A corn wrky class transcription factor Zmwrky71 and expression product and application thereof
By isolating and cloning the ZmWRKY71 gene from maize and introducing it into Arabidopsis thaliana to construct transgenic plants, the problem of insufficient drought resistance in maize was solved, and significant drought resistance was achieved, promoting the cultivation of stress-resistant plants.
Patent Information
- Application Number
- CN202410779028.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-17
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2044-06-17
AI Technical Summary
The lack of effective WRKY transcription factor regulation in maize to combat drought stress affects its stress resistance breeding. Existing technologies are insufficient to improve the drought resistance of maize through complex transcription factor regulatory networks.
The ZmWRKY71 gene was isolated and cloned from maize, and introduced into Arabidopsis thaliana via Agrobacterium-mediated transformation to construct transgenic plants and verify their improved tolerance to drought stress.
It improved the drought tolerance of transgenic plants, which showed significant drought resistance and promoted the breeding of new stress-resistant plant varieties.
Smart Images

Figure CN118562819B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering and crop genetic breeding technology, and particularly relates to a corn WRKY transcription factor ZmWRKY71 and an expression product and application thereof. BACKGROUND
[0002] Corn is one of the most important food crops in China, and is widely used as animal feed, silage and industrial products. Moreover, with the gradual improvement of people's living standards in China, the dietary structure is constantly optimized, and the consumption demand of corn also begins to be in a growth trend.
[0003] Plants often encounter various adverse natural environments during growth, such as drought, high salt, low temperature, high temperature and waterlogging, etc. Among them, drought has become one of the main factors restricting corn production in China. Research in the past few decades shows that transcription factors play an indispensable role in various signal pathways for resisting abiotic stress, especially drought stress. Therefore, it can be tried to cultivate new corn varieties with stress resistance by studying the complex regulation network of transcription factors.
[0004] It is found that the drought resistance of corn is closely related to the hormone level in the body, and some transcription factors also have a regulatory effect on the plant height of corn. Among them, the WRKY transcription factor is one of the largest transcription factor families in higher plants. The WRKY protein can inhibit or activate the expression of downstream genes by binding to the W-box (TTGACC / T) in the promoter of the target gene, thereby regulating the growth and development of plants.
[0005] In recent years, some WRKY transcription factors have been reported to regulate the drought resistance of plants in crops such as rice and Arabidopsis, but there are few drought-related reports in the WRKY family of corn. SUMMARY
[0006] The technical problem to be solved by the present application is to provide a corn WRKY transcription factor ZmWRKY71 and an expression product and application thereof, which can improve the drought resistance of plants by overexpressing the transcription factor ZmWRKY71 in the plants, and has important significance for cultivating new plant varieties with stress resistance.
[0007] The present application solves the above technical problems by adopting the following technical solutions:
[0008] A corn WRKY transcription factor ZmWRKY71 The nucleotide sequence of the transcription factor ZmWRKY71 is shown as SEQ ID NO. 1.
[0009] As one of the preferred modes of the present application, the transcription factorZmWRKY71, The amino acid sequence of the expression product is shown as SEQ ID NO. 2.
[0010] As one of the preferred modes of the present application, the expression product of the transcription factor ZmWRKY71 interacts with the W box cis-element, thereby improving the stress resistance of the plant.
[0011] As one of the preferred modes of the present application, the expression product of the transcription factor ZmWRKY71 binds to the DNA core sequence "TGAC" of the W box (TTGACC / T) cis-element.
[0012] An expression product of the above-mentioned corn WRKY transcription factor ZmWRKY71 .
[0013] An expression vector, a recombinant bacterium, a transgenic cell line or an expression cassette of the above-mentioned corn WRKY transcription factor ZmWRKY71 .
[0014] The above-mentioned corn WRKY transcription factor ZmWRKY71 is used in the breeding of stress-resistant plants.
[0015] As one of the preferred modes of the present application, the stress resistance is drought resistance.
[0016] A method for breeding stress-resistant plants, the above-mentioned corn WRKY transcription factor ZmWRKY71 is introduced into a target plant to obtain a transgenic plant; the stress resistance of the transgenic plant is higher than that of the target plant.
[0017] As one of the preferred modes of the present application, the target plant is corn, and the stress resistance is drought resistance.
[0018] The present application has the following advantages compared with the prior art:
[0019] The present application isolates and clones ZmWRKY71 a gene from corn, introduces it into Arabidopsis thaliana by Agrobacterium-mediated transformation method to obtain a transgenic plant, and then verifies that the transgenic Arabidopsis thaliana has improved tolerance to drought stress, which is of great significance for breeding new varieties of stress-resistant plants. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 is a schematic diagram of the amino acid sequence homology alignment of the conserved regions of ZmWRKY71 and other species WRKY family transcription factors in Example 2;
[0021] Figure 2 is an evolutionary tree analysis diagram after the amino acid sequence alignment of ZmWRKY71 and other WRKY transcription factors in Example 2;
[0022] Figure 3 is a schematic diagram of subcellular localization of ZmWRKY71 protein in corn protoplasts (laser confocal microscope observation results for subcellular localization of ZmWRKY71 protein, nuclear localization signal mCherry as a nuclear marker) in Example 3;
[0023] Figure 4 is a PCR detection result of transgenic (ZmWRKY71) T3 generation plants (in the figure, "M": DL2000 Marker; "WT": wild type plant; "L1~15": each transgenic T3 generation plant sample) in Example 5; ZmWRKY71
[0024] Figure 5 is a germination phenotype diagram of transgenic (ZmWRKY71) Arabidopsis under drought conditions (in the figure, "0 mM, 300 mM, 350 mM mannitol MS plate" is used to simulate different drought conditions; "L1, L11, L15" are three selected transgenic plant samples) in Example 6; ZmWRKY71
[0025] Figure 6 is a germination rate statistical diagram of transgenic (ZmWRKY71) Arabidopsis under drought conditions (in the figure, "0 mM, 300 mM, 350 mM mannitol MS plate" is used to simulate different drought conditions; "L1, L11, L15" are three selected transgenic plant samples) in Example 6; ZmWRKY71
[0026] Figure 7 is a root length phenotype diagram of transgenic (ZmWRKY71) Arabidopsis under drought conditions (in the figure, "0 mM, 200 mM, 300 mM mannitol MS plate" is used to simulate different drought conditions; "L1, L11, L15" are three selected transgenic plant samples) in Example 7; ZmWRKY71
[0027] Figure 8 is a root length statistical diagram of transgenic (ZmWRKY71) Arabidopsis under drought conditions (in the figure, "0 mM, 200 mM, 300 mM mannitol MS plate" is used to simulate different drought conditions; "L1, L11, L15" are three selected transgenic plant samples) in Example 7. ZmWRKY71 DETAILED DESCRIPTION
[0028] The following will make a detailed description of the embodiments of the present application, which are implemented on the premise of the technical solutions of the present application, and give detailed implementation manners and specific operation processes, but the protection scope of the present application is not limited to the following embodiments. Meanwhile, in the following embodiments, the methods used are all conventional methods unless otherwise specified; the primers used are all synthesized by Shanghai Shengong Biotechnology Co., Ltd.; sequencing is performed by Shanghai Shengong Biotechnology Co., Ltd.; various restriction endonucleases, ligases, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs and the like used in the experiment are purchased from Takara Company; the reverse transcription kit is purchased from Promega Company; the plasmid extraction kit, gel recovery kit and genomic extraction kit are purchased from Quanshijin Biotechnology Co., Ltd.; the methods are all performed according to the instructions.
[0029] Example 1, transcription factor ZmWRKY71 :
[0030] The present application isolates and clones a gene from corn, the nucleotide sequence of which is shown as SEQ ID NO. 1, and the coding region amino acid sequence is shown as SEQ ID NO. 2. ZmWRKY71
[0031] Example 2, sequence homology and homology analysis of transcription factor ZmWRKY71 :
[0032] According to the sequence sequencing results, sequence alignment is performed in the NCBI database, and it is found that the cloned gene sequence has the closest homologous relationship with the WRKY family transcription factor. By aligning the ZmWRKY71 protein of the transcription factor and the protein sequences of other WRKY transcription factor family members, it is analyzed that the zinc finger structure type of the ZmWRKY71 protein is C2H2 type, and according to the structural characteristics of the DNA binding domain, the ZmWRKY71 protein belongs to the first WRKY transcription factor family (as shown in ZmWRKY71 ). In order to further analyze the systematic evolution relationship of the ZmWRKY71 protein and other WRKY transcription factors, the WRKY proteins of different plants are analyzed for the systematic evolution relationship with ZmWRKY71 (as shown in Figure 1 ). Figure 2
[0033] It can be known that: ZmWRKY71 has high homology with TaWRKY2, TaWRKY1 and OsWRKY30, and has functional similarity. According to the related literature reports, TaWRKY2, TaWRKY1 and OsWRKY30 are all related to drought stress, which indicates that ZmWRKY71 may be involved in drought stress response.
[0034] Example 3, subcellular localization of ZmWRKY71 protein
[0035] 1. Construction ZmWRKY71 Subcellular localization fusion vector
[0036] Using pCAMBIA1305 (p1305) as the vector backbone and GFP (green fluorescent protein) as the reporter gene, p1305- was constructed. ZmWRKY71 -GFP fusion expression vector. When designing the primers for this gene, remove... ZmWRKY71 The gene's stop codon. The upstream restriction enzyme site is XbaI, and the downstream restriction enzyme site is BamHI. Primers were synthesized by Sangon Biotech and their sequences are as follows:
[0037] 71-1305F:GCTCTAGAATGCTGCAGCAGCAGCCG;
[0038] 71-1305R: CGGGATCCGAACAGGAGTTGCTGCTCGAAA.
[0039] 2. Protoplast transformation
[0040] (1) B73 corn seeds were grown in the dark for about 2 weeks. 1.5g of leaves from the yellowed seedlings with good growth were taken, the veins were removed, and the leaves were cut into 0.2mm thin strips with a scalpel in a dark environment.
[0041] (2) Place the cut leaf strips into the prepared enzymatic hydrolysate (15 mL) and use tweezers (pipe tip) to completely soak them.
[0042] (3) Use a vacuum pump to extract in the dark for 30 minutes to accelerate the full contact between the enzyme hydrolysate and the cell wall.
[0043] (4) Incubate at room temperature on a horizontal shaker at 40 rpm for 6 h in the dark.
[0044] (5) Pre-cool a certain amount of W5 solution and an empty sterile 50mL round-bottom centrifuge tube (ice bath).
[0045] (6) Rinse W5 with a 100-mesh metal sieve and filter the diluted enzymatic hydrolysate containing protoplasts.
[0046] (7) Reduce the acceleration and deceleration of the refrigerated centrifuge, centrifuge at 100g and 4℃ for 2min, remove the supernatant, add 5mL of W5 solution pre-cooled on ice, and slowly tilt and rotate the centrifuge tube to mix it.
[0047] (8) Place on ice in the dark for 30 minutes, then centrifuge again at 100g and 4℃ for 2 minutes.
[0048] (9) Darkly remove W5 solution as much as possible, and add appropriate amount of MMG solution (e.g. 300 μL) according to the amount of precipitate, and resuspend the protoplasts in the same way. Check the state and quantity of protoplasts in the solution under a microscope on a hemocytometer, so that the final concentration is not less than 1 x 10 6 .
[0049] (10) Add 5 μg of recombinant plasmid DNA (the concentration is preferably more than 500 ng / μL) into a 2 mL round-bottom EP tube.
[0050] (11) Add 100 μL of protoplasts (2 x 10 4 ), and mix gently.
[0051] (12) Add 120 μL (the total volume of step 11 + step 12) of PEG4000 solution, and mix gently.
[0052] (13) Perform induction on ice in the dark, and select the transformation time according to the expression amount, generally 1 h.
[0053] (14) Dilute the transformation mixture with 480 μL (four times the volume added in step 12) of W5 solution at room temperature, and mix gently to terminate the transformation reaction.
[0054] (15) Centrifuge for 2 min at room temperature, and try to remove the supernatant, then rinse with W5 once, and centrifuge to remove the supernatant in the same way.
[0055] (16) Resuspend the cells with W1 / W5 solution, then transfer to a multi-well tissue culture dish, and wrap with tin foil paper.
[0056] (17) Culture the protoplasts at room temperature for 24-36 h, then observe with a laser confocal microscope.
[0057] The results are shown in Figure 3 , (nuclear localization signal mCherry as a nuclear marker). It can be seen that: the ZmWRKY71-GFP fusion protein is located in the nucleus, which is consistent with the characteristics of transcription factors. Figure 3
[0058] Example 4, detection of transgenic ZmWRKY71 Arabidopsis:
[0059] Construct a plant expression vector pCAMBIA1301a- ZmWRKY71 , introduce it into Columbia wild-type Arabidopsis thaliana by Agrobacterium-mediated genetic transformation method of Arabidopsis thaliana, and obtain transgenic plants by hygromycin screening. Then extract Arabidopsis thaliana genomic DNA, and perform PCR detection to screen homozygous transgenic Arabidopsis thaliana.
[0060] Example 5, detection of transgenicZmWRKY71 Positive identification of T3 generation plants:
[0061] 1. Genomic DNA was extracted using the CTAB method, with the following steps:
[0062] Take a 2cm leaf and place it in a 2mL centrifuge tube. Add a small steel ball, freeze quickly in liquid nitrogen, and then place in a grinder. Shake at 45Hz for 2 minutes. After thorough shaking, add 800µL of CTAB extraction buffer, vortex to mix, and incubate in a 65℃ water bath for 1 hour, turning several times during incubation. Add an equal volume of chloroform-isoamyl alcohol (24:1) to a fume hood and vortex to mix. Centrifuge at 12000rpm for 10 minutes, carefully aspirate about 700µL of the supernatant, transfer to a 1.5mL centrifuge tube, add an equal volume of isopropanol to precipitate the nucleic acid, and let stand for 2 minutes. Then centrifuge at 12000rpm for 10 minutes, discard the supernatant, add 500µL of 70% alcohol and gently wash twice. Finally, discard the alcohol, air dry in a fume hood, add 100µL of deionized water, and store at -20℃.
[0063] 2. Primer design
[0064] ZmWRKY71 The full-length CDS of the gene is 1143 bp. Specific primers were designed using Primer Premier 5.0 software and synthesized by Sangon Biotech. The primer sequences are as follows:
[0065] 71-F: ATGCTGCAGCAGCAGCCGTGG;
[0066] 71-R: TCAGAACAGGAGTGTGCTGCTCGAAAA.
[0067] The amplification length is 1143 bp.
[0068] 3. PCR amplification conditions
[0069] The PCR amplification reaction was performed using the following reaction system (25 µL): Primer STAR Max premix (2×) 12.5 µL, primers 71-F and 71-R 1 µL each, genomic DNA 2 µL, and sterile water 8.5 µL.
[0070] After adding the sample, centrifuge at low speed to mix, and then perform the reaction in a PCR instrument. The reaction procedure is as follows:
[0071] After pre-denaturation at 98 °C for 10 minutes, denature at 98 °C for 10 seconds, anneal at 60 °C for 5 seconds, extend at 72 °C for 1 minute, run for 35 cycles, and finally extend at 72 °C for 10 minutes. Store the PCR product at 4 °C.
[0072] genetically modified( ZmWRKY71PCR detection results of T3 generation plants are shown in Figure 4 Figure, wherein "WT" represents wild type plants; "L1~15" represents Arabidopsis samples collected from different plants after Agrobacterium infection). It can be seen from Figure 4 that the transgenic Arabidopsis lines appear bright single bands with a size of about 1143bp, while the WT has no band, indicating that the transgenic Arabidopsis lines are successfully transformed and are all homozygous plants.
[0073] Example 6, transgenic ( ZmWRKY71 ) Germination rate determination of T3 generation plants:
[0074] Arabidopsis seeds of WT wild type plants and ZmWRKY71 transgenic lines were surface sterilized with 12% sodium hypochlorite and cultured in the dark at 4°C for 72 hours. The sterile seeds of WT and transgenic lines were sown on MS plates supplemented with 0mM, 300mM and 350mM mannitol and grown at 22°C in a growth chamber with a light cycle of 16 / 8 hours light / dark. Then the germination rate (cotyledonous seedlings) was detected after 7 days of growth.
[0075] The phenotypes and statistical results of germination rate are shown in Figure 5 , Figure 6 It can be seen from Figure 5 , Figure 6 that on the MS medium without mannitol, both WT and transgenic lines can grow normally and all grow two leaves; under the treatment of 300mM and 350mM mannitol simulated drought, the germination rate is reduced, but the germination rate of the transgenic lines is significantly higher than that of the WT, indicating that the ZmWRKY71 transgenic lines are more drought-tolerant than the wild type.
[0076] Example 7, transgenic ( ZmWRKY71 ) Root growth determination of T3 generation plants:
[0077] First, the seeds of WT and transgenic lines were sown on MS plates, then grown at 22°C with a light cycle of 16 / 8 hours light / dark for 4 days. Then, the four-day-old seedlings were transferred to fresh MS medium supplemented with 0mM, 200mM and 300mM mannitol. Then the root length of the seedlings was measured after 7 days of growth on vertical plates.
[0078] The phenotypes and statistical results of root length are shown in Figure 7 , Figure 8 It can be seen from Figure 7 , Figure 8It can be known that: in 0mmol / L mannitol culture medium, the root length of each strain is consistent; with the increase of mannitol concentration, the root growth of Arabidopsis is inhibited, the root length of WT and transgenic Arabidopsis strain has the trend of shortening, and under the treatment of 200mmol / L and 300mmol / L mannitol, the root length of transgenic Arabidopsis strain is obviously longer than that of WT, which shows that the transgenic strain is more drought-resistant than the wild type.
[0079] In conclusion: the gene isolated and cloned from corn in the application has important effect on improving the drought stress tolerance of plants, and the research has important significance for cultivating new varieties of stress-resistant plants. ZmWRKY71
[0080] In addition, through the binding property experiment with W box (TTGACC / T), it is found that the transcription factor ZmWRKY71 can interact with W box (TTGACC / T) cis-element, and the DNA core sequence combined with the W box cis-element is "TGAC", therefore it is speculated that the transcription factor ZmWRKY71 can improve the stress resistance of plants by interacting with the W box cis-element.
[0081] The above only describes the preferred embodiments of the application and is not intended to limit the application, and any modification, equivalent replacement and improvement made within the spirit and principle of the application shall be included in the protection scope of the application.
Claims
1. A kind ZmWRKY71 The application of genes in breeding drought-resistant maize is characterized by, The ZmWRKY71 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. A method for cultivating stress-resistant plants, characterized in that, Will ZmWRKY71 Genes are introduced into a target plant to obtain a transgenic plant; the transgenic plant exhibits higher stress resistance than the target plant; ZmWRKY71 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the target plant is maize; the stress resistance is drought resistance.