Detection primers and application of Relish-SSR molecular markers related to resistance to Vibrio parahaemolyticus in whiteleg shrimp

By detecting continuous glutamine repeat sequences in the Relish gene of whiteleg shrimp and designing Relish-SSR molecular marker detection primers, the problem of identifying the resistance of whiteleg shrimp to Vibrio parahaemolyticus was solved, efficient screening and breeding were achieved, and the efficiency of selecting and breeding disease-resistant shrimp was improved.

CN118516469BActive Publication Date: 2025-09-30SUN YAT SEN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410698920.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2025-09-30
Estimated Expiration
2044-05-31

AI Technical Summary

Technical Problem

The existing technology lacks effective SSR molecular markers related to the resistance of whiteleg shrimp to Vibrio parahaemolyticus, which makes it difficult to efficiently screen and breed shrimp varieties with strong disease resistance, affecting the sustainable development of the aquaculture industry.

Method used

By detecting continuous glutamine repeat sequences (microsatellites) in the cds region of the Relish gene of white shrimp (Penaeus vannamei), the corresponding detection primers Relish-SSR-F and Relish-SSR-R were designed for PCR amplification and fluorescence electrophoresis detection, and the allelic type of the Relish-SSR molecular marker was identified to screen and identify the resistance to Vibrio parahaemolyticus.

Benefits of technology

The accurate identification and screening of the resistance to Vibrio parahaemolyticus of whiteleg shrimp has been achieved, which improves the accuracy and efficiency of breeding and shortens the breeding cycle. It has the advantages of low cost, simplicity and high efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118516469B_ABST
    Figure CN118516469B_ABST
Patent Text Reader

Abstract

The present invention discloses detection primers for Relish-SSR molecular markers related to the resistance of whiteleg shrimp to Vibrio parahaemolyticus and their applications. The present invention discovered a continuous glutamine repeat sequence (microsatellite) with polymorphism in the Relish gene of whiteleg shrimp, the polymorphism of which affects the polyglutamine structure encoded by the Relish gene, and can affect the anti-Vibrio parahaemolyticus trait of shrimp by regulating the expression of downstream antimicrobial peptides, that is, the present invention obtains a Relish-SSR molecular marker related to the anti-Vibrio parahaemolyticus shape of whiteleg shrimp. On the basis of the molecular marker, the present invention also provides corresponding detection primers, etc., which can be used for the identification of the anti-Vibrio parahaemolyticus trait of whiteleg shrimp or the screening of whiteleg shrimp with high resistance to Vibrio parahaemolyticus. The SSR molecular markers described in the present invention can also be used for population genetic structure analysis and molecular marker-assisted breeding, which is beneficial to the breeding of disease-resistant varieties of whiteleg shrimp.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetics technology, and more specifically relates to detection primers for Relish-SSR molecular markers related to resistance to Vibrio parahaemolyticus in white shrimp and applications thereof. Background Art

[0002] Shrimp, an arthropod of the genus Penaeus, family Penaeidae, order Decapoda, are a major aquaculture species in my country. Among them, the whiteleg shrimp (Litopenaeus vannamei) is the single most valuable species (FAO, 2020). my country is the world's largest shrimp aquaculture country, with production exceeding 2.09 million tons in 2022 (2023 Fisheries Statistical Yearbook). Diseases are a major bottleneck limiting the sustainable development of the shrimp aquaculture industry. In 2021, direct economic losses from diseases to the whiteleg shrimp aquaculture industry reached 5.7 billion yuan (2022 China Aquatic Animal Health Status Report).

[0003] Acute hepatopancreatic necrosis (AHPND), caused by pathogens such as Vibrio parahaemolyticus carrying the PirA / PirB virulence genes, is a major threat to the shrimp aquaculture industry. The disease has a mortality rate of 40% to 100%. Affected shrimp exhibit symptoms such as slow growth, whitish and atrophic hepatopancreas, an empty jejunum, and reduced motility, leading to a significant decrease in shrimp production. Breeding shrimp varieties with strong disease resistance is one of the key approaches to combating this disease.

[0004] Identifying key genes, molecular markers, or genetic elements associated with disease resistance is fundamental to modern biological breeding, improving selection accuracy and shortening breeding cycles. Microsatellites, also known as simple sequence repeats (SSRs) or short tandem repeats (STRs), are a type of tandemly repeated DNA sequence consisting of 1 to 6 nucleotides. They are widely used in the genetic structure of animal populations and have advantages such as high polymorphism, good reproducibility, genetic stability, and codominance. Currently, no SSR or STR molecular markers associated with Vibrio parahaemolyticus resistance in whiteleg shrimp have been reported. Furthermore, molecular markers such as SSRs are randomly distributed throughout the genome, not evenly distributed across every gene. Finding SSRs and other molecular markers associated with Vibrio parahaemolyticus resistance in the complex genome is extremely difficult. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention provides a detection primer for a Relish-SSR molecular marker related to resistance to Vibrio parahaemolyticus of white shrimp and its application.

[0006] The first object of the present invention is to provide a detection primer for a Relish-SSR molecular marker related to resistance of Penaeus vannamei to Vibrio parahaemolyticus.

[0007] The second object of the present invention is to provide a detection kit for Relish-SSR molecular markers related to the resistance of whiteleg shrimp to Vibrio parahaemolyticus.

[0008] The third object of the present invention is to provide the use of the detection primer or the detection kit in identifying the anti-Vibrio parahaemolyticus trait of whiteleg shrimp.

[0009] The fourth object of the present invention is the use of the detection primer or the detection kit in the preparation of a product for identifying the anti-Vibrio parahaemolyticus trait of whiteleg shrimp.

[0010] The fifth object of the present invention is the use of the detection primer or the detection kit in screening whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0011] The sixth object of the present invention is the use of the detection primer or the detection kit in preparing a product for screening whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0012] The seventh object of the present invention is the use of the detection primer or the detection kit in molecular marker-assisted breeding of whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0013] The eighth object of the present invention is the use of the detection primer or the detection kit in the preparation of a product for molecular marker-assisted breeding of whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0014] The ninth object of the present invention is to provide a method for identifying the anti-Vibrio parahaemolyticus trait of Penaeus vannamei.

[0015] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0016] The present invention performs PCR amplification, sequencing, and allele detection on the Relish gene (LvRelish) of white shrimp germplasm with different genetic backgrounds. A continuous glutamine (Q) repeat sequence (microsatellite; SSR) is detected at the 1750-1815bp cds region of the LvRelish gene DNA sequence, and the microsatellite is detected to be polymorphic. Association analysis of the microsatellite with the anti-Vibrio parahaemolyticus trait of white shrimp reveals that its polymorphism affects the structure of the polyglutamine encoded by the LvRelish gene, affects the anti-Vibrio parahaemolyticus trait of white shrimp by regulating the expression of downstream antimicrobial peptides, and is significantly correlated with its anti-Vibrio parahaemolyticus trait. The microsatellite can be used as a molecular marker for non-destructive detection during the breeding process of white shrimp, with the advantages of simplicity, accuracy, and low cost. That is, the present invention obtains an SSR molecular marker related to the resistance to Vibrio parahaemolyticus of whiteleg shrimp, named Relish-SSR molecular marker, which is suitable for large-scale screening of whiteleg shrimp populations in breeding and identification of Relish alleles in whiteleg shrimp germplasm resources.

[0017] Based on the Relish-SSR molecular markers described in the present invention, by designing corresponding detection primers, it is possible to identify the resistance of white shrimp to Vibrio parahaemolyticus and screen for resistant shrimp. Therefore, the present invention claims protection for detection primers for the Relish-SSR molecular markers associated with resistance to Vibrio parahaemolyticus in white shrimp.

[0018] Specifically, the detection primers of the present invention are designed for the microsatellite repeat sequence at 1750-1815 bp in the cds region of the Relish gene of the white shrimp Penaeus vannamei.

[0019] Specifically, the GenBank accession number of the Relish gene is EF432734.

[0020] The microsatellite repeat sequence of the present invention is a continuous glutamine repeat sequence. The number of continuous glutamine repeats varies in different white shrimps, and the range of the number of continuous glutamine repeats is 19 to 23.

[0021] As a specific embodiment, the detection primers are Relish-SSR-F and Relish-SSR-R; the nucleotide sequence of the Relish-SSR-F is shown in SEQ ID NO.1; the nucleotide sequence of the Relish-SSR-R is shown in SEQ ID NO.2.

[0022] Specifically, the 5' end of the Relish-SSR-F is labeled with a fluorescent group.

[0023] Optionally, the fluorescent group is FAM.

[0024] Given that the detection primers or the detection kit of the present invention can be used to detect the Relish-SSR molecular marker and obtain its corresponding allele type, it is possible to identify the resistance of white shrimp to Vibrio parahaemolyticus and screen white shrimp that are resistant to Vibrio parahaemolyticus. Therefore, the present invention also claims protection for the following applications of the detection primers or the detection kit:

[0025] The present invention also claims protection for a detection kit for Relish-SSR molecular markers related to resistance of whiteleg shrimp to Vibrio parahaemolyticus, wherein the kit contains the aforementioned detection primers.

[0026] The present invention also claims protection for the use of the detection primer or the detection kit in identifying the anti-Vibrio parahaemolyticus trait of whiteleg shrimp.

[0027] The present invention also claims protection for the use of the detection primer or the detection kit in preparing a product for identifying the anti-Vibrio parahaemolyticus trait of whiteleg shrimp.

[0028] The present invention also claims protection for the use of the detection primer or the detection kit in screening whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0029] The present invention also claims protection for the use of the detection primer or the detection kit in preparing a product for screening whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0030] The present invention also seeks to protect the use of the detection primer or the detection kit in molecular marker-assisted breeding of whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0031] The present invention also seeks to protect the use of the detection primer or the detection kit in preparing a product for molecular marker-assisted breeding of whiteleg shrimp resistant to Vibrio parahaemolyticus.

[0032] The present invention also provides a method for identifying the Vibrio parahaemolyticus resistance of whiteleg shrimp, comprising the following steps:

[0033] S1. Extracting genomic DNA from the tested whiteleg shrimp sample;

[0034] S2. Using the genomic DNA obtained in step S1 as a template, PCR amplification is performed using the detection primers. If the amplified product contains a sequence encoding 20 consecutive glutamines and the allele type is homozygous, the tested whiteleg shrimp has the Vibrio parahaemolyticus resistance trait.

[0035] Specifically, when the detection primers Relish-SSR-F and Relish-SSR-R of the present invention are used for detection, if the amplification product is a single band with a length of 197 bp, it indicates that the tested whiteleg shrimp is a homozygote with an allele type of 197 bp, has a Vibrio parahaemolyticus resistance trait, and is a whiteleg shrimp with high resistance to Vibrio parahaemolyticus.

[0036] Specifically, the method for identifying the Vibrio parahaemolyticus resistance of whiteleg shrimp using the detection primers Relish-SSR-F and Relish-SSR-R of the present invention comprises the following steps:

[0037] S1. Extracting genomic DNA from the tested whiteleg shrimp sample;

[0038] S2. Using the extracted genomic DNA as a template, PCR amplification was performed using primers Relish-SSR-F and Relish-SSR-R;

[0039] S3. Detect the amplified product using capillary fluorescence electrophoresis.

[0040] In a specific embodiment of the present invention, the reaction system used for PCR amplification in step S2 is: TaKaRa Taq HS 0.15 μL, dNTP Mixture 2.4 μL, 10× PCR Buffer 2 μL, Relish-SSR-F and Relish-SSR-R primers 1 μM each, DNA template 100 ng, and ddH2O to make up to 20 μL;

[0041] In a specific embodiment of the present invention, the reaction conditions used for PCR amplification in step S2 are: denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds, 30 cycles; extension at 72°C for 5 minutes.

[0042] The present invention has the following beneficial effects:

[0043] The present invention discovered a continuous glutamine repeat sequence (microsatellite) with polymorphism in the Relish gene of whiteleg shrimp. Its polymorphism affects the polyglutamine structure encoded by the Relish gene, and can affect the anti-Vibrio parahaemolyticus trait of shrimp by regulating the expression of downstream antimicrobial peptides. That is, the present invention obtained a Relish-SSR molecular marker related to the anti-Vibrio parahaemolyticus shape of whiteleg shrimp. On the basis of the molecular marker, the present invention also provides corresponding detection primers, etc., which can be used for the identification of the anti-Vibrio parahaemolyticus trait of whiteleg shrimp or the screening of whiteleg shrimp with high resistance to Vibrio parahaemolyticus. The Relish-SSR molecular marker and its detection primer, etc. described in the present invention can also be used for population genetic structure analysis and molecular marker-assisted breeding, and have broad application prospects in the selection and breeding of disease-resistant varieties of whiteleg shrimp. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The structure of the LvRelish gene and the sequence and position of the Relish-SSR molecular marker and its corresponding detection primer.

[0045] Figure 2 These are the detection results of Relish-SSR molecular markers in whiteleg shrimp samples; Figure A shows the detection result of a homozygous individual with an allele of 197bp; Figure B shows the detection result of a heterozygous individual with an allele of 197bp and 200bp; Figure C shows the detection result of a heterozygous individual with an allele of 194bp and 200bp.

[0046] Figure 3 Figure 2 is the fluorescence quantitative PCR detection result of Relish, PEN, Lysozyme and Crustin; Figure A is the typing pattern of white shrimp resistant to Vibrio parahaemolyticus; Figure B is the fluorescence quantitative PCR detection result of Relish, PEN, Lysozyme and Crustin; in the figure, "*" p<0.05, "**" p<0.01, "***" p<0.001. DETAILED DESCRIPTION

[0047] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0048] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0049] Example 1 Obtaining SSR molecular markers of the Relish gene of white shrimp

[0050] The present invention designs corresponding PCR amplification primers based on the sequence of the Relish gene (LvRelish; GenBank accession number EF432734) of whiteleg shrimp. By PCR amplification and resequencing the Relish gene of six whiteleg shrimp germplasms with different genetic backgrounds, it is found that a repeat sequence (SSR) encoding glutamine (Q) is present at 1750 to 1815 bp in the cds region of the gene. By performing diversity amplification detection in the six whiteleg shrimp germplasms with different genetic backgrounds, the number of repeats encoding glutamine continuously in the SSR is statistically obtained, which is 19 to 23. That is, the present invention obtains a polymorphic SSR molecular marker in the Relish gene of whiteleg shrimp, which is named Relish-SSR molecular marker.

[0051] The above six types of whiteleg shrimp germplasms with different genetic backgrounds are: the new variety "Zhengxing No. 1" independently bred in my country, the OI conservation population introduced by the Hawaii Oceanographic Institute (OI), the day and night fast population of Thailand's Syaqua Company, the Saipan population introduced from Saipan Island, the United States, and the shrimp populations introduced from Mexico and Ecuador.

[0052] The nucleotide sequences of the PCR amplification primers are as follows:

[0053] Relish-SSR-F:FAM-GTGCCTTCTCCATCATATCAAGAT(SEQ ID NO.1)

[0054] Relish-SSR-R:CAGCTGTGAACCTATCTGCTG(SEQ ID NO.2)

[0055] The reaction system used for PCR amplification was as follows: TaKaRa Taq HS (5U / μL) 0.15 μL, dNTP Mixture 2.4 μL, 10× PCR Buffer 2 μL, 1 μM each of forward and reverse primers, 100 ng of DNA template, and ddH2O to make up to 20 μL.

[0056] The reaction conditions used for PCR amplification were as follows: denaturation at 95°C for 5 minutes; cycles: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 30 cycles; extension at 72°C for 5 minutes; and storage at 16°C.

[0057] The PCR amplification product was resequenced by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. After comparison, it was found that there were continuous glutamine-encoding repeat sequences (SSRs) in the cds region of the LvRelish gene (GenBank accession number: EF432734). The structure of the LvRelish gene (GenBank accession number: EF432734) and the sequence and location of the SSR and its corresponding detection primers are shown in the figure. Figure 1 shown.

[0058] Depend on Figure 1 The LvRelish gene contains four exons and three introns. The SSR is located in the first exon and contains a repeat sequence encoding continuous glutamine (Q). Polymorphism statistics have revealed five LvRelish alleles in whiteleg shrimp, with product lengths of 194, 197, 200, 203, and 206 bp, respectively, corresponding to 19 to 23 continuous glutamine repeats.

[0059] Example 2 Method for Detecting Relish-SSR Molecular Marker Allele Types

[0060] Based on the PCR amplification primers (Relish-SSR-F / Relish-SSR-R) described in Example 1, the present invention constructs a method for detecting the allele type of Relish-SSR molecular marker using the primers, comprising the following steps:

[0061] S1. Extract genomic DNA from the tested whiteleg shrimp Penaeus vannamei;

[0062] S2. Using the extracted genomic DNA as a template, PCR amplification was performed using primers Relish-SSR-F and Relish-SSR-R;

[0063] S3. Detect the amplified product using capillary fluorescence electrophoresis.

[0064] The product used for PCR amplification in step S2 is TaKaRa Taq TM HotStart Version, PCR reaction system: TaKaRa Taq HS (5U / μL) 0.15μL, dNTP Mixture 2.4μL, 10× PCR Buffer 2μL, forward and reverse primers 1μM each, DNA template 100ng, ddH2O to 20μL; PCR reaction conditions: denaturation at 95°C for 5 minutes; cycles: denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 30 cycles; extension at 72°C for 5 minutes; storage at 16°C.

[0065] Using the above method, the present invention detected the allele types of SSR molecular markers of some white shrimp samples in Example 1, and the results were as follows: Figure 2 As shown. Figure 2 It can be seen that the present invention has detected homozygous individuals with an allele type of 197bp (see Figure 2 The number of consecutive glutamines encoded by the 197 bp product is 20, that is, the number of consecutive glutamine repeats is 20), and the allele type is a heterozygous individual of 197 bp and 200 bp (see Figure 2 B), heterozygous individuals with alleles of 194bp and 200bp (see Figure 2 The above results show that the allele type of the Relish-SSR molecular marker of whiteleg shrimp can be accurately detected using the primers and method of the present invention.

[0066] Example 3 Analysis of the association between different alleles of molecular markers and the anti-Vibrio parahaemolyticus trait

[0067] The present invention uses the six whiteleg shrimps from different sources collected in Example 1 to conduct an association analysis on the different allele types of the Relish-SSR molecular marker of whiteleg shrimp and its anti-Vibrio parahaemolyticus traits. A total of 320 whiteleg shrimps were used, including 50 each of "Zhongxing No. 1", OI seed conservation group, day and night fast group, and Saipan group, and 60 each of the introduced groups from Mexico and Ecuador, which were placed in a breeding barrel and cultured for 48 hours. After the whiteleg shrimps were in a stable state, each shrimp was artificially injected with 50 μL of Vibrio parahaemolyticus pathogen solution (the concentration of Vibrio parahaemolyticus pathogen solution was 2.5×10 4 CFU / μL) were challenged with the virus. Inspections were conducted every 4 hours after challenge, and the time of death and the group to which the individual shrimp belonged were recorded. Dead shrimp were numbered, and muscle tissue from the dead shrimp was collected and stored at -80°C for 168 hours. After 168 hours of challenge, all surviving shrimp were recorded as disease-resistant individuals. Culture was continued for 192 hours, at which time muscle tissue from the shrimp was collected. Genomic DNA from the above materials (shrimp that died within 168 hours and muscle tissue from shrimp that survived until 192 hours) was extracted using the Marine Animal Tissue Genomic DNA Extraction Kit (TIANGEN).

[0068] According to the method described in Example 2, PCR amplification was performed on the genomic DNA of the above materials respectively, and the amplified products were detected by capillary fluorescence electrophoresis to determine their allele types and calculate the capillary fluorescence electrophoresis detection results.

[0069] The present invention tested the anti-Vibrio parahaemolyticus trait of the six whiteleg shrimps (320 tails in total) from different sources in Example 1. After the test, 56 shrimps survived and the number of individuals with recorded survival time phenotyping data was 264 tails. The Relish-SSR marker typing results showed that a total of 10 allele types were detected in the 320 shrimps, including three major allele types, namely 197 / 197 (27.81%), 197 / 200 (35.94%) and 200 / 200 (24.06%). The statistical results of the phenotypic traits of shrimp anti-Vibrio parahaemolyticus showed that the average survival times of the three major allele types 197 / 197, 197 / 200 and 200 / 200 were 94.92h, 64.87h and 43.84h, respectively. On this basis, a general linear model (GLM) was used to analyze the association between the disease resistance phenotype and the Relish allele typing. The results of the linear model variance analysis are shown in Table 1. As shown in Table 1, the Relish-SSR marker allele type was significantly correlated with the survival rate of shrimp infected with Vibrio parahaemolyticus (p < 0.001). Among them, the average survival time of individuals with allele type 197 / 197 was 94.92 hours, which was significantly higher than that of individuals with allele types 194 / 200, 197 / 200, and 200 / 200.

[0070] Table 1 Association analysis between Relish-SSR marker alleles and phenotypic traits of resistance to Vibrio parahaemolyticus

[0071]

[0072] Note: “-” indicates insufficient sample size and inability to calculate standard deviation; “***” indicates p < 0.001.

[0073] Subsequently, the SNK and LSD tests were used to perform pairwise comparison analysis on the four alleles with higher allele frequencies (197 / 197, 194 / 200, 197 / 200, 200 / 200) and the disease resistance phenotype. The results are shown in Table 2.

[0074] Table 2 Pairwise comparison of Relish-SSR marker alleles and phenotypic traits against Vibrio parahaemolyticus

[0075]

[0076] Note: “**” p<0.01; “***” p<0.001.

[0077] Combining the results shown in Tables 1 and 2, it can be seen that the allele type of the Relish-SSR molecular marker is associated with the resistance of shrimp to Vibrio parahaemolyticus. Individuals with the Relish-SSR molecular marker allele type of 197 / 197 have the strongest resistance to Vibrio parahaemolyticus, and their survival time after infection with Vibrio parahaemolyticus is significantly longer than that of individuals with other allele types.

[0078] Example 4 Verification of the association between different alleles of molecular markers and resistance to Vibrio parahaemolyticus

[0079] The present invention also used four independently cultivated white shrimp populations to verify the association between different allele types of the Relish-SSR molecular marker of white shrimp and its anti-Vibrio parahaemolyticus trait. The four populations used were HD-0711, HD-1522, HD-3121 and HD-7403, with 90 tails in each population, totaling 360 tails. The toxicity experiment and sample collection were carried out according to the method described in Example 3, and the genomic DNA of the collected samples was PCR amplified according to the method described in Example 2. The amplified products were detected by capillary fluorescence electrophoresis, and their allele types were determined and the capillary fluorescence electrophoresis detection results were counted.

[0080] The present invention conducted an anti-Vibrio parahaemolyticus trait test on the whiteleg shrimp groups HD-0711, HD-1522, HD-3121 and HD-7403 (a total of 360 tails). After the test, 85 shrimps survived and the number of individuals with survival time phenotyping data was recorded for 275 tails. The Relish-SSR marker typing results showed that a total of 6 allele types were detected in the 360 ​​shrimps, including 3 major allele types, namely 197 / 197 (24.44%), 197 / 200 (48.33%) and 200 / 200 (18.06%). The statistical results of the shrimp anti-Vibrio parahaemolyticus phenotypic traits showed that the average survival time of the three major allele types 197 / 197, 197 / 200 and 200 / 200 were 102.75h, 80.38h and 68.31h, respectively. The relationship between the Relish-SSR marker allele type and the resistance to Vibrio parahaemolyticus was tested according to the analysis method described in Example 3. The results of the linear model variance analysis are shown in Table 3. As shown in Table 3, the Relish-SSR marker allele type was significantly correlated with the survival rate of shrimp infected with Vibrio parahaemolyticus (p < 0.001). Subsequently, the SNK and LSD tests were used to perform pairwise comparative analysis on the four allele types with higher allele frequencies (194 / 200, 197 / 197, 197 / 200, 200 / 200) and the disease resistance phenotype. The results are shown in Table 4. As shown in Tables 3 and 4, the average survival time of individuals with the allele type 197 / 197 was 102.75h, which was significantly higher than that of individuals with the allele types 194 / 200, 197 / 200 and 200 / 200. The above results verified the association between the Relish-SSR molecular marker allele type and the shrimp resistance to Vibrio parahaemolyticus. Individuals with the Relish-SSR molecular marker allele type of 197 / 197 had the strongest resistance to Vibrio parahaemolyticus, and their survival time after infection with Vibrio parahaemolyticus was significantly longer than that of individuals with other allele types.

[0081] Table 3 Verification of the association between Relish-SSR marker alleles and phenotypic traits of resistance to Vibrio parahaemolyticus

[0082]

[0083]

[0084] Note: “***” p<0.001.

[0085] Table 4 Pairwise comparison of Relish-SSR marker alleles and phenotypic traits against Vibrio parahaemolyticus

[0086]

[0087] Note: “*” p<0.05, “**” p<0.01, “***” p<0.001.

[0088] Example 5 Relationship between different alleles of molecular markers and antimicrobial peptide expression

[0089] The present invention also examined the relationship between the Relish-SSR molecular marker allele type and antimicrobial peptide expression. Whiteleg shrimp (Penaeus vannamei) from the six different sources described in Example 1 were collected, with 30 shrimp from each source, for a total of 180 shrimp, and cultured in a culture tank for 48 hours. After the shrimp were stable, each shrimp was artificially injected with 50 μL of Vibrio parahaemolyticus pathogen solution (the concentration of the Vibrio parahaemolyticus pathogen solution was 2.5×10 3 CFU / μL) were used for the challenge. Gill and muscle tissues of shrimp were collected at 0 h and 12 h after the challenge, with 15 shrimp from each family collected. Genomic DNA from muscle tissue was extracted using the Marine Animal Tissue Gene DNA Extraction Kit (TIANGEN) for Relish-SSR allele typing of individual shrimp. RNA from gill tissue was extracted using the RNAprep Pure Animal Tissue Total RNA Extraction Kit (TIANGEN) and reverse transcribed into cDNA using the StarScript III RT-PCR Kit (GenStar) for fluorescent quantitative PCR detection of antimicrobial peptides.

[0090] The genomic DNA was amplified by PCR according to the method described in Example 2, and the results of capillary fluorescence electrophoresis were counted, and the Relish-SSR allele type of each sampled individual was counted.

[0091] Specific primers were designed based on the articles by Wang PH (2013) and Qiu W (2014) to detect the expression changes of antimicrobial peptides Relish, PEN, Lysozyme and Crustin in individuals with three major allele types (allele types 197 / 197, 197 / 200 and 200 / 200), respectively, and EF1α was used as an internal reference control.

[0092] The fluorescent quantitative PCR primers designed by the present invention for detecting the antimicrobial peptides are shown in Table 5.

[0093] Table 5 Fluorescence quantitative PCR primers for detecting antimicrobial peptides

[0094]

[0095]

[0096] Note: PEN2 / PEN3 and Crustin1 / Crustin2 are antimicrobial peptides from the same family, sharing similar functional domains but distinct sequences. Based on previous studies, these four antimicrobial peptides have been shown to induce a strong immune response against Vibrio parahaemolyticus infection, so they were also tested separately.

[0097] The fluorescence quantitative PCR reaction system was as follows: 5 μL 2×TB Green Fast qPCR mixture (Takara, Japan), 250 nM forward / reverse primers, 1 μL cDNA, and ddH2O was added to 10 μL.

[0098] The reaction conditions for fluorescence quantitative PCR were as follows: pre-denaturation at 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 20 seconds, and 72°C for 5 seconds, followed by heating to 95°C at a rate of 5°C / s to establish a melting curve.

[0099] According to statistics, among the 180 shrimps collected in this example, there were 45 shrimps with the 197 / 197 allele, 62 shrimps with the 197 / 200 allele, and 51 shrimps with the 200 / 200 allele. The results of the fluorescence quantitative PCR test of the antimicrobial peptides Relish, PEN, Lysozyme and Crustin are shown in Figure 2. Figure 3 As shown; Figure 3 A in the figure is the typing pattern of shrimp individuals against Vibrio parahaemolyticus. The tested individuals were typed using Relish-SSR markers, and individuals with allele types of 197 / 197, 197 / 200, and 200 / 200 were selected to compare the expression differences of antimicrobial peptides. Figure 3 B in the figure is the fluorescence quantitative PCR test results of Relish, PEN, Lysozyme and Crustin. Figure 3 Twelve hours after infection with V. parahaemolyticus, the mRNA expression levels of the Relish gene did not differ significantly among the three alleles, but the mRNA expression levels of the genes encoding the other three antimicrobial peptides, PEN, Lysozyme, and Crustin, were significantly different. The expression levels of PEN, Lysozyme, and Crustin antimicrobial peptides in individuals with the 197 / 197 allele were higher than those in individuals with the 197 / 200 and 200 / 200 genotypes. Some of the differences were significant (p < 0.05), indicating that individuals with the 197 / 197 allele had a stronger immune response against V. parahaemolyticus than those with the other genotypes, consistent with the disease resistance phenotypic traits of shrimp.

[0100] The above results show that the SSR molecular markers and their detection primers described in the present invention can be used to screen whiteleg shrimp with resistance to Vibrio parahaemolyticus, and can be used for molecular breeding of shrimp with high resistance to Vibrio parahaemolyticus.

[0101] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A detection primer for Relish-SSR molecular markers related to resistance to Vibrio parahaemolyticus in whiteleg shrimp, characterized in that: The detection primers are for Penaeus vannamei Relish The microsatellite repeat sequence at 1750-1815 bp in the gene cds region was designed; Relish The GenBank accession number of the gene is EF432734; the detection primers include Relish-SSR-F and Relish-SSR-R; the nucleotide sequence of the Relish-SSR-F is shown in SEQ ID NO.1; the nucleotide sequence of the Relish-SSR-R is shown in SEQ ID NO.

2.

2. A detection kit for Relish-SSR molecular markers related to resistance of whiteleg shrimp to Vibrio parahaemolyticus, characterized in that: The kit contains the detection primer according to claim 1.

3. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in the preparation of a product for identifying the resistance of whiteleg shrimp to Vibrio parahaemolyticus.

4. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in preparing a product for screening whiteleg shrimp for resistance to Vibrio parahaemolyticus.

5. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in the preparation of a product for molecular marker-assisted breeding of whiteleg shrimp resistant to Vibrio parahaemolyticus.

6. A method for identifying the resistance of Penaeus vannamei to Vibrio parahaemolyticus for non-diagnostic purposes, characterized in that: The following steps are involved: S1. Extracting genomic DNA from the tested whiteleg shrimp sample; S2. Using the genomic DNA obtained in step S1 as a template, PCR amplification is performed using the detection primers described in claim 1. If the amplified product is a single band with a length of 197 bp, it indicates that the tested whiteleg shrimp is homozygous for the allele type of 197 bp, has the Vibrio parahaemolyticus resistance trait, and is a whiteleg shrimp with high resistance to Vibrio parahaemolyticus.

Citation Information

Patent Citations

  • Litopenaeus vannamei anti-vibrio related EST-STR marker as well as specific primer and detection method thereof

    CN113005204A

  • DNA probe sequence for genetic sex identification of litopenaeus vannamei and acquisition method

    US20170175188A1