A bifunctional composite probe 4-mba-hrp-agnps and a preparation method and application thereof
By modifying AgNPs with 4-MBA and HRP, and combining aptamer sensing, a highly sensitive and specific dual-mode detection of antibiotics was achieved by utilizing the lateral flow of a paper-based platform and the evaporation force of alcohol. This solves the problem of insufficient detection sensitivity in existing technologies and is suitable for environmental and food safety testing.
Patent Information
- Application Number
- CN202410603152.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-15
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-05-15
AI Technical Summary
Existing paper-based SERS substrates suffer from problems such as uneven nanoparticle distribution, high instrument requirements, complex processes, and high costs when detecting antibiotics. Furthermore, they lack sensitivity to targets with weak Raman scattering, making it difficult to achieve rapid, simple, and highly sensitive detection.
A bifunctional composite probe, 4-MBA-HRP-AgNPs, is used. 4-MBA is modified onto the surface of AgNPs. Combined with aptamer sensing, lateral flow is achieved by utilizing alcohol evaporation and paper-based capillary force. Combined with SERS and colorimetric detection, highly sensitive and specific detection of antibiotics is achieved through aptamer binding and dissociation.
It enables dual-mode detection of antibiotics, improves detection sensitivity, simplifies the operation process, reduces costs, is suitable for rapid detection on paper-based platforms, and is applicable to environmental and food safety testing.
Smart Images

Figure CN118549406B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a bifunctional composite probe 4-MBA-HRP-AgNPs and its preparation method and application. Specifically, it relates to a bifunctional composite probe 4-MBA-HRP-AgNPs capable of simultaneous Raman and colorimetric detection and its preparation method and application, belonging to the technical field of biosensors. BACKGROUND
[0002] As a new type of pollutant, antibiotics have the characteristics of biological toxicity, biological accumulation and environmental persistence, and pose a certain risk to human health and the ecological environment. When antibiotics are released into the environment, they can directly threaten human safety by interfering with normal metabolism and changing microbial communities. On the other hand, the large amount of antibiotics released into the environment will lead to chemical pollution and promote the generation and spread of antibiotic-resistant genes and antibiotic-resistant bacteria. Antibiotic resistance reduces the potential of antibiotics to treat human and animal pathogens, posing a serious threat to global public health. Therefore, rapid, simple and highly sensitive detection of antibiotic pollution is one of the key technical problems that need to be solved at present.
[0003] Due to the low cost, small amount of reagents, and portability of paper-based materials, they provide the possibility for on-site detection. SERS technology, with the advantages of no need for complex sample pretreatment, non-destructive sample and high sensitivity, combined with paper-based platform will become a rapid and efficient method for detecting antibiotics. The existing methods for making paper-based SERS substrates still have the disadvantages of uneven distribution of nanoparticles, high instrument requirements, complex process or high cost of substrate manufacturing. In addition, large-scale production of SERS substrates can only be used as a platform for direct detection, and the sensitivity of target substances with weak Raman scattering needs to be further improved. SUMMARY
[0004] The technical problem to be solved by the present application is to provide a bifunctional composite probe 4-MBA-HRP-AgNPs capable of being used for Raman and colorimetric detection simultaneously, a preparation method and application thereof, and suitable for target objects with weak Raman scattering; the present application provides a simple method for fixing nanoparticles on a paper base, and realizes double-mode detection of antibiotics through transverse flow on a paper tip platform by using the volatilization of alcohol and the capillary force of the paper base material; the multifunctional composite probe 4-MBA-HRP-AgNPs prepared by the present application combines SERS and aptamer sensing, and indirectly detects antibiotics by using Raman marker 4-MBA; meanwhile, HRP is modified on the surface of AgNPs, and HRP can catalyze the color reaction of a substrate such as 3,3'5,5'-tetramethylbenzidine (TMB); the present application realizes indirect high-sensitivity and specific detection of antibiotics based on the influence of antibiotic aptamer on the SERS enhancement effect of the 4-MBA-HRP-AgNPs probe and the inhibitory effect of peroxidase activity.
[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0006] One of the purposes of the present application is to provide a preparation method of a bifunctional composite probe 4-MBA-HRP-AgNPs capable of being used for Raman and colorimetric detection simultaneously, and a preparation flowchart is as shown in Figure 1 The preparation method comprises the following steps:
[0007] (1) Preparation of AgNPs:
[0008] 0.6mL of 0.1M AgNO3 solution is dissolved in 20mL of ultrapure water, and stirred and heated to boiling, then 0.4mL of 0.1M sodium citrate solution is quickly added to the boiling water, the color of the mixed solution gradually changes from colorless and transparent to light yellow, and finally to turbid yellow, the mixed solution is kept boiling under stirring for 1h, then continues to be stirred and cooled to room temperature to obtain AgNPs, which is stored at 4℃ for standby;
[0009] (2) Preparation of 4-MBA solution:
[0010] 4-MBA is used as a Raman marker molecule for indirect detection of antibiotics, 4-MBA is dissolved with a solvent to prepare a 4-MBA stock solution, and the stock solution is diluted with a solvent to prepare a 4-MBA solution for standby;
[0011] (3) Modification of 4-MBA on the surface of AgNPs:
[0012] The 4-MBA solution obtained in step (2) and the AgNPs solution obtained in step (1) are mixed uniformly at a certain ratio, and then incubated at room temperature to fix 4-MBA on the surface of AgNPs;
[0013] (4) Loading HRP on the surface of AgNPs:
[0014] HRP was added to the system of step (3), and after mixing, it was incubated in a 4℃ refrigerator, then centrifuged to remove the supernatant, and ultrapure water was added for dispersion, and this centrifugation and dispersion step was repeated three times to obtain a 4-MBA-HRP-AgNPs composite probe, which was stored at 4℃ for standby.
[0015] In the above technical solution, in step (2), the solvent is anhydrous ethanol; the 4-MBA mother liquor has a concentration of 1mM; and the 4-MBA solution after dilution has a concentration of 7.5μM.
[0016] In the above technical solution, in step (3), when the 4-MBA solution is mixed with the AgNPs solution, the volume ratio is 1:3, and incubation is carried out at room temperature for 3h.
[0017] In the above technical solution, in step (4), the HRP has a concentration of 60μg / mL, and the volume ratio of HRP to 4-MBA solution is 3:4; after mixing, it is incubated in a 4℃ refrigerator for 12h, then the mixture is centrifuged at a centrifugal force of 7232g for 15min to remove the supernatant; an equal volume of ultrapure water is added to the centrifuge tube to re-disperse, and this centrifugation and dispersion step is repeated three times to prepare a 4-MBA-HRP-AgNPs composite probe, which is stored at 4℃ for standby.
[0018] The second object of the present application is to provide a bifunctional composite probe 4-MBA-HRP-AgNPs capable of simultaneous Raman and colorimetric detection, prepared by the above preparation method.
[0019] The third object of the present application is to provide a use of the bifunctional composite probe 4-MBA-HRP-AgNPs in indirect detection of antibiotics.
[0020] In the above technical solution, the bifunctional composite probe 4-MBA-HRP-AgNPs is detected in SERS / colorimetric dual mode when used for indirect detection of antibiotics. The flow chart is as shown in Figure 2 The specific operation includes the following steps:
[0021] A. Preparation of a paper pointed SERS substrate
[0022] The paper sharp SERS substrate is designed to have a geometry of an isosceles triangular structure on top and a rectangular structure on the bottom, and the triangular top angle is 15°. The isosceles triangular structure serves as a paper sharp, and the rectangular structure serves as a volatile liquid absorption area. The length of the bottom side of the isosceles triangular structure is greater than the length of the wide side of the rectangular structure. The bottom side and the wide side are fixedly connected together, and the wide side is located at the center of the bottom side. Since the filter paper may have some impurities on the surface during the production process, the paper sharp substrate surface is cleaned with alcohol, and then the part containing impurities at the tip of the isosceles triangular structure is cut off. The specific operation is as follows: the entire rectangular structure on the bottom of the paper sharp substrate is inserted obliquely upward into a centrifuge tube containing 75% alcohol. The humidity of the air is kept constant at 50±5% RH, and the reaction is carried out at room temperature for 1 h. The impurities are concentrated at the front end of the isosceles triangular structure by the volatilization of alcohol and the capillary force of the paper substrate material. The front end of the isosceles triangular structure is cut off, and the isosceles triangular structure becomes an isosceles trapezoidal structure after the front end is cut off. The upper base of the isosceles trapezoidal structure serves as the paper sharp front end of the paper sharp SERS substrate.
[0023] B. Detecting the Raman signal of the antibiotic solution:
[0024] The paper sharp SERS substrate after cleaning and cutting in step A is used as a SERS substrate for collecting Raman spectra. The distance of 8 mm from the paper sharp front end of the SERS substrate is the sample addition area 1, and the distance of 16 mm from the paper sharp front end is the sample addition area 2. 5 μL of 4-MBA-HRP-AgNPs complex probe is added dropwise at the sample addition area 1, and 5 μL of 5 μM antibiotic aptamer solution (Apt) and 5 μL of antibiotic solution are added dropwise at the sample addition area 2 in sequence. The entire rectangular structure on the bottom of the paper sharp substrate is inserted obliquely upward into a centrifuge tube containing 75% alcohol. The humidity of the air is kept constant at 50±5% RH, and the reaction is carried out at room temperature for 1 h. All solvents flow to the paper sharp front end by the volatilization of alcohol and the capillary force of the paper substrate material. In the flow process, the antibiotic aptamer preferentially binds to the antibiotic, and finally enriches at the paper sharp front end with the 4-MBA-HRP-AgNPs complex probe. After 1 h of reaction, the SERS substrate is taken out of the alcohol, and after the SERS substrate is completely dried, the Raman spectrum is collected at the paper sharp front end of the SERS substrate by using a portable Raman spectrometer;
[0025] The principle of this step is that when there is an aptamer, the aptamer is wrapped around the nanoparticles, the gap between the nanoparticles becomes larger, resulting in a decrease in "hot spots", and the Raman signal of 4-MBA is reduced. When there is a target, the aptamer will preferentially bind to the target, form a stable hairpin structure and detach from the surface of AgNPs. In this way, the nanoparticles are not protected by the aptamer, and the "hot spots" will recover, so that the Raman signal of 4-MBA is again highly enhanced. The change in Raman signal before and after the addition of the target can be used to analyze and detect the target.
[0026] C. Detecting the absorbance of the antibiotic solution:
[0027] After measuring the Raman signal of the front end of the paper tip in step B, the part 2mm from the front end of the paper tip is cut off and immersed in 20μL TMB mixed solution for 5min. After shaking uniformly, the ultraviolet absorption peak of the mixed solution is detected by a micro ultraviolet spectrophotometer; the TMB mixed solution includes TMB color developing solution A and TMB color developing solution B, and the volume ratio of the two is 1:1.
[0028] The principle of this step is that when there is no target, the aptamer is wrapped around the nanoparticles, and due to the shielding effect of the aptamer, TMB as a colorimetric probe cannot approach the surface of 4-MBA-HRP-AgNPs, thereby inhibiting the peroxidase activity of 4-MBA-HRP-AgNPs to oxidize TMB. When the target is present, the aptamer will bind to the target with high specific affinity, and the aptamer will leave the surface of the nano-composite probe due to the change in structure, thereby restoring the catalytic activity of the probe and oxidizing colorless TMB to blue oxTMB. By measuring the absorbance of the oxidation product at 650nm, the target is quantitatively analyzed.
[0029] In the above technical solution, in steps A and B, the paper tip-shaped SERS substrate includes an isosceles trapezoidal paper tip on the top and a long rectangular volatile liquid absorption area on the bottom, the lower base of the paper tip and the wide side of the volatile liquid absorption area are fixedly connected together to form a whole, and the wide side is located at the center of the lower base; the paper tip has an upper base length of 2.0±0.3mm, a lower base length of 14.0±2.0mm, and a height of 24±1.0mm; the volatile liquid absorption area has a width of 7.0±1.0mm and a length of 20.0±1.0mm; the paper tip-shaped SERS substrate has a whole height of 44.0±2.0mm, and the distance of 8mm from the front end of the SERS substrate is the sample adding area 1, and the distance of 16mm from the front end of the paper tip is the sample adding area 2.
[0030] In the above technical solution, in step B, the SERS substrate is removed, and the Raman spectrum is collected at the paper tip of the SERS substrate, and the operation is as follows: under the condition of 785 nm excitation wavelength and 300 mW laser power, the size of the focused spot is about 160 μm, the integral time of each spectrum is set to 3.5 s, the SERS signals of three detection positions in the range of 1 mm in front of the paper tip are randomly measured, and the average value represents the SERS signal of the paper tip.
[0031] The principle of SERS / colorimetric detection of the 4-MBA-HRP-AgNPs composite probe is as follows:
[0032] (1) The AgNPs are prepared by a hot reduction method, and then, 4-MBA is modified on the surface of the AgNPs as a Raman signal molecule by using the strong affinity between thiol and Ag (forming an Ag-S bond). Due to the surface plasmon resonance of the metal nanostructure, the local field (or near field) is enhanced, that is, the "hot spot" effect, and the Raman peak of 4-MBA is significantly enhanced. This result may be because the intermolecular hydrogen bond between the carboxyl groups of 4-MBA adsorbed on the AgNPs causes a dimerization process, reducing the nanogap. At the same time, HRP is loaded on the surface of the AgNPs. HRP is a peroxidase, and in the presence of H2O2, HRP catalyzes the oxidation of H2O2 into ·OH free radicals, which oxidize TMB into blue oxTMB. Compared with other metal nanoparticles, the 4-MBA-HRP-AgNPs composite probe designed in the application has the Raman "hot spot" effect and the catalytic activity of peroxidase, and the combination of the aptamer can realize the indirect high-sensitivity and specific detection of the target.
[0033] (2) When the aptamer is present, the aptamer is attached to the AgNPs through the N atom on the phosphate. The aptamer is wrapped around the nanoparticles, and due to the electrostatic repulsion between the aptamers, the gap between the nanoparticles is increased, thereby reducing the electromagnetic field enhancement. The reduction of "hot spots" reduces the Raman signal of 4-MBA. When the target is present, the aptamer will preferentially bind to the target to form a stable hairpin structure and detach from the surface of the AgNPs. In this way, the nanoparticles are not protected by the aptamer, and the "hot spots" are restored, thereby making the Raman signal of 4-MBA highly enhanced. The change value of the Raman signal before and after the addition of the target can realize the analysis and detection of the target.
[0034] (3) Considering that the nanomaterial has a large specific surface area and good enzyme loading characteristics, the application loads sufficient HRP on the surface of AgNPs to enhance the catalytic activity of the system. When there is no target, the aptamer is wrapped around the nanoparticles, and due to the shielding effect of the aptamer, TMB as a colorimetric probe cannot access the surface of 4-MBA-HRP-AgNPs, thereby inhibiting the peroxidase activity of 4-MBA-HRP-AgNPs in oxidizing TMB. When the target exists, the aptamer will bind to the target with high specific affinity, and the aptamer will leave the surface of the nanocomposite probe due to the change in structure, thereby restoring the catalytic activity of the probe and oxidizing colorless TMB to blue oxTMB. The target is quantitatively analyzed by measuring the absorbance of the oxidation product at 650 nm.
[0035] Compared with the prior art, the application has the following characteristics:
[0036] (1) The application prepares a 4-MBA-HRP-AgNPs composite probe with SERS and colorimetric dual response, and the aptamer is wrapped around the surface of the composite probe, so that the nanogap of the composite probe becomes larger, the "hot spot" is reduced, the Raman signal of the system 4-MBA is reduced, and the shielding effect of the aptamer causes TMB as a colorimetric probe to be unable to access the surface of 4-MBA-HRP-AgNPs, thereby reducing the blue oxidation product oxTMB generated by the system. By adding the target, the aptamer can be separated from the surface of 4-MBA-HRP-AgNPs, thereby restoring the SERS response and catalytic activity of the composite probe. The change value of the Raman signal before and after the addition of the target and the difference value of the ultraviolet absorption peak can realize the dual-mode analysis and detection of the target, so that the result is more reliable. Again, the whole system is carried out on a paper-based platform, only a small amount of sample volume (5 μL) and reagent consumption (5 μL) are required, and the on-line sample capture and nanoparticle enrichment are realized on the paper tip platform through lateral flow by using the volatilization of alcohol and the capillary force of the paper-based material. The high-sensitivity rapid detection of the target can be realized in only 1 h.
[0037] (2) The SERS / colorimetric dual-mode detection method described in the application has higher sensitivity than the direct detection method, and has the advantages of simple operation, fast analysis speed, low manufacturing cost, etc. It is expected to develop into a conventional detection method for antibiotics, and has good application prospects in environmental and food safety detection. BRIEF DESCRIPTION OF DRAWINGS
[0038] Figure 1 The process flow chart of the preparation method of the bifunctional composite probe 4-MBA-HRP-AgNPs capable of being used for Raman and colorimetric detection in the application;
[0039] Figure 2Process flow chart for the fabrication of paper tip SERS substrate and the dual detection process in the present application;
[0040] Figure 3 Structure diagram of paper tip SERS substrate prepared in Example 2 of the present application;
[0041] Figure 4a UV-vis spectrum of 4-MBA-HRP-AgNPs composite probe prepared in Example 3 of the present application;
[0042] Figure 4b Transmission electron microscope image of 4-MBA-HRP-AgNPs composite probe prepared in Example 3 of the present application under 30000x magnification;
[0043] Figure 5a Logarithmic function relationship between Raman intensity at 1580cm -1 and OTC concentration (concentration range: 1nM-10μM) in Example 1;
[0044] Figure 5b Raman spectrum of 4-MBA on paper tip SERS / colorimetric sensor in Example 1;
[0045] Figure 6 Logarithmic function between absorption peak value at 650nm and OTC concentration in Example 1;
[0046] Figure 7a Average Raman intensity column chart of 4-MBA at 1580cm -1 in 10 experiments in Example 1 (n=3);
[0047] Figure 7b Raman spectrum of 4-MBA at 1580cm -1 in 10 experiments in Example 1;
[0048] Figure 7c Average UV absorption peak intensity column chart of 4-MBA at 650nm in 10 experiments in Example 1;
[0049] Figure 7d UV-visible spectrum of 4-MBA at 650nm in 10 experiments in Example 1;
[0050] Figure 8a Raman intensity column chart of SERS detection of different antibiotics at 1580cm -1 in Example 2;
[0051] Figure 8bTo verify the UV detection of different antibiotics in Example 2 at 650 nm, the UV absorption peak intensity column chart was detected. DETAILED DESCRIPTION
[0052] The following describes the specific embodiments of the technical solutions of the present application in detail, but the present application is not limited to the following description:
[0053] The materials and reagents used in the following examples of the present application and the instruments and equipment are as follows:
[0054] 1. Materials and reagents
[0055] Table 1. Main reagent materials for the experiment
[0056] Material and reagent name Molecular formula / abbreviation Manufacturer Silver nitrate AgNO3 National Pharmaceutical Group Chemical Reagent Co., Ltd. Sodium citrate [C6H5Na3O7] National Pharmaceutical Group Chemical Reagent Co., Ltd. 4-Mercaptobenzoic acid 4-MBA Shanghai Jizisheng Biotech Co., Ltd. Oxytetracycline OTC Aladdin Chemical Reagent Co., Ltd. Chloramphenicol CAP Aladdin Chemical Reagent Co., Ltd. Kanamycin Kana Aladdin Chemical Reagent Co., Ltd. Tetracycline TC Aladdin Chemical Reagent Co., Ltd. Ampicillin AMP Aladdin Chemical Reagent Co., Ltd. Oxytetracycline aptamer Apt Shanghai Genechem Co., Ltd. Horseradish peroxidase HRP Shanghai McLean Science and Technology Biochemical Co., Ltd. 3,3',5,5'-tetramethylbenzidine TMB Shanghai McLean Science and Technology Biochemical Co., Ltd. Ethanol [C2H5OH] National Pharmaceutical Group Chemical Reagent Co., Ltd. Tap water / Laboratory tap water (Qingdao) Honey / Local supermarket Ultrapure water H2O / Whatman chromatography paper (3MM level CHR) / GE Healthcare Company (USA) Qualitative filter paper / Hangzhou Special Paper Co., Ltd. (Xinxing)
[0057] Note: The water used in the experiment is ultrapure water 18.2 MΩ·cm-1, and the oxytetracycline aptamer base sequence is (GGAGGCTCTCGGGACGACTGGACCCTTCTGTGGTAGATTCTATCTAATGTCGTCCCGCCTTTAGGAT TTACA).
[0058] 2. Instruments and equipment
[0059] Table 2. Main instruments and equipment for the experiment
[0060]
[0061]
[0062] Example 1: Preparation of AgNPs
[0063] First, 0.1M 0.6mL AgNO3 solution was dissolved in 20mL ultrapure water, and stirred and heated to boiling; then 0.4mL 0.1M sodium citrate was quickly added to the boiling water, and the color of the mixed solution gradually changed from colorless and transparent to light yellow, and finally to turbid yellow; the mixed solution was kept boiling under stirring for 1h, then continued to be stirred and cooled to room temperature, and stored at 4℃ for standby.
[0064] Example 2: Preparation of paper pointed SERS substrate
[0065] Based on the geometry of the paper-tipped SERS substrate, the chromatographic paper was cut into 15° paper-tipped shapes using a paper cutter. Since some impurities may remain on the surface of the filter paper during production, the surface of the paper tip was cleaned using the volatile properties of alcohol, and the impure portion at the tip was then cut off. The specific procedure is as follows: The rectangle below the paper-tipped substrate was inserted obliquely upwards into a centrifuge tube containing 75% alcohol. The humidity of the air was kept constant at 50±5% RH, and the reaction was carried out at room temperature for 1 hour. The evaporation of alcohol and the capillary action of the paper substrate concentrated the impurities at the very tip of the paper tip. The very tip of the paper tip was then cut off, becoming the paper tip tip of the SERS substrate. The cut paper tip has an isosceles trapezoidal top and a rectangle bottom. The isosceles trapezoidal structure serves as the paper-tipped SERS substrate, and the rectangular structure serves as the volatile liquid absorption area. The length of the bottom edge of the paper tip is greater than the length of the wide edge of the substrate, and the bottom edge and wide edge are fixedly connected together with the wide edge located at the center of the bottom edge.
[0066] The paper-point-shaped SERS substrate has the following structural diagram: Figure 3 As shown: It includes an isosceles trapezoidal paper tip at the top and a rectangular volatile liquid absorption area at the bottom. The lower base of the paper tip and the wide side of the volatile liquid absorption area are fixedly connected together to form a whole, with the wide side located at the center of the lower base. The paper tip has an upper base side length of 2.0 mm, a lower base side length of 14.0 mm, and a height of 24 mm. The volatile liquid absorption area has a width of 7.0 mm and a length of 20.0 mm. The paper tip-shaped SERS substrate has an overall height of 44.0 mm. Sample loading area 1 is located 8 mm from the front end of the paper tip SERS substrate, and sample loading area 2 is located 16 mm from the front end of the paper tip.
[0067] Example 3: Preparation of 4-MBA-HRP-AgNPs composite probe
[0068] Anhydrous ethanol was selected as the solvent for 4-MBA, and a 1 mM 4-MBA solution was prepared as the stock solution and diluted to 7.5 μM for later use. The 7.5 μM 4-MBA solution was mixed with the AgNPs obtained in Example 1 at a ratio of 1:3 (v / v) and incubated at room temperature for 3 h. Then, 60 μg / mL HRP was added, with a volume ratio of HRP to 4-MBA of 3:4, and the mixture was incubated at 4 °C for 12 h. Finally, the mixture was centrifuged at 7232 g for 15 minutes, the supernatant was removed, and an equal volume of ultrapure water was added to the centrifuge tube to redisperse the mixture. This centrifugation and dispersion step was repeated three times to obtain the 4-MBA-HRP-AgNPs composite probe, which was stored at 4 °C for later use. The UV-vis spectrum of the 4-MBA-HRP-AgNPs composite probe is shown below. Figure 4a As shown, the transmission electron microscope image is as follows: Figure 4b As shown:
[0069] like Figure 4aAs shown, AgNPs have a strong ultraviolet absorption peak at 435 nm, and after 4-MBA Raman signal molecules are modified through Ag-S bond, the position of the ultraviolet absorption peak of the nanoparticles slightly red shifts to 441 nm due to the change of the refractive index around the nanoparticles; in addition, the absorption peak of the 4-MBA-HRP-AgNPs composite probe at 452 nm indicates that HRP is successfully modified on the AgNPs; on the other hand, in order to verify the feasibility of the principle, we observed the aggregation state of the composite probe by transmission electron microscopy, as shown in Figure 4b As shown, when sufficient 4-MBA molecules are fixed on the AgNPs, the dimerization process of the AgNPs is caused by the intermolecular hydrogen bonds between the carboxyl groups of 4-MBA, which reduces the gap between the nanoparticles and forms more SERS hot spots.
[0070] Example 4: Detection using the 4-MBA-HRP-AgNPs composite probe obtained in Example 3
[0071] Honey and tap water were used as actual samples: the honey sample was diluted 50 times with ultrapure water, and in order to remove insoluble impurities, the supernatant was taken after centrifugation, and the supernatant was filtered with a 0.22 μm microporous filter film. The filtered honey sample was ultrasonicated for 10 min (input power 200 W) and then stored in a 4°C refrigerator. The laboratory tap water sample was also filtered with a 0.22 μm microporous filter film. Then, OTC was added to the honey and tap water samples to prepare samples containing different concentrations of OTC (the OTC concentrations in the samples to be detected were 50 nM, 0.5 μM and 5 μM, respectively). The detection method included the following steps:
[0072] A. Preparation of paper-tipped SERS substrate
[0073] The structure and preparation method of the paper-tipped SERS substrate are the same as those of Example 2;
[0074] B. Raman detection of target substances:
[0075] The prepared paper-like SERS substrate is used as a substrate for collecting Raman spectrum, 5 μL of 4-MBA-HRP-AgNPs complex probe is added dropwise to sample area 1, 5 μL of 5 μM terramycin aptamer solution (Apt) and 5 μL of the solution to be detected are added dropwise to sample area 2 in sequence, the paper-like substrate is inserted into a centrifuge tube containing 75% alcohol with the long rectangle below the paper-like substrate being inclined upward, the humidity of the air is kept unchanged at 50±5% RH, and the reaction is carried out at room temperature for 1 h, the volatilization of alcohol and the capillary force of the paper substrate material are used to flow all the solvents to the front end of the paper, in the process of flowing, the terramycin aptamer is preferentially combined with the target, and finally the 4-MBA-HRP-AgNPs complex probe is enriched at the front end of the paper, after 1 h of reaction, the SERS substrate is taken out of the alcohol, and after the SERS substrate is completely dried, the Raman spectrum at the paper tip of the SERS substrate is collected by using a portable Raman spectrometer: under the condition of 785 nm excitation wavelength and 300 mW laser power, the size of the focused spot is about 160 μm, the integral time of each spectrum is set to 3.5 s, the SERS signals of three detection positions within 1 mm from the front end of the paper tip are randomly measured, and the average value represents the SERS signal of the paper tip;
[0076] C. Absorbance detection of the target:
[0077] After the Raman signal of the paper tip is measured in step B, the part 2 mm away from the front end of the paper tip is cut off and immersed in 20 μL of TMB mixed solution for 5 min, and after uniform shaking, the ultraviolet absorption peak of the solution is detected by using a micro ultraviolet spectrophotometer.
[0078] In the present application, the Raman signal intensity of 4-MBA at 1580 cm -1 The Raman signal intensity of 4-MBA at 1580 cm
[0079] When the OTC concentration in the honey sample is 50 nM, 0.5 μM and 5 μM, the SERS signals are 9745.36, 11876.6 and 12496.72, respectively;
[0080] When the OTC concentration in the tap water sample is 50 nM, 0.5 μM and 5 μM, the SERS signals are 8757.622, 11496.83 and 14608.72, respectively;
[0081] When the OTC concentrations in the honey samples were 50 nM, 0.5 μM, and 5 μM, the UV absorption peaks were 1.43, 2.17, and 2.32, respectively.
[0082] When the OTC concentrations in the tap water samples were 50 nM, 0.5 μM, and 5 μM, the UV absorption peaks were 1.31, 1.95, and 2.70, respectively.
[0083] OTC spiking experiments were conducted on tap water and honey samples, with OTC spiking concentrations of 50, 500, and 5000 nM in the two actual samples, respectively. The results are shown in Table 3. For SERS detection, the OTC recovery rate in tap water was 82.93-103.66% (n=3), with a relative standard deviation (RSD) of 1.15-8.07%. The OTC recovery rate in honey samples was 101.16-103.03% (n=3), with an RSD of 1.15-6.92%. This indicates that the SERS detection method of this invention exhibits good reproducibility and accuracy for the determination of OTC in actual samples. In colorimetric detection, the OTC recovery rate in tap water was 81.05-111.60% (n=3), with an RSD of 1.57-2.33% (Table 4). The OTC recoveries in honey samples ranged from 91.55% to 107.08% (n=3), with relative standard deviations (RSDs) of 0.77% to 1.33%. This demonstrates that the colorimetric detection method of this invention exhibits good reproducibility and accuracy for the determination of OTC in actual samples.
[0084] Table 3. Recovery rate of OTC in SERS detection (n=3)
[0085]
[0086]
[0087] Table 4. Recovery rate of OTC in colorimetric detection (n=3)
[0088]
[0089] The spiked recovery experiment of this invention demonstrates that the detection method of this invention exhibits good accuracy and reproducibility. In summary, the results indicate that the detection method constructed in this invention has promising prospects for practical applications.
[0090] Verification Example 1: Validation of the detection performance of the 4-MBA-HRP-AgNPs composite probe obtained in Example 4 of this invention for SERS / colorimetric dual-mode detection:
[0091] To achieve accurate quantification, Raman spectra of 4-MBA corresponding to different concentrations of OTC were collected at the paper tip under optimal conditions.Figure 5b ). 4-MBA has many characteristic peaks at Raman shifts between 0-2000 cm -1 , such as 520, 1074, 1137, 1180, 1580 cm -1 , etc. The peak at 1074 cm -1 belongs to the C-S stretching mode of aromatic ring, and the peak at 1580 cm -1 belongs to the breathing mode of aromatic ring. The weak bands at 1362 cm -1 and 840 cm -1 are COO- stretching modes. The weak bands at 1137 cm -1 and 1179 cm -1 corresponding to C-H deformation modes are also observed, which is consistent with previous reports. Since the Raman peak at 1580 cm -1 is more sensitive to the change of OTC concentration, it is chosen as the ideal peak for the quantitative analysis of OTC. As shown in Figure 5a , it indicates that the Raman signal intensity is positively correlated with the concentration of OTC. In the range of 1 nM to 10 μΜ, there is a good linear relationship between the Raman intensity of the characteristic peak at 1580 cm -1 and the logarithm of OTC concentration. The linear regression equation is y = 2442.86x + 27348.09 (R 2 = 0.994), and the detection limit is 0.635 nM (S / N = 3).
[0092] The front end of the paper tip sensor after SERS detection is cut off and immersed in a mixed solution of TMB and H2O2 (20 μL) for 5 min, and its ultraviolet absorption detection result is as follows: as shown in Figure 6 , the concentration curve of OTC is drawn, and it can be seen from the figure that in the concentration range of 1 nM-10 μΜ, with the increase of OTC concentration, the absorption peak and the logarithm value of OTC concentration show a good linear relationship, the linear regression equation is y = 0.362x + 4.29, R 2 = 0.979, and the detection limit is 0.728 nM (S / N = 3).
[0093] In order to evaluate the reproducibility of the proposed paper tip SERS / colorimetric sensor, the applicant carried out 10 independent repeated experiments. Figure 7a and 7b show the SERS spectra of 4-MBA and the signal intensity at 1580 cm -1 in 10 experiments, respectively. The Raman signal intensity at 1580 cm -1 in 10 experiments is 9881.72, and the corresponding RSD is 4.39%. The colorimetric detection results are as shown in Figure 7c and Figure 7dAs shown, the UV absorption peak at 650 nm was 1.2634 in 10 experiments, with a corresponding RSD of 6.11%. The results indicate that the paper tip SERS / colorimetric detection method of this invention exhibits good reproducibility.
[0094] Verification Example 2: Verification of the specificity of the 4-MBA-HRP-AgNPs composite probe obtained in Example 4 of this invention for SERS / colorimetric dual-mode detection:
[0095] The 4-MBA-HRP-AgNPs composite probe obtained in Example 4 of this invention was applied to kanamycin (Kana), tetracycline (TC), chloramphenicol (CAP), and ampicillin (AMP) for specificity verification experiments. The detection method was the same as that in Example 4. After the OTC aptamer and different types of target molecules in equal amounts were reacted with the composite probe on a paper tip SERS substrate, the specificity of the method was determined by SERS detection and colorimetric detection of the response to the target antibiotic and interfering substances.
[0096] The results are as follows Figure 8a and Figure 8b As shown, the SERS intensities of Kana, TC, CAP, and AMP at 1580 cm⁻¹ -1 The peak value was much lower than that of OTC. Colorimetric results also showed the same conclusion; tetracycline may exhibit a higher response than other antibiotics due to its similar structure to OTC, but this response is still much lower than that of OTC. This indicates that the paper-tip-based dual-mode detection sensor has good specificity and can specifically detect OTC.
[0097] The above examples are merely illustrative of the technical concept and features of the present invention and should not be construed as limiting the scope of protection of the present invention. All equivalent transformations or modifications made in accordance with the essence of the present invention should be included within the scope of protection of the present invention.
Claims
1. A method for preparing a bifunctional composite probe 4-MBA-HRP-AgNPs capable of simultaneous Raman and colorimetric detection, characterized in that, Includes the following steps: (1) Preparation of silver nanoparticles (AgNPs): Dissolve 0.6 mL of 0.1 M AgNO3 solution in 20 mL of ultrapure water and heat to boiling. Then, quickly add 0.4 mL of 0.1 M sodium citrate solution to the boiling water. The color of the mixed solution gradually changes from colorless and transparent to pale yellow, and finally to turbid yellow. Keep the mixed solution boiling for 1 h with stirring, and then continue stirring and cool to room temperature to obtain AgNPs, which are stored at 4 °C for later use. (2) Preparation of 4-mercaptobenzoic acid (4-MBA) solution: 4-MBA was used as a Raman marker molecule for indirect detection of antibiotics. 4-MBA was dissolved in a solvent to prepare a 4-MBA stock solution, which was then further diluted with a solvent to prepare a 4-MBA solution for later use. (3) Modifying AgNPs surface with 4-MBA: The 4-MBA solution obtained in step (2) and the AgNPs solution obtained in step (1) are mixed evenly in a certain proportion and then incubated at room temperature to fix 4-MBA onto the surface of AgNPs. (4) Loading horseradish peroxidase (HRP) onto the surface of AgNPs: Add HRP to the system in step (3), mix well and incubate at 4°C. Then centrifuge to remove the supernatant, add ultrapure water for dispersion, and repeat this centrifugation and dispersion step three times to obtain the 4-MBA-HRP-AgNPs composite probe, which is stored at 4°C for later use.
2. The preparation method according to claim 1, characterized in that, In step (2), the solvent is anhydrous ethanol; the concentration of the 4-MBA mother liquor is 1 mM; the concentration of the diluted 4-MBA solution is 7.5 μM; in step (3), the volume ratio of the 4-MBA solution to the AgNPs solution is 1:3, and the mixture is incubated at room temperature for 3 h.
3. The preparation method according to claim 1, characterized in that, In step (4), the HRP concentration is 60 μg / mL, and the volume ratio of HRP to 4-MBA solution is 3:
4. After mixing, the mixture is placed in a refrigerator at 4 ℃ and incubated for 12 h. Then, the mixture is centrifuged at 7232g for 15 minutes to remove the supernatant. An equal volume of ultrapure water is added to the centrifuge tube to redisperse the mixture. This centrifugation and dispersion step is repeated three times to obtain the 4-MBA-HRP-AgNPs composite probe, which is stored at 4 ℃ for later use.
4. A bifunctional composite probe 4-MBA-HRP-AgNPs that can be used for both Raman and colorimetric detection, obtained by the preparation method described in any one of claims 1-3.
5. The application of the bifunctional composite probe 4-MBA-HRP-AgNPs as described in claim 4 in the indirect detection of antibiotics.
6. The application according to claim 5, characterized in that, The aforementioned bifunctional composite probe 4-MBA-HRP-AgNPs is used for indirect detection of antibiotics in a dual SERS / colorimetric mode. The specific operation includes the following steps: A. Preparation of paper-tipped SERS substrates Design the geometry of the paper-tip SERS substrate. Use a paper cutter to cut chromatographic paper into a paper-tip shape with an isosceles triangle structure on top and a rectangle structure on the bottom, with the apex angle of the triangle being 15°. The isosceles triangle structure serves as the paper tip, and the rectangle structure serves as the volatile liquid absorption zone. The length of the base of the isosceles triangle structure is greater than the length of the width of the rectangle structure. The base and width are fixedly connected together, with the width located at the center of the base. Since some impurities may remain on the surface of the filter paper during the production process, the surface of the paper-tip substrate is cleaned using the volatile properties of alcohol, and the impurity-containing part of the tip of the isosceles triangle structure is cut off. The specific operation is as follows: Insert the entire rectangle below the paper-tip substrate diagonally upward into a centrifuge tube containing 75% alcohol, maintain a constant air humidity of 50 ± 5% RH, and react at room temperature for 1 minute. h, by utilizing the evaporation of alcohol and the capillary force of the paper base material, impurities are concentrated at the very front of the isosceles triangle structure. The very front of the isosceles triangle structure is cut off, and the isosceles triangle structure becomes an isosceles trapezoid structure after the very front of the isosceles triangle structure is cut off. The upper base of the isosceles trapezoid structure serves as the paper tip front of the paper tip-shaped SERS base. B. Detection of Raman signals in antibiotic solutions: Using the cleaned and trimmed paper-tipped SERS substrate from step A as the SERS substrate for collecting Raman spectra, sample loading area 1 was located 8 mm from the tip of the SERS substrate, and sample loading area 2 was located 16 mm from the tip. 5 µL of a 4-MBA-HRP-AgNPs composite probe was added dropwise to sample loading area 1, and 5 µL of a 5 µM antibiotic aptamer solution (Apt) and 5 µL of an antibiotic solution were added dropwise sequentially to sample loading area 2. The entire rectangular section below the paper-tipped substrate was inserted obliquely upwards into a centrifuge tube containing 75% ethanol. The humidity was maintained at 50 ± 5% RH, and the reaction was carried out at room temperature for 1 h. Utilizing the evaporation of ethanol and the capillary action of the paper substrate, all solvents flowed towards the tip of the paper. During this flow, the antibiotic aptamer preferentially bound to the antibiotic. Finally, the 4-MBA-HRP-AgNPs composite probe accumulated at the tip of the paper. After h, the SERS substrate was removed from the alcohol and allowed to dry completely. Then, a portable Raman spectrometer was used to collect Raman spectra at the tip of the paper on the SERS substrate. C. Detect the absorbance of antibiotics: After measuring the Raman signal at the tip of the paper in step B, cut off the portion 2 mm from the tip and immerse it in 20 µL of TMB mixed solution for 5 min. After shaking evenly, use a micro-ultraviolet spectrophotometer to detect the ultraviolet absorption peak of the mixed solution. The TMB mixed solution includes TMB colorimetric solution A and TMB colorimetric solution B, with a volume ratio of 1:
1.
7. The application according to claim 6, characterized in that, In steps A and B, the paper-tip-shaped SERS substrate includes an isosceles trapezoidal paper tip at the top and a rectangular volatile liquid absorption area at the bottom. The lower base of the paper tip and the wide side of the volatile liquid absorption area are fixedly connected together to form a whole, with the wide side located at the center of the lower base. The paper tip has an upper base side length of 2.0 ± 0.3 mm, a lower base side length of 14.0 ± 2.0 mm, and a height of 24 ± 1.0 mm. The volatile liquid absorption area has a width of 7.0 ± 1.0 mm and a length of 20.0 ± 1.0 mm. The overall height of the paper-tip-shaped SERS substrate is 44.0 ± 2.0 mm. Sample application area 1 is located 8 mm from the front end of the paper-tip SERS substrate, and sample application area 2 is located 16 mm from the front end of the paper tip.
8. The application according to claim 6, characterized in that, In step B, the SERS substrate is removed, and Raman spectra are collected at the paper tip of the SERS substrate. The operation is as follows: using a portable Raman spectrometer, under the conditions of 785 nm excitation wavelength and 300 mW laser power, the size of the focused spot is 160 µm, the integration time of each spectrum is set to 3.5 s, and the SERS signals at three detection positions within a range of 1 mm from the front end of the paper tip are randomly measured. The average value is used to represent the SERS signal of the paper tip.