Molecular Marker of Glycogen Phosphorylase in Litopenaeus vannamei Related to Cold Tolerance Trait and Its Application

Abstract

The invention discloses a cold-resistance-related molecular marker of glycogen phosphorylase of whiteleg shrimp, comprising any one or more of a molecular marker A, a molecular marker B, a molecular marker C, a molecular marker D and a molecular marker E. The molecular marker of the invention is significantly correlated with the cold-resistance trait of whiteleg shrimp, can be used as a functional marker of cold-resistance ability of whiteleg shrimp, and improves the efficiency of cold-resistance breeding of whiteleg shrimp. The method comprises the following steps: extracting genomic DNA of muscle tissue of whiteleg shrimp to be tested and using the genomic DNA as a template DNA for PCR amplification and purifying the amplified product, then sequencing the obtained product, determining the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D and the molecular marker E, thereby selecting individuals with advantageous genotypes for breeding whiteleg shrimp, and accurately and efficiently breeding whiteleg shrimp varieties with strong cold-resistance and stress resistance.

Description

Technical Field

[0001] The present invention belongs to the technical field of Litopenaeus vannamei breeding, and particularly relates to a molecular marker of glycogen phosphorylase related to cold tolerance traits of Litopenaeus vannamei and its application. Background Art

[0002] Due to its characteristics of fast growth, delicious meat, rich nutrition and suitability for intensive farming, Litopenaeus vannamei is deeply loved by farmers and consumers, and has become one of the most widely cultured crustaceans in China. Under artificial breeding conditions, the suitable water temperature for this shrimp is 16 - 38°C. When the water temperature is lower than 15°C, it will stop eating, and when the water temperature is lower than 10°C, it may cause a large number of deaths. During the Chinese Spring Festival every year, its market price is usually 2 to 3 times that of normal times. Therefore, shrimp farmers are encouraged to carry out shrimp farming in winter to seek a large market supply during the Spring Festival. However, this farming method is restricted by the low temperature in winter. Too low water temperature will lead to the growth stagnation of shrimps and even a large number of deaths. Currently, low temperature has been regarded as one of the key environmental factors affecting the growth and survival of Litopenaeus vannamei. Nevertheless, the current research on the low-temperature tolerance mechanism and variety breeding of Litopenaeus vannamei is still very limited.

[0003] Glycogen Phosphorylase (GP) is a key rate-limiting enzyme in the process of glycogen decomposition, mainly acting on the α-1,4 glycosidic bond of glycogen and directly promoting glycogen decomposition. Research shows that GP is closely related to physiological activities such as tissue differentiation, feeding and movement of animals. Under cold stress, the gene expression of GP is up-regulated, and the activity of GP is enhanced, thus promoting the conversion of glycogen into antifreeze protectants. Therefore, the Glycogen Phosphorylase gene is very likely to become an important biomarker for studying the cold tolerance ability of Litopenaeus vannamei.

[0004] Compared with traditional breeding techniques, molecular marker-assisted breeding shows advantages such as higher efficiency, accuracy and being unaffected by environmental factors, and can significantly improve the breeding efficiency of animals and plants. Single nucleotide polymorphism (SNP) has been widely used in molecular-assisted breeding due to its large number and genetic stability in the genome. Currently, SNP molecular markers significantly related to low-temperature traits have been reported in a variety of aquatic animals. For example, 13 SNP loci related to low-temperature tolerance traits have been found in the Perlucin gene of Pinctada fucata martensii; 2 SNP loci related to low-temperature tolerance traits have also been identified in the Hsp70 gene of Crassostrea gigas. In Paralichthys olivaceus, hsp70 and hmgb1 genes have respectively found 3 and 2 SNPs significantly associated with low-temperature tolerance, among which hsp70The allele G at the SNP_1797 locus of the gene was only found in the cold-tolerant population of Paralichthys olivaceus, while hmgb1 the T allele at the SNP_725 locus of the gene is associated with the cold-tolerant trait of Paralichthys olivaceus. However, there are few reports on the molecular marker research of the cold-tolerant trait of Litopenaeus vannamei. SUMMARY OF THE INVENTION

[0005] In view of the above deficiencies, the present invention discloses a Litopenaeus vannamei glycogen phosphorylase molecular marker related to the cold-tolerant trait. An SNP molecular marker related to the cold-tolerant trait of Litopenaeus vannamei is screened based on the glycogen phosphorylase gene of Litopenaeus vannamei, and the SNP molecular marker is used as a functional marker for breeding Litopenaeus vannamei varieties with strong cold tolerance.

[0006] The present invention is implemented by the following technical solutions:

[0007] A Litopenaeus vannamei glycogen phosphorylase molecular marker related to the cold-tolerant trait, which includes any one or more of molecular marker A, molecular marker B, molecular marker C, molecular marker D, and molecular marker E;

[0008] The molecular marker A is located at the 2475 bp site of the nucleotide sequence shown in Sequence 1 in the sequence listing, denoted as D.2475 C>T. The base at this site is C or T, and the mutation types are C / C homozygous type and C / T heterozygous type;

[0009] The molecular marker B is located at the 2481 bp site of the nucleotide sequence shown in Sequence 1 in the sequence listing, denoted as D.2481 G>A. The base at this site is A or G, and the mutation types are A / G heterozygous type and G / G homozygous type;

[0010] The molecular marker C is located at the 2562 bp site of the nucleotide sequence shown in Sequence 1 in the sequence listing, denoted as D.2562 C>T. The base at this site is C or T, and the mutation types are C / C homozygous type and C / T heterozygous type;

[0011] The molecular marker D is located at the 2611 bp site of the nucleotide sequence shown in Sequence 1 in the sequence listing, denoted as D.2611 G>A. The base at this site is A or G, and the mutation types are A / G heterozygous type and G / G homozygous type;

[0012] The molecular marker E is located at the 2643 bp site of the nucleotide sequence shown in Sequence 1 in the sequence listing, denoted as D.2643 G>T. The base at this site is G or T, and the mutation types are G / G homozygous type and G / T heterozygous type.

[0013] The nucleotide sequence described in Sequence 1 of the Sequence Listing is the nucleotide sequence of the gene glycogen phosphorylase gene.

[0014] The application of the whiteleg shrimp glycogen phosphorylase molecular marker related to the cold tolerance trait is to use the whiteleg shrimp glycogen phosphorylase molecular marker for the selective breeding of whiteleg shrimp with cold tolerance traits. Specifically, first extract the genomic DNA of the muscle tissue of the whiteleg shrimp to be tested, then use the genomic DNA as the template DNA for PCR amplification, then purify the amplification product, and then sequence the purified amplification product to determine the genotypes of the molecular markers A, B, C, D, and E;

[0015] When the genotype of molecular marker A is the CT genotype of the dominant genotype, select this individual as a candidate parent for whiteleg shrimp variety breeding; when the genotype of molecular marker B is the AG genotype of the dominant genotype, select this individual as a candidate parent for whiteleg shrimp variety breeding; when the genotype of molecular marker C is the CT genotype of the dominant genotype, select this individual as a candidate parent for whiteleg shrimp variety breeding; when the genotype of molecular marker D is the AG genotype of the dominant genotype, select this individual as a candidate parent for whiteleg shrimp variety breeding; when the genotype of molecular marker E is the GT genotype of the dominant genotype, select this individual as a candidate parent for whiteleg shrimp variety breeding.

[0016] In the PCR amplification process, the primer set for detecting the whiteleg shrimp glycogen phosphorylase molecular marker related to the cold tolerance trait includes primer F and primer R. The sequence of primer F is ATGATGGAAGAGATGGGC (Sequence 2 in the Sequence Listing), and the sequence of primer R is TGTATCCCACAGGCAAACTCT (Sequence 3 in the Sequence Listing).

[0017] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0018] The reaction procedure of the PCR amplification includes the following steps:

[0019] S1. Pre-denature at 94°C for 3 min;

[0020] S2. Denature at 94°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 45 s, and perform 35 cycles;

[0021] S3. Extend at 72 °C for 10 min.

[0022] The technical solution has the following beneficial effects compared with the prior art:

[0023] Based on the analysis and screening of the glycogen phosphorylase gene of Litopenaeus vannamei, the present invention provides SNP molecular markers closely related to the cold tolerance trait of Litopenaeus vannamei, which can be applied to the accurate and efficient breeding of new cold-tolerant varieties of Litopenaeus vannamei, facilitating the research and application of cold tolerance and stress resistance breeding of Litopenaeus vannamei, and providing a good foundation for the research on low-temperature culture and improvement of Litopenaeus vannamei. Description of the Drawings

[0024] Figure 1 is a partial fragment sequence of the product obtained by amplifying the glycogen phosphorylase gene in the example. a represents positions 327 - 333, showing the CC and CT peak maps of the D.2475 C>T locus; b represents positions 333 - 339, showing the AG and GG peak maps of the D.2481 G>A locus; c represents positions 414 - 420, showing the CC and CT peak maps of the D.2562C>T locus; d represents positions 463 - 469, showing the AG and GG peak maps of the D.2611 G>A locus; e represents positions 495 - 501, showing the GG and GT peak maps of the D.2643 G>T locus. Detailed Embodiments

[0025] The present invention is further illustrated by the following examples, which shall not be construed as limiting the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means used are generally conventional means well-known to those skilled in the art.

[0026] Example: The screening of the glycogen phosphorylase molecular marker of Litopenaeus vannamei related to the cold tolerance trait described in the present invention is as follows:

[0027] (1) After selecting 120 Litopenaeus vannamei with a body weight of about 3 g and acclimating them for 2 days, a cold tolerance experiment was carried out with 9.5 - 10.5 °C as the stress condition. The first 40 shrimps that died were used as the low-temperature sensitive group, and the last 40 surviving shrimps were used as the low-temperature tolerant group.

[0028] (2) Randomly select 5 Litopenaeus vannamei from the low-temperature sensitive group and the low-temperature tolerant group respectively, extract muscle tissue and extract genomic DNA using the conventional phenol-chloroform extraction method. The obtained genomic DNA was stored at -20 °C for future use.

[0029] (3)Primers F and R were designed based on the mRNA sequence of the Litopenaeus vannamei glycogen phosphorylase gene, and then used to amplify and screen for SNP sites in the glycogen phosphorylase gene.

[0030] The sequence of primer F is: ATGATGGAAGAGATGGGC;

[0031] The sequence of primer R is: TGTATCCCACAGGCAAACTCT;

[0032] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer F at a concentration of 10 μmol / L, 2 μL of primer R at a concentration of 10 μmol / L, and 20 μL of ddH2O;

[0033] The reaction program for PCR amplification includes the following steps:

[0034] S1: Pre-denature at 94°C for 3 min;

[0035] S2: Denature at 94°C for 30 s, anneal at 60°C for 30 s, and extend at 72°C for 45 s for 35 cycles;

[0036] S3: Extend at 72°C for 10 min;

[0037] (4)The PCR amplification products were detected by 1% agarose gel electrophoresis, purified and sequenced, and then analyzed by DNAstar software for sequence alignment and peak map analysis to screen for relevant SNPs sites; the sequence of the PCR amplification products of one sample is shown as follows:

[0038] ATGATGGAAGAGATGGGCAAGGAGAACATCTTCATCTTTGGCATGACTGTTGAGGAAGTAGAAGAGCTCAAGCGCCGTGGTTACAATGCTCATGATTATTACAATCGCCTCCCAGAGCTGCGCCAGTGCATTGATCAGATCAGCAGTGGATTCTTCTCCCCAAGCAATCCTGACCAATTCAAGGACTTGGTCAACATCCTCATGTATCATGATCGCTTCTTCCTGTTCGCTGACTTCGAATCTTACATCAAATGCCAAGATTCTGTCAACAAGCTGTACCAGAATCCAAATGATTGGACCAGCAAGGCGATCATGAACATTGCCTCCTCCGGCAAGTTCTCTAGTGACAGAACCATTGCACAGTACGGCCGAGAAATTTGGGGGGTTGAGCCCTCTTGGGAGAAGTTGCCTGCTCCCCACGAGCCACGAGATACAGATATTACCAGAGAAGAAGCTAAGTAAACCGGATTCTGCCAGGTTGGTCAAGTCTTCTGGTTGTATAGAGTTTGCCTGTGGGATACA;

[0039] Among them, the 330th position is D.2475 C>T, the 336th position is D.2481 G>A, the 417th position is D.2562 C>T, the 466th position is denoted as D.2611 G>A, and the 498th position is D.2643 G>T;

[0040] (5)According to the selected SNPs sites, the white shrimps in the sensitive group and the tolerant group are respectively detected and genotyped according to the above method, the samples of different SNP sites in the sensitive group and the tolerant group are counted, the genotype frequencies and allele frequencies are calculated, and the chi-square analysis is used for independence test. The specific results are shown in Table 1.

[0041] Analysis based on Table 1 shows that the genotypic polymorphisms of each molecular marker locus have a highly significant impact on the cold tolerance trait of Litopenaeus vannamei: The cold tolerance performance of individuals with the CT genotype of molecular marker A is better than that of individuals with the CC genotype. Preferentially select locus D.2475 C>T for CC genotype individuals; The cold tolerance performance of individuals with the AG genotype of molecular marker B is better than that of individuals with the GG genotype. Preferentially select locus D.2481 G>A for AG genotype individuals; The cold tolerance performance of individuals with the CT genotype of molecular marker C is better than that of individuals with the CC genotype. Preferentially select locus D.2562 C>T for CT genotype individuals; The cold tolerance performance of individuals with the AG genotype of molecular marker D is better than that of individuals with the GG genotype. Select locus D.2611 G>A for AG genotype individuals; The cold tolerance performance of individuals with the GT genotype of molecular marker E is better than that of individuals with the GG genotype. Preferentially select locus D.2643 G>T for GT genotype individuals.

[0042] In the present invention, appendage muscle tissue of Litopenaeus vannamei is taken to extract DNA, which will not cause too much impact on the shrimp body. Breeding can be carried out by means of molecular-assisted breeding, such as using methods of gene knockout or gene editing to process the molecular markers and then obtaining the varieties.

[0043] Chi-square analysis results of the loci described in Table 1

[0044]

[0045] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Application of a molecular marker of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance trait, characterized in that: The molecular markers of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance traits include molecular marker A, molecular marker B, molecular marker C, molecular marker D, and molecular marker E; molecular marker A is located at the 2475 bp site of the nucleotide sequence shown in Sequence 1 in the Sequence Listing, denoted as D.2475 C>T, the base at this site is C or T, and the mutation types are C / C homozygous type and C / T heterozygous type; molecular marker B is located at the 2481 bp site of the nucleotide sequence shown in Sequence 1 in the Sequence Listing, denoted as D.2481 G>A, the base at this site is A or G, and the mutation types are A / G heterozygous type and G / G homozygous type; molecular marker C is located at the 2562 bp site of the nucleotide sequence shown in Sequence 1 in the Sequence Listing, denoted as D.2562 C>T, the base at this site is C or T, and the mutation types are C / C homozygous type and C / T heterozygous type; molecular marker D is located at the 2611 bp site of the nucleotide sequence shown in Sequence 1 in the Sequence Listing, denoted as D.2611 G>A, the base at this site is A or G, and the mutation types are A / G heterozygous type and G / G homozygous type; molecular marker E is located at the 2643 bp site of the nucleotide sequence shown in Sequence 1 in the Sequence Listing, denoted as D.2643 G>T, the base at this site is G or T, and the mutation types are G / G homozygous type and G / T heterozygous type; The molecular markers of Litopenaeus vannamei glycogen phosphorylase are used for the selective breeding of Litopenaeus vannamei with cold tolerance traits. Specifically, first, genomic DNA of the muscle tissue of the Litopenaeus vannamei to be tested is extracted, then the genomic DNA is used as template DNA for PCR amplification, then the amplification product is purified, and then the purified amplification product is sequenced to determine the genotypes of the molecular marker A, molecular marker B, molecular marker C, molecular marker D, and molecular marker E; When the genotype of molecular marker A is the CT genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker B is the AG genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker C is the CT genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker D is the AG genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties; when the genotype of molecular marker E is the GT genotype of the dominant genotype, select this individual as a candidate parent for the breeding of Litopenaeus vannamei varieties.

2. Use of the molecular marker of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance traits according to claim 1, characterized in that: In the PCR amplification process, the primer set for detecting the molecular markers of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance traits includes primer F and primer R. The sequence of primer F is ATGATGGAAGAGATGGGC, and the sequence of primer R is TGTATCCCACAGGCAAACTCT.

3. Use of the molecular marker of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance traits according to claim 2, characterized in that: The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.

4. Use of the molecular marker of Litopenaeus vannamei glycogen phosphorylase related to cold tolerance traits according to claim 1, characterized in that: The reaction procedure for the PCR amplification includes the following steps: S1. Pre-denature at 94 °C for 3 min; S2. Denature at 94 °C for 30 s, anneal at 60 °C for 30 s, extend at 72 °C for 45 s, and perform 35 cycles; S3. Extend at 72 °C for 10 min.

Images