Adeno-associated virus mutant and its application

Abstract

The present invention belongs to the field of biomedicine technology, and discloses an adeno-associated virus mutant and its application. The amino acid sequence of the AAV6 capsid protein mutant of the present invention is shown in SEQ ID No.33. The AAV6 capsid protein mutant of the present invention does not need to be integrated into the genome, and the recombinant adeno-associated virus constructed specifically infects activated T cells, which can achieve rapid infection and reinfusion, and reduce unnecessary quality inspection and in vitro residence time. The preparation method of the high-yield AAV6 capsid protein mutant virus library of the present invention uses an AAV2-based Rep‑Cap inactivated mutant vector instead of an AAV6-based Rep‑Cap inactivated mutant vector for virus packaging, and the yield is increased by more than 10 times, and has the advantages of high abundance and good uniformity of each mutant.

Description

[0001] This invention patent application is a divisional application based on Chinese patent application No. 202311217358.5, filed on September 20, 2023, with the invention name “Adeno-associated virus mutants and their applications”. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant and an application thereof. Background Art

[0003] Adeno-associated virus (AAV) is a non-pathogenic defective virus composed of a single-stranded DNA fragment of about 4.7kb. The AAV genome is contained in a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames and terminal inverted repeat sequences. Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. As an important gene vector, it is widely used in gene function research and gene therapy due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance and stable physical properties. Different serotypes have different specific tropisms for tissues and cells, and the transfection efficiency varies.

[0004] Tumor immunotherapy specifically identifies and eliminates tumor cells by activating the body's own immune system or enhancing the body's anti-tumor immune response. Because of its small side effects and rapid onset, it has become the current development direction in the field of tumor treatment. With the in-depth research on tumor immunotherapy in recent years, various types of therapies have shown good efficacy in refractory recurrent tumors, such as antibody-drug conjugates, dual-targeted antibodies, CAR-T therapy and TCR-T therapy. T cells play an important role in inhibiting tumor growth and clearing tumor lesions. Related studies on immune checkpoint inhibitors and tumor-infiltrating lymphocytes have shown the potential of T cells in treating cancer. However, the effect of T cells in treatment is limited by tumor specificity and the number of effector cells, and any local immunosuppressive factors need to be overcome. Therefore, the development of a viral vector that is highly targeted to T cells and does not affect T cell activity has great clinical value and commercial significance. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides an AAV6 capsid protein mutant, comprising a heterologous peptide; the amino acid sequence of the heterologous peptide is shown in any one of SEQ ID No.1 to SEQ ID No.11; the insertion site of the heterologous peptide is located between amino acids 588 and 589 of the AAV capsid protein.

[0008] The AAV6 capsid protein mutant of the present invention does not need to be integrated into the genome, and the recombinant adeno-associated virus constructed specifically infects activated T cells, which can achieve rapid infection and reinfusion, reducing unnecessary quality inspection and in vitro residence time.

[0009] As a preferred embodiment of the AAV6 capsid protein mutant described in the present invention, its amino acid sequence is shown in any one of SEQ ID No.23 to SEQ ID No.33.

[0010] In a second aspect, the present invention provides a nucleic acid encoding an AAV6 capsid protein mutant, comprising a heterologous peptide; the nucleotide sequence of the heterologous peptide is shown in any one of SEQ ID No.12 to SEQ ID No.22.

[0011] As a preferred embodiment of the nucleic acid described in the present invention, its nucleotide sequence is shown in any one of SEQ ID No.34 to SEQ ID No.44.

[0012] In a third aspect, the present invention provides a recombinant adeno-associated virus, including the AAV6 capsid protein mutant. The adeno-associated virus mutant has the advantages of low dose, strong infectivity and good safety in its ability to infect resting T cells specifically. Infection of unactivated T cells can achieve the advantages of collecting cells and infecting them on the same day, and reinfusing them on the same day, which greatly reduces the preparation cost and can reduce the impact on T cell activity.

[0013] As a preferred embodiment of the recombinant adeno-associated virus described in the present invention, it also includes a heterologous target gene; the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

[0014] In a fourth aspect, the present invention uses the AAV6 capsid protein mutant and the recombinant adeno-associated virus in the preparation of a drug for delivering gene products to cells of a subject or in the preparation of a tumor immunotherapy drug.

[0015] Preferably, the cells are immune cells.

[0016] Preferably, the immunotherapy comprises CAR-T therapy or TCR-T therapy.

[0017] In a fifth aspect, the present invention uses the AAV6 capsid protein mutant and the recombinant adeno-associated virus to infect resting T cells.

[0018] In a sixth aspect, the present invention provides a method for preparing a high-yield AAV6 capsid protein mutant virus library, comprising the following steps:

[0019] (1) constructing an AAV6 backbone vector; the AAV6 backbone vector comprises a CAG promoter, an Intron, a mutant AAV6CAP sequence and polyA; the mutant AAV6 CAP sequence comprises a sequence after T589 of the AAV6CAP sequence is removed and a sequence of T at N583 and the front segment of polyA constitutes a site for subsequent enzyme cutting of the backbone;

[0020] (2) constructing an AAV2 mutant Rep-CAP vector; introducing a stop codon within the first 20 bp of the VP1, VP2, and VP3 start codons of the CAP sequence in the AAV2 mutant Rep-CAP vector;

[0021] (3) using a vector containing AAV6 CAP as a template, using primers to amplify PCR to obtain a nucleic acid fragment containing a random sequence; connecting the nucleic acid fragment into the AAV6 library backbone vector by Gibson homologous recombination connection; obtaining an AAV6 random peptide vector library;

[0022] (4) The AAV2 mutant Rep-Cap plasmid, the AAV6 random peptide vector library, and the pHelper plasmid are co-transfected into cells, and the adeno-associated virus is purified to obtain a high-yield AAV6 capsid protein mutant virus library.

[0023] When preparing the AAV6 mutant virus library, the present invention uses an AAV2-based Rep-Cap inactivated mutant vector instead of an AAV6-based Rep-Cap inactivated mutant vector for virus packaging. Quantitative results show that when the AAV6 virus library is packaged using an AAV2-based Rep-Cap inactivated mutant vector, the yield is increased by more than 10 times, and has the advantages of high abundance and good uniformity of each mutant. The sequencing results did not find the presence of AAV6 and AAV2 Cap recombination sequences in the AAV6 virus library prepared using an AAV2-based Rep-Cap inactivated mutant vector.

[0024] As a preferred embodiment of the preparation method of the present invention, the primer is:

[0025] GGGACTGTGGCAGTCAATCTCCAGAGCAGCAGCNNKNNKNNKNNKNNKNNKNNKACAGACCCTGCGACCGGAGAT and / or

[0026] CGGTTTATTGATTAACAATCGATTACAGGGGACGGGTGAGGTAAC.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant screened by the present invention has high efficiency in targeting T cells, and has the advantages of low dosage, strong infectivity and good safety. The AAV capsid protein mutant screened by the present invention does not need to be integrated into the genome, and the constructed recombinant adeno-associated virus can infect resting T cells to achieve rapid infection and reinfusion, reducing unnecessary quality inspection and in vitro residence time. The use of the AAV capsid protein mutant screened by the present invention to infect resting T cells has great clinical value and commercial application scenarios.

[0029] When preparing the AAV6 mutant virus library, the present invention uses an AAV2-based Rep-Cap inactivated mutant vector instead of an AAV6-based Rep-Cap inactivated mutant vector for virus packaging. Quantitative results show that when the AAV6 virus library is packaged using an AAV2-based Rep-Cap inactivated mutant vector, the yield is increased by more than 10 times, and has the advantages of high abundance and good uniformity of each mutant. The sequencing results did not find the presence of AAV6 and AAV2 Cap recombination sequences in the AAV6 virus library prepared using an AAV2-based Rep-Cap inactivated mutant vector. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The fluorescence microscopy was used to detect the eGFP fluorescence intensity of resting T cells infected with different rAAV virions (72 h); A is blank, B is rAAV6 virus at MOI 10 4 Resting T cells were infected under the conditions of rAAV6 virus at MOI 10 5 Resting T cells were infected under the conditions of 1:1, D~N were AAV6 capsid protein mutant viruses a~k at MOI 10 4 Infect resting T cells under these conditions.

[0031] Figure 2 This is a histogram of eGFP fluorescence expression detected by flow cytometry after resting T cells were infected with different rAAV viruses for 72 hours; A is blank, B is rAAV6 virus at MOI 10 4 Resting T cells were infected under the conditions of rAAV6 virus at MOI 10 5 Resting T cells were infected under the conditions of 1:1, D~N were AAV6 capsid protein mutant viruses a~k at MOI 10 4 Infect resting T cells under these conditions.

[0032] Figure 3 The results are as follows: Statistical results of eGFP fluorescence expression in resting T cells 72 hours after infection with different rAAV virions by flow cytometry; A is a bar graph showing the proportion of cells expressing eGFP protein to total cells; and B is a bar graph showing the average fluorescence intensity of eGFP under various infection conditions.

[0033] Figure 4 RT-qPCR was used to detect the relative intensity of eGFP mRNA in resting T cells 72 hours after infection with different rAAV6 capsid protein mutant viruses.

[0034] Figure 5 The luciferase activity assay was used to detect the infectivity of different rAAV virions on resting T cells 96 hours after infection. DETAILED DESCRIPTION

[0035] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0036] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials and reagents used, unless otherwise specified, can be obtained from commercial sources. The GenBank accession number of AAV6 VP1 is AF028704.1.

[0037] Example 1: Screening for AAV6 mutants that effectively infect unactivated T cells

[0038] (1) Construction of AAV6 library backbone vector

[0039] The AAV6 library backbone vector contains CAG promoter, Intron, mutated AAV6 CAP sequence [the sequence after T589 of the AAV6CAP sequence is removed, and the T at N583 and the sequence in front of polyA constitute the site BsrG I (TGTACA) for subsequent enzyme cleavage of the backbone] and poly A. The above sequence is synthesized by gene synthesis and inserted between the ITRs of the rAAV vector to form the AAV6 library backbone vector.

[0040] (2) Construction of mutant Rep-CAP vector

[0041] By introducing a stop codon within the first 20 bp of the VP1, VP2, and VP3 start codons of the CAP sequence in AAV2 (NCBI Reference Sequence: NC_001401.2), the Rep-CAP inactivation mutant vector based on AAV2 expresses Rep protein, but cannot express VP1, VP2, and VP3 proteins of the CAP of AAV2, thereby avoiding contamination of the CAP sequence in the parent AAV2 (plasmid number: D#YJ119). By introducing a stop codon within the first 20 bp of the VP1, VP2, and VP3 start codons of the CAP sequence in AAV6 (GenBank: AF028704.1), the Rep-CAP inactivation mutant vector based on AAV6 expresses Rep protein, but cannot express VP1, VP2, and VP3 proteins of the CAP of AAV6 (plasmid number: D#YJ077). The above sequence was synthesized by gene synthesis and inserted to replace the CAP sequence of the Rep-CAP vector.

[0042] (3) Construction of random 7-peptide vector library

[0043] Two primers were designed (the insertion site was located between S588 and T589 of AAV6, the upstream primer targeted the nucleic acid sequence after T589 of the template, and the downstream primer targeted the terminal sequence of CAP). The 5' ends of the upstream and downstream primers both had homology arm sequences of more than 15 bp consistent with the backbone. In addition, the upstream primer introduced a 21 bp nucleic acid sequence (7*NNK) between the homology arm sequence and the targeting sequence to introduce a random 7-peptide into the CAP sequence.

[0044] The base sequences of the two primers (5'->3') are as follows:

[0045] V6-7P-F:

[0046] GGGACTGTGGCAGTCAATCTCCAGAGCAGCAGCNNKNNKNNKNNKNNKNNKNNKACAGACCCTGCGACCGGAGAT;

[0047] V6-Stop-R:

[0048] CGGTTTATTGATTAACAATCGATTACAGGGGACGGGTGAGGTAAC.

[0049] Using the vector containing AAV6 CAP as a template, the above primers were used to amplify the fragment containing the random sequence by PCR. The fragment was subjected to gel electrophoresis and gel recovery to obtain the purified nucleic acid fragment of the random 7-peptide library; the nucleic acid fragment was connected to the AAV6 library backbone vector (after BsrG I restriction enzyme digestion and gel recovery purification) by Gibson homologous recombination connection; the connected vector was purified by a PCR product purification kit and digested with Plasmid-Safe DNase enzyme to remove the unconnected fragments; finally, it was purified by a PCR product purification kit to obtain the constructed AAV6 vector library.

[0050] (4) Construction of AAV6 mutant virus library

[0051] The mutant Rep-Cap plasmid, AAV6 vector library, and pHelper plasmid were co-transfected into HEK-293T cells, and the adeno-associated virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured at 1×10 12 GC / mL~1×10 13 GC / mL is the appropriate titer, and the AAV6 mutant virus library is obtained and placed at -80°C for future use.

[0052] When the AAV virus library is prepared using the traditional method, the production capacity of the AAV6 mutant library is very low compared to many other AAV serotypes, and the output per dish is between 2E7 and 4E8, which is difficult to meet normal screening needs. There are disadvantages such as high preparation cost, poor uniformity and coverage compared to other serotypes. In order to reduce the deviation caused by the error in the preparation of the virus library when screening new serotypes, the present invention first focuses on optimizing the preparation of the AAV6 mutant virus library.

[0053] Virus packaging tests were performed using an AAV2-based Rep-Cap inactivated mutant vector and compared with an AAV6-based Rep-Cap inactivated mutant vector.

[0054] The three plasmids were matched according to the transfection ratio required for the production of the AAV mutant library, and the virus packaging was performed at the same production scale. The comparison results are shown in Table 1:

[0055] Table 1 Comparison results

[0056] Production number Production system using RC plasmid Lysate titer (GC / mL) RM392 AAV2-based Rep-Cap inactivation mutation vector (plasmid number: D#YJ119) 1.44E+10 RM394 AAV6-based Rep-Cap inactivation mutation vector (plasmid number: D#YJ077) 4.24E+08

[0057] When preparing the AAV6 mutant virus library, the present invention uses an AAV2-based Rep-Cap inactivated mutant vector instead of an AAV6-based Rep-Cap inactivated mutant vector for virus packaging. Quantitative results show that when the AAV6 virus library is packaged in parallel using an AAV2-based Rep-Cap inactivated mutant vector, the yield is nearly 100 times higher than that of the group using an AAV6-based Rep-Cap inactivated mutant vector. Sequencing results did not find the presence of AAV6 and AAV2 Cap recombination sequences in the AAV6 virus library prepared using an AAV2-based Rep-Cap inactivated mutant vector.

[0058] (5) T cell screening of AAV6 mutants

[0059] 1) T cell recovery and AAV infection

[0060] RPMI 1640 medium was preheated at 37°C; frozen CD3 + T cells were thawed quickly; the revived cells were aspirated into a 50 mL centrifuge tube, 15 mL of RPMI 1640 medium containing 1% P / S and 10% FBS was added, and the cells were centrifuged at 300 g for 10 min to 15 min; the cells were resuspended in 1 mL of RPMI 1640 medium containing 1% P / S and 10% FBS, and the cells were counted (trypan blue staining, counting the total number of cells and the number of dead cells); 5×10 5 Cell suspension; 5×10 per well 9 AAV6 mutant virus library was added at a dose of GC to infect unactivated T cells. After 2 hours of infection, rhIL-2 was added to each well at a final concentration of 50 U / mL, and the mixture was gently pipetted and mixed. After 2 hours, CD3 / CD28 T cell activator was added to each well at a final concentration of 25 μL / mL, and the mixture was gently pipetted and mixed, and the cells were cultured in a cell culture incubator for 48 hours (37°C, 5% CO 2 ).

[0061] 2) Total RNA extraction and RT-PCR

[0062] The cells were aspirated into a 1.5 mL centrifuge tube and centrifuged at 300 g for 10 minutes to collect the cells and remove the supernatant. The RNA extraction method was in accordance with the instructions of TransZol Up Plus RNA Kit (Full Form Gold, ER501). The RNA samples were extracted using PrimeScript TMIV1st strand cDNA Synthesis Mix (Takara, 6215A) was used to synthesize the first strand cDNA. Subsequently, two rounds of PCR amplification were performed using NEBQ5. The first round of amplification used outer primers, and the second round used the first round product recovered from the gel as a template, or NGS primers were used for amplification, and the PCR product of the corresponding band size was recovered from the gel and sent to the company for NGS sequencing; or library construction primers were used for amplification and gel recovery, and the sub-vector library was constructed, packaged, and screened according to the above process. AAV capsid protein mutants a to k were screened out, and the amino acid sequences of their VP1 were shown in SEQ ID No.23 to SEQ ID No.33, and the nucleotide sequences were shown in SEQ ID No.34 to SEQ ID No.44, respectively; the amino acid sequences of the targeting peptides in VP1 were shown in SEQ ID No.1 to SEQ ID No.11, and the nucleotide sequences were shown in SEQ ID No.12 to SEQ ID No.22, respectively.

[0063] Example 2: Construction of AAV capsid protein mutants and virus production

[0064] Using rAAV6 as a control, AAV capsid protein mutants a to k were constructed as follows:

[0065] (1) Construction of mutant serotype vector and plasmid extraction

[0066] The Rep-CAP plasmid was double-digested with Smi I and BshT I, and the fragment band of about 5000 bp was cut out by gel electrophoresis and gel recovery to obtain the digested backbone fragment. Primers were designed according to the Cap sequences of the target mutants a to k obtained by screening to construct the plasmids of the target mutant AAV. The Rep-CAP plasmid of AAV6 was used as a template and the F1+R1 primers were used for PCR amplification to obtain the target product 1. Similarly, the Rep-CAP plasmid of AAV6 was used as a template and the F2+R2 primers were used for PCR amplification to obtain the target product 2. The backbone and the fragments, and the fragments have homology arm sequences, and the multi-fragment assembly can be performed into a complete vector by Gibson.

[0067] The primers for PCR product 1 in the construction of AAV capsid protein mutant a vector are Cap-F+FFa-R, and the primers for PCR product 2 are FFa-F+Cap-R. The primer sequences involved (5' to 3') are:

[0068] FFa-F:

[0069] TTGAGTGGGAGTGATACGAAGACAGACCCTGCGACCGGAGA;

[0070] FFa-R:

[0071] CTTCGTATCACTCCCACTCAAGCTGCTGCTCTGGAGATTGA.

[0072] The primers for PCR product 1 in the construction of AAV capsid protein mutant b vector are Cap-F+FFb-R, and the primers for PCR product 2 are FFb-F+Cap-R. The primer sequences involved (5' to 3') are:

[0073] FFb-F:

[0074] GTGCCCGGGTTTTCCTGCTTTGACAGACCCTGCGACCGGAGA;

[0075] FFb-R:

[0076] CAAAGCAGGAAAACCCGGCACGCTGCTGCTCTGGAGATTGA.

[0077] The primers for PCR product 1 in the construction of AAV capsid protein mutant c vector are Cap-F+FFc-R, and the primers for PCR product 2 are FFc-F+Cap-R. The primer sequences involved (5' to 3') are

[0078] FFc-F:

[0079] GATACGCAGACTCAGAAGCATACAGACCCTGCGACCGGAGA;

[0080] FFc-R:

[0081] ATGCTTCTGAGTCTGCGTATCGCTGCTGCTCTGGAGATTGA.

[0082] In the construction of AAV capsid protein mutant d vector, the primers for PCR product 1 are Cap-F+FFd-R, and the primers for PCR product 2 are FFd-F+Cap-R. The primer sequences involved (5' to 3') are

[0083] FFd-F:

[0084] GATACGCAGAATCAGAAGCATACAGACCCTGCGACCGGAGA;

[0085] FFd-R:

[0086] ATGCTTCTGATTCTGCGTATCGCTGCTGCTCTGGAGATTGA.

[0087] The primers for PCR product 1 in the construction of AAV capsid protein mutant e vector are Cap-F+FFe-R, and the primers for PCR product 2 are FFe-F+Cap-R. The primer sequences involved (5' to 3') are

[0088] FFe-F:

[0089] CATGATTCTTCTCCTAAGGCTACAGACCCTGCGACCGGAGA;

[0090] FFe-R:

[0091] AGCCTTAGGAAGAATCATGGCTGCTGCTCTGGAGATTG.

[0092] The primers for PCR product 1 in the construction of AAV capsid protein mutant f vector are Cap-F+FFf-R, and the primers for PCR product 2 are FFf-F+Cap-R. The primer sequences involved (5' to 3') are

[0093] FFf-F:

[0094] GAGGGGCCTCGGTCTCTGGAGACAGACCCTGCGACCGGAG;

[0095] FFf-R:

[0096] CTCCAGAGACCGAGGCCCCTCGCTGCTGCTCTGGAGATTG.

[0097] The primers for PCR product 1 in the construction of AAV capsid protein mutant g vector are Cap-F+FFg-R, and the primers for PCR product 2 are FFg-F+Cap-R. The primer sequences involved (5' to 3') are

[0098] FFg-F:

[0099] GCGGGTGGTAGTTCTGCGGAGACAGACCCTGCGACCGGAG;

[0100] FFg-R:

[0101] CTCCGCAGAACTACCACCCGCGCTGCTGCTCTGGAGATTG.

[0102] The primers for PCR product 1 in the construction of AAV capsid protein mutant h vector are Cap-F+FFh-R, and the primers for PCR product 2 are FFh-F+Cap-R. The primer sequences involved (5' to 3') are

[0103] FFh-F:

[0104] GATACGCAGAATAAGAAGCATACAGACCCTGCGACCGGAG;

[0105] FFh-R:

[0106] ATGCTTCTTATTCTGCGTATCGCTGCTGCTCTGGAGATTG.

[0107] In the construction of AAV capsid protein mutant i vector, the primers for PCR product 1 are Cap-F+FFi-R, and the primers for PCR product 2 are FFi-F+Cap-R. The primer sequences involved (5' to 3') are

[0108] FFi-F:

[0109] GATAGTCCTAATAAGAAGAATACAGACCCTGCGACCGGAG;

[0110] FFi-R:

[0111] ATTCTTCTTATTAGGACTATCGCTGCTGCTCTGGAGATTG.

[0112] The primers for PCR product 1 in the construction of AAV capsid protein mutant j vector are Cap-F+FFj-R, and the primers for PCR product 2 are FFj-F+Cap-R. The primer sequences involved (5' to 3') are

[0113] FFj-F:

[0114] GAGGTTGGGGTGCAGCCTTATACAGACCCTGCGACCGGAG;

[0115] FFj-R:

[0116] ATAAGGCTGCACCCCAACCTCGCTGCTGCTCTGGAGATTG.

[0117] The primers for PCR product 1 in the construction of AAV capsid protein mutant k vector are Cap-F+FFk-R, and the primers for PCR product 2 are FFk-F+Cap-R. The primer sequences involved (5' to 3') are

[0118] FFk-F:

[0119] GGTAATTCTGCTTCTAAGGATACAGACCCTGCGACCGGAG;

[0120] FFk-R:

[0121] ATCCTTAGAAGCAGAATTACCGCTGCTGCTCTGGAGATTG.

[0122] The sequences of the primers Cap-F and Cap-R involved in the construction of the above-mentioned AAV capsid protein mutant ak vector are:

[0123] Cap-F:

[0124] GCATCTTTGAACAATAAATGATTTAAATCAGGTATGG;

[0125] Cap-R:

[0126] GTTCAACTGAAACGAATCAATTTATTGATTAACAGGCAATTACAGG.

[0127] Take a clean 200μL PCR tube, mark it and place it on an ice box. Prepare the reaction solution with the above enzyme-cut backbone, target fragment 1 and target fragment 2 at a backbone: fragment molar ratio of 1:3, and react in a PCR instrument at 50℃ for 30min for recombination connection. Take 50μL competent cells and thaw them on ice. Mix 10μL of the connection product with DH5α competent cells and place them on ice for 20min-30min; heat shock at 42℃ for 45 seconds; quickly place them on ice for 2min, add 400μL of recovery SOC medium (without antibiotics), and culture at 37℃ and 200rpm for 1h; evenly apply it on Amp resistance plate (50μg / ml) and culture at 32℃ for 18 hours. Select monoclonal bacteria, expand the culture in 4ml liquid LB medium (Amp+ resistance), and culture at 32℃ for 18 hours.

[0128] The bacterial solution was centrifuged at 12000rpm for 1 minute, and the supernatant medium was discarded; 250μL of buffer P1 / RNaseA mixture was added, and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added, and the tube was inverted 8 to 10 times; 350μL of buffer was added P3, immediately invert and mix 8-10 times to completely neutralize the solution; centrifuge at 13000rpm for 10 minutes, take the supernatant and pass it through the column; centrifuge at 12000rpm for 1 minute, discard the waste liquid, add 500μL of PW1, centrifuge at 12000rpm for 1 minute, discard the waste liquid; add 600μL of PW2, centrifuge at 12000rpm for 1 minute, discard the supernatant; add 600μL of PW2, centrifuge at 12000rpm for 1 minute, discard the supernatant; idle at 12000rpm for 2 minutes; add 30μL-50μL of 55℃ preheated eluent, let it stand for 2 minutes, and centrifuge at 12000rpm for 1 minute. Use a micro-nucleic acid quantifier for concentration detection.

[0129] The obtained plasmid was tested for concentration, and 10 μL of the positive plasmid identified by enzyme digestion was sent for sequencing, and the positive plasmid was stored at -20°C. The sequencing results showed that the obtained plasmid could encode the variant capsid protein VP1. Finally, according to the amount of virus required for the later test, the relevant Helper plasmid, each group of Rep-Cap plasmid (AAV6, AAV6 mutant a~k) plasmid and GOI plasmid (including scAAV, CAG, eGFP, WPREs, SV40pA) were extracted.

[0130] (2) Packaging and purification of mutant serotype viruses

[0131] The Rep-Cap plasmids, plasmids expressing green fluorescent protein (eGFP) or firefly luciferase, and pHelper plasmids of each group (AAV6 wild type and AAV6 capsid protein mutant) were co-transfected into HEK-293T cells in appropriate amounts, and the AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured at 1×10 12 GC / mL~1×10 13 GC / mL is the appropriate titer, and the control AAV6 wild-type virus, AAV6 capsid protein mutant 1 (described in patent application publication number CN115838399A) and AAV6 capsid protein mutant viruses a~k are obtained and placed at -80°C for use.

[0132] Example 3: Comparative detection of various indicators of resting T cells infected with mutant serotypes

[0133] (1) AAV infection of T cells and cell culture

[0134] The groups were set up: control AAV6 virus, reference AAV6 capsid protein mutant 1 (described in patent application publication number CN115838399A), and AAV6 capsid protein mutant viruses a to k.

[0135] RPMI 1640 medium was preheated at 37°C; frozen CD3 + T cells were thawed quickly; the revived cells were aspirated into a 50 mL centrifuge tube, 15 mL of RPMI 1640 medium containing 1% P / S and 10% FBS was added, and the cells were centrifuged at 300 g for 10 min to 15 min; the cells were resuspended in 1 mL of RPMI 1640 medium containing 1% P / S and 10% FBS, and the cells were counted (trypan blue staining, counting the total number of cells and the number of dead cells); according to the cell counting results, the cell density was adjusted to 1×10 6 cells / mL; according to the experimental group, 500 μL of cell suspension (cell number 5×10 5 cells / well), or add 100 μL of cell suspension (cell number 1×10 5 cells / well); each group was infected with T cells at MOI: 1E4 (the control AAV6 high-dose group MOI was 1E5). 4 hours after infection, rhIL-2 was added to each well at a final concentration of 50U / mL, and the mixture was gently pipetted. 2 hours later, CD3 / CD28 T cell activator was added to each well at a final concentration of 25μL / mL, and the mixture was gently pipetted and placed in a cell culture incubator (37°C, 5% CO 2 ).

[0136] (2) Fluorescence observation

[0137] At 72 h, fluorescence images of each group of T cells were taken using a fluorescence microscope (the photography parameters and exposure time remained the same).

[0138] (3) Detection of target mRNA expression level

[0139] 1) Total RNA extraction:

[0140] Each group of cells was aspirated into a 1.5 mL centrifuge tube, centrifuged at 300 g for 15 min to collect the cells, and then the liquid was aspirated. The RNA extraction method was in accordance with the instructions of TransZol Up Plus RNA Kit (Full Gold, ER501). 300 μl of TranZol up was added to each tube of cells, and 60 μL of chloroform was added. The tube was shaken vigorously for 30 s and incubated at room temperature for 3 min; centrifuged at 12,000 g and 4 ° C for 10 min. Transfer the colorless aqueous phase to a new 1.5ml RNase-free EP tube, add an equal volume of anhydrous ethanol, and gently invert to mix; add the obtained solution and precipitate to the centrifuge column, centrifuge at 12,000g for 30s at room temperature, and discard the filtrate; add 500μL CB9, centrifuge at 12,000g for 30s at room temperature, and discard the filtrate; repeat once; add 500μL WB9, centrifuge at 12,000g for 30s at room temperature, and discard the filtrate; repeat once; centrifuge at 12,000g for 2min to completely remove residual ethanol; place the centrifuge column in a 1.5ml RNase-free EP tube, add 50μL RNase-free Water in the center of the centrifuge column, and let it stand at room temperature for 1min; centrifuge at 12,000g for 1min at room temperature to elute RNA; use a micro-nucleic acid quantifier detector to detect the sample RNA concentration, measure the RNA concentration, OD260 / 280, and OD260 / 230, and store the extracted RNA at -80℃. Each RNA sample was used The first-strand cDNA was synthesized using III RT SuperMix for qPCR (+gDNA wiper) (Novozyme, R323).

[0141] 2) Quantitative PCR (qPCR) experiments

[0142] Each group of cDNA was used as a template, and the qPCR system was configured according to the instructions of 2×SYBR Green qPCR Master Mix (Bimake, B212203), as shown in Table 2:

[0143] Table 2 qPCR system

[0144] Reagents Usage 2×SYBR Green qPCR Master Mix 10μL template 1μL Upstream primer 0.5μL Downstream primer 0.5μL ROX Reference Dye 0.4μL Deionized water Up to 20μL

[0145] The primer sequences (5'->3') are as follows:

[0146] EGFP-Tf:GCTGGAGTACAACTACAAC;

[0147] EGFP-Tr:TGGCGGATCTTGAAGTTC;

[0148] GAPDH101-F:CTGGGCTACACTGAGCACC;

[0149] GAPDH101-R:AAGTGGTCGTTGAGGGCAATG.

[0150] The qPCR program settings are shown in Table 3:

[0151] Table 3 qPCR program

[0152]

[0153] According to the Ct value of each group, the relative expression was calculated according to the formula 2^-ΔΔct.

[0154] (4) Flow cytometry

[0155] Collect the T cells of each group cultured for 72 hours: collect the cells and supernatant of each well into a 1.5mL EP tube, centrifuge at 300g for 12 minutes, and remove the supernatant. Repeat the washing once, remove the supernatant, add 500μL PBS to resuspend, and blow it into a single cell suspension with a pipette tip, and place it on ice for upflow detection.

[0156] (5) Firefly luciferase activity detection

[0157] The T cells of each group cultured for 96 h were transferred to a 96-well plate for luciferase detection, and an equal volume of room temperature Bright-Lumi TM II Firefly luciferase reporter gene detection reagent (Biyuntian RG052), incubate at room temperature for 5 minutes. Chemiluminescence detection was performed using a multifunctional microplate reader with chemiluminescence detection function.

[0158] The results of AAV capsid protein mutant virus a~k infection of resting T cells showed that each capsid protein mutant virus had a higher eGFP fluorescence expression intensity than the rAAV6 control virus 72 hours after infection. Among them, the difference between capsid protein mutant virus j and rAAV6 control virus was the most obvious ( Figures 1 to 5 ). Flow cytometric analysis showed that compared with the rAAV6 control virus, the capsid protein mutant viruses a~k all had stronger resting T cell infection ability. After AAV capsid protein mutant ak infected T cells, the percentage of cells expressing eGFP fluorescence in the total cells increased by 2.65 to 11.8 times compared with the control rAAV6 virus ( Figure 2 and Figure 3 Compared with the rAAV6 control virus, the average fluorescence intensity of eGFP in T cells infected with AAV capsid protein mutants a-k increased by 1.4 to 12.1 times ( Figure 3). RT-qPCR studies showed that at the same MOI, capsid protein mutant viruses a~k had a 5.4- to 19-fold increase in target gene mRNA expression compared to the rAAV6 control virus ( Figure 4 ). It is worth mentioning that the capsid protein mutant viruses j and k achieved infection of resting T cells close to or exceeding the control virus rAAV6 at MOI: 1E5 at MOI: 1E4. The performance of capsid protein mutant j was particularly excellent. When infecting resting T cells at MOI: 1E4, the proportion of cells expressing eGFP green fluorescence and the average fluorescence intensity of eGFP reached about twice that of the control rAAV6 virus infecting resting T cells at MOI: 1E5. Even under the condition of reducing the infection rate by 10 times, there is still a stronger target gene expression intensity.

[0159] Secondly, the luciferase activity of T cell lysates after infection was detected and it was found that the capsid protein mutant viruses a~k had higher luciferase activity in T cells 96h after infection compared with the rAAV6 control virus ( Figure 5 ). This indicates that the AAV capsid protein mutant of the present invention has a better infection effect on resting T cells.

[0160] The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant obtained by screening the present invention has high efficiency in targeting resting T cells, and has the advantages of low dose, strong infectivity and good safety. Compared with the infection after activation by stimulating factors (48h) in the prior art, the infection of resting T cells can achieve the advantages of collecting cells on the same day, infection on the same day, and reinfusion on the same day, which greatly reduces the preparation cost. In addition, the infection of unactivated T cells reduces the cumbersome operation and processing time of in vitro culture, which can greatly reduce the impact on T cell activity. Compared with the shortcomings of lentiviral vectors, which have the risk of genomic integration carcinogenesis and the relatively low efficiency of infecting unactivated T cells, the AAV capsid protein mutants obtained by screening the present invention do not need to integrate the genome, greatly improve the infectivity of resting T cells, can achieve rapid infection and reinfusion, and reduce unnecessary quality inspection and in vitro residence time. In short, the use of the AAV capsid protein mutants obtained by screening the present invention to infect resting T cells has great clinical value and commercial application scenarios.

[0161] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. An AAV6 capsid protein mutant, characterized in that: Its amino acid sequence is shown in SEQ ID No.

33.

2. A nucleic acid encoding an AAV6 capsid protein mutant, characterized in that: Its nucleotide sequence is shown in SEQ ID No.

44.

3. A recombinant adeno-associated virus, characterized in that: Including the AAV6 capsid protein mutant described in claim 1.

4. The recombinant adeno-associated virus according to claim 3, characterized in that It also includes a heterologous target gene; the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

5. Use of the AAV6 capsid protein mutant according to claim 1 or the recombinant adeno-associated virus according to claim 3 or 4 in the preparation of a drug for delivering gene products to resting T cells.

6. Use of the AAV6 capsid protein mutant described in claim 1 and the recombinant adeno-associated virus described in claim 3 or 4 in infecting resting T cells for non-disease diagnosis and treatment purposes.

Images