The use according to claim 2, characterized in that: E1) The nucleic acid molecule is the DNA molecule shown in Sequence 1.

4. The use according to any one of claims 1 to 3, characterized in that: The regulating the growth and development of plant pods is embodied in regulating the length and / or width and / or weight of plant pods.

5. The use according to any one of claims 1 to 3, characterized in that: The regulating plant yield is embodied in regulating the plant thousand-grain weight.

Images