A method for constructing an animal model of polycystic ovary syndrome and its application

Abstract

The present invention discloses a method for constructing an animal model of polycystic ovary syndrome and its application. The polycystic ovary syndrome animal model is constructed by knocking out or silencing the pcbp2 gene of an experimental organism. In the present invention, the inventors found that pcbp2 knockout led to the occurrence of PCOS in female zebrafish, and further found that one of the reasons for the occurrence of PCOS was that pcbp2 knockout significantly enhanced the inflammatory response in the ovaries of female zebrafish. The present invention also proposes that pcbp2 plays an indispensable role in maintaining the normal physiological function of the ovary, lays a preliminary theoretical foundation for further studying the specific mechanism of action of PCBP protein in PCOS and ovarian inflammation, and provides a good animal model for exploring the normal physiological function of PCBP protein in vertebrates and its role in different diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of disease model construction, and in particular to a method for constructing a polycystic ovary syndrome animal model and application thereof. Background Art

[0002] Poly(C)-binding proteins (PCBP) are a family of widely expressed RNA-binding proteins that have high affinity for poly(C) sequences and can specifically bind to them and interact with them. In mammals, the PCBP protein family mainly includes two subgroups: PCBP (PCBP1, PCBP2, PCBP3, PCBP4) and heterogeneous nuclear ribonucleoprotein (hnRNP) K. The proteins in this family all contain three hnRNP K homology (KH) domains of approximately 70 amino acids in length, which can bind to poly(C) sequences to perform a variety of functions and can also perform transcriptional and post-transcriptional regulation in cells, including mRNA selective splicing, regulation of mRNA stability, and translational regulation, and have been shown to play a role in a variety of diseases.

[0003] Zebrafish (Danio rerio) is a small tropical freshwater fish. It is currently considered to be one of the important model organisms in the study of vertebrate development. It has been widely used in the fields of embryonic development, tissue regeneration, nervous system development, immune response, drug screening and disease models, and plays an important role in biomedical research. Zebrafish has the advantages of small size, fast reproduction, in vitro embryonic development, transparent embryos, strong tissue regeneration ability, easy breeding, low experimental cost and short breeding cycle; and compared with mammalian models such as mice, the mutation or knockout of maternal genes during zebrafish development is not easy to cause embryonic lethality, and the occurrence and development of diseases can be tracked in real time in vivo. In addition, zebrafish has a clear genetic background, mature gene editing methods, and strong operability, which makes it easy to implement modeling technologies such as gene editing, physical and chemical mutagenesis, transgenic and tumor cell implantation. The homology of zebrafish genes with human genes is as high as 87%. Generally speaking, most oncogenes, tumor suppressor genes and cell cycle regulatory genes are extremely highly conserved in humans and zebrafish, and their biological functions are similar. Therefore, zebrafish can be used as an important tool to study human-related genes. In addition, CRISPR / Cas9 (Clustered regularly interspaced short palindromic repeat / CRISPR-associatednuclease 9) is currently the most mainstream gene editing technology. Due to its higher construction efficiency, lower cost, simpler method, and the ability to target multiple genes at the same time, it has been widely used in the preparation of various cell and animal models, providing a useful tool for studying the occurrence and development of diseases, screening therapeutic targets and drug effects, etc.

[0004] Polycystic Ovary Syndrome (PCOS) is the most common endocrine disease in women, with an incidence rate of about 5% to 18% in women of childbearing age worldwide. It has many adverse reproductive and metabolic effects on women with the disease, such as endocrine diseases, metabolic disorders, reproductive disorders and psychological problems. PCOS usually manifests as obesity, hirsutism, menstrual disorders, high androgen levels, ovarian cysts, ovulation disorders, etc. Its pathogenesis is complex, with multifactorial and heterogeneous causes, and may be the result of the interaction between genetic, metabolic and environmental factors. The dominant and secondary effects of these factors may vary from woman to woman. PCOS is caused by metabolic disorders or dysfunction of the hypothalamus-pituitary-ovarian axis, with specific symptoms such as steroidogenesis disorders, insulin resistance, fat deposition (especially in the abdominal area) and hyperandrogenemia, and these symptoms are interrelated and ultimately lead to PCOS. For example, fat deposition or increased BMI will trigger the ovaries to release more androgens, leading to excessive androgen and hyperandrogenism; fat deposition will also lead to insulin resistance. Insulin resistance and excessive androgen secretion will lead to obesity and type 2 diabetes, which will lead to irregular menstrual cycles, endocrine disorders, and then cause ovulation disorders, infertility, and even psychological diseases such as depression and anxiety. In addition, PCOS can also lead to a series of complications, such as type 2 diabetes (T2DM), obesity, infertility, hypertension, cardiovascular disease, endometrial cancer, etc. These complications may be related to the pathogenesis of PCOS, or they may be secondary changes of PCOS.

[0005] PCBPs play an important role in the occurrence and development of tumors. Although the molecular mechanisms by which changes in their expression levels regulate tumors have been studied, there are almost no reports on the normal physiological functions of PCBPs in the body and their correlation with polycystic ovary syndrome, and thus there is a lack of relevant animal models of polycystic ovary syndrome. Summary of the invention

[0006] The present invention aims to solve at least one of the above-mentioned technical problems existing in the prior art. To this end, the object of the present invention is to provide a method for constructing an animal model of polycystic ovary syndrome and its application. The present invention successfully constructs a pcbp2 knockout animal model through a model organism (zebrafish), and successfully enables the pcbp2 knockout strain zebrafish to develop normally to adulthood. It is also found that pcbp2 knockout leads to the occurrence of PCOS in female zebrafish, and further finds that one of the reasons for the occurrence of PCOS is that pcbp2 knockout significantly enhances the inflammatory response in the ovaries of female zebrafish. The present invention also proposes that pcbp2 plays an indispensable role in maintaining the normal physiological function of the ovary, lays a preliminary theoretical foundation for further studying the specific mechanism of action of PCBP protein in PCOS and ovarian inflammation, and provides a good animal model for exploring the normal physiological function of PCBP protein in vertebrates and its role in different diseases.

[0007] The first aspect of the present invention provides a method for constructing a disease animal model, comprising the following steps:

[0008] Knockout or silence the pcbp2 gene in experimental organisms.

[0009] In some embodiments of the present invention, at least one of the 12 exons of the pcbp2 gene of the experimental organism is knocked out or silenced.

[0010] In some embodiments of the present invention, the fourth exon of the pcbp2 gene of the experimental organism is knocked out or silenced.

[0011] In some embodiments of the present invention, the site corresponding to the fourth exon of the pcbp2 gene is shown in SEQ ID NO:1.

[0012] In some embodiments of the present invention, the knockout or silencing comprises knocking out or silencing using at least one gene editing technology or physicochemical mutagenesis technology selected from RNA interference, plasmid-mediated gene knockout, embryonic stem cell knockout, CRISPR system, transcription activator-like effector nuclease technology (TALENs) or zinc finger nuclease (ZFN) technology.

[0013] Of course, those skilled in the art may also use other technologies that can achieve silencing or knockout of a specified gene, including but not limited to the above-mentioned RNA interference, plasmid-mediated gene knockout, embryonic stem cell knockout, CRISPR system, TALENs and ZFN.

[0014] In some embodiments of the invention, the construction method uses the CRISPR system for knockout.

[0015] In some embodiments of the invention, the CRISPR system comprises CRISPR-Cas9.

[0016] Of course, those skilled in the art can select other CRISPR systems according to usage requirements, including but not limited to Cas9, Cas12a, Cas13a and Cas13b.

[0017] In some embodiments of the present invention, the gRNA primers in the CRISPR system are shown as SEQ ID NOs: 2 and 3.

[0018] Of course, those skilled in the art can design other gRNA primers with equivalent effects according to usage requirements, so as to cooperate with the corresponding CRISPR system and the corresponding target site.

[0019] In some embodiments of the invention, the disease comprises polycystic ovary syndrome and / or its related disease conditions.

[0020] In some embodiments of the invention, PCOS-related disease conditions include, but are not limited to, subfertility, ovarian inflammation, ovarian enlargement, ovarian cyst-like changes, abnormal increase in atretic follicles, abnormal follicular development, ovarian fibrosis, abnormal gonadotropin secretion, and abnormal androgen levels.

[0021] In some embodiments of the invention, the organism comprises an animal.

[0022] In some embodiments of the invention, the animal comprises a fish.

[0023] In some embodiments of the invention, the animal is a zebrafish.

[0024] In the present invention, the organism generally refers to any species that can survive to adulthood after knocking out or silencing the pcbp2 gene, including but not limited to the above-mentioned zebrafish. As a model organism known in the art, zebrafish can represent its versatility and feasibility in a wide range of species.

[0025] In some embodiments of the present invention, the construction method specifically includes: synthesizing gRNA, mixing it with the Cas9 system and injecting it into the embryo, and obtaining it after sequencing, screening and typing.

[0026] The second aspect of the present invention provides the use of the disease model obtained by the construction method described in the first aspect of the present invention in drug screening.

[0027] In some embodiments of the present invention, the pcbp2 gene of the disease model is mutated.

[0028] In some embodiments of the present invention, the mutation is a base addition or deletion.

[0029] In some embodiments of the present invention, compared with the wild-type pcbp2 gene, the pcbp2 gene of the disease model has at least one base added or deleted.

[0030] In some embodiments of the present invention, compared with the wild-type pcbp2 gene, the pcbp2 gene of the disease model has 5-25 bases added or deleted.

[0031] In some embodiments of the present invention, compared with the wild-type pcbp2 gene, the pcbp2 gene of the disease model has 8-20 bases added or deleted.

[0032] It should be understood that the purpose of the present invention is not to limit the number of pcbp2 gene additions or deletions in the disease model. In the art, any base change (change) that can achieve frameshift mutation should fall within the scope of protection of the present invention. The pcbp2 gene has 954 bases, and any base deletion and addition will actually bring about substantial changes in expression. The present invention cannot exhaustively enumerate the frameshift mutations brought about by any number of base changes, but those skilled in the art should understand that such changes are easy to achieve and do not require additional creative work.

[0033] In some embodiments of the present invention, compared with the wild-type pcbp2 gene, the pcbp2 gene of the disease model has 8 more bases.

[0034] In some embodiments of the present invention, compared with the wild-type pcbp2 gene, the pcbp2 gene of the disease model is missing 20 bases.

[0035] In the present invention, the wild-type zebrafish pcbp2 gene normally encodes 318 amino acids and contains three KH domains with a length of about 70 amino acids, while the pcbp2 constructed in the present invention +8bp and pcBP2 Δ20bp These two mutations are caused by the addition or deletion of bases in the pcbp2 genome, which can cause frameshift mutations in the gene, leading to premature termination of protein translation and the production of truncated proteins. +8bp The mutant pcbp2 gene encodes 76 amino acids, pcbp2 Δ20bp The mutant pcbp2 gene encodes 69 amino acids. Both mutations cause the translation of pcbp2 protein to terminate prematurely at the first KH domain, ultimately resulting in the loss of three complete KH domains that are required for gene function.

[0036] The third aspect of the present invention provides the use of the disease model obtained by the construction method described in the first aspect of the present invention in the preparation of a polycystic ovary syndrome risk prediction product.

[0037] In some embodiments of the present invention, the risk of PCOS is analyzed by constructing a disease model that fits the subject's condition and comparing it with the disease model obtained by the construction method described in the first aspect of the present invention.

[0038] The beneficial effects of the present invention are:

[0039] 1. The present invention successfully constructed two different pcbp2 gene knockout zebrafish strains, and these pcbp2 knockout zebrafish strains can grow and develop normally in the embryonic stage and survive to adulthood, providing a good animal model for further research on the gene function of pcbp2.

[0040] 2. The pcbp2 gene knockout zebrafish strain in the present invention can be used as a model of polycystic ovary syndrome, with good fitting effect and simple construction, which lays a preliminary theoretical foundation for further studying the specific mechanism of action of PCBP protein in PCOS and ovarian inflammation, and provides a good model support for exploring the normal physiological function of PCBP protein in vertebrates and its role in different diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the zebrafish pcbp2 gene knockout model established using CRISPR / Cas9 technology, where A is the knockout target located on the fourth exon of the zebrafish pcbp2 gene, marked in blue; red is the protospacer adjacent motif (PAM); B is the comparison of the wild-type and mutant pcbp2 genomic DNA sequences, the sequences of the two mutants are 8 bases more (pcbp2 +8bp ) and a 20-base deletion (pcbp2 Δ20bp ), C is the peak diagram of genomic DNA sequencing results, and the red box is the site of gene mutation.

[0042] Figure 2 Schematic diagram of the protein structure of wild-type Pcbp2 and the predicted protein structure of mutant zebrafish strains.

[0043] Figure 3 The results of Western blot detection of Pcbp2 protein content in wild-type and mutant zebrafish.

[0044] Figure 4 For the two mutant lines, pcbp2 + / -A statistical graph showing the genotype distribution of offspring produced by selfing of heterozygous zebrafish. The results are presented as percentages, and the numbers on the bar graph represent the actual number of zebrafish embryos counted.

[0045] Figure 5 This is a morphological comparison of wild-type and mutant zebrafish of different ages. The scale bar in the figure is 0.2 mm; dpf: days after fertilization; mpf: months after fertilization.

[0046] Figure 6 Statistical graphs of the number of eggs laid by female zebrafish (A) and the survival of fertilized eggs (B), where ns means no statistical difference, *p<0.05, **p<0.01, ***p<0.001.

[0047] Figure 7 pcBP2 + / + and pcBP2 - / - Ovarian in vivo morphology, where A is pcbp2 + / + and pcBP2 +8bp The morphology of ovarian tissue at 6 mpf, the white arrows indicate a few follicle necrosis in the ovary; B is pcbp2 + / + and pcBP2 +8bp The morphology of ovarian tissue at 12 mpf, the white arrow indicates the cystic mass in the ovary; C is pcbp2 + / + and pcBP2 +8bp The morphology of ovarian tissue at 15 mpf. The white arrow indicates that the entire ovarian structure is necrotic and a large amount of white floccules are formed; D is pcbp2 + / + and pcBP2 Δ20 The morphology of ovarian tissue at 12 mpf. The white arrows indicate follicular necrosis and cystic masses in the ovaries. The number in the upper right corner of the picture represents the proportion of individuals with this morphology to all individuals tested. The scale in the figure is 1 mm.

[0048] Figure 8 pcBP2 + / + and pcBP2 - / - Comparison of body weight and gonad weight of female zebrafish, where AC represents pcbp2 at different ages. + / + and pcBP2 - / - Comparison of individual weight (A), ovary weight (B), and gonadal index (GSI, ovary / body weight) (C) of female zebrafish. D is a comparison of pcbp2 at different ages. + / + and pcBP2 - / - Statistical results of the number of follicles in the ovaries of female zebrafish, ns means no statistical difference, *p<0.05, **p<0.01, ***p<0.001.

[0049] Fig. 9 pcBP2 + / + and pcBP2 - / - HE staining of ovarian sections; A and B are 15 mpf pcBP2 + / + and pcBP2 - / - HE staining of ovarian tissue sections. The number in the lower left corner of the picture represents the proportion of individuals with this morphology in all the individuals tested. a, b1-b3 are enlarged images of the boxes in the figure. a is the normal ovarian structure of wild-type zebrafish, and b1-b3 show the images of atretic follicles (AF), increased stromal cells (orange asterisks), liquefaction of yolk granules (blue arrows), and dissolution of the zona pellucida (green arrows) in pcbp2- / - ovaries, respectively. The scale bar in the figure is 200μm.

[0050] Fig.10 The levels of testosterone (Testo) (A), follicle-stimulating hormone (FSH) (B), luteinizing hormone (LH) (C) and the ratio of LH / FSH (D) in ovarian tissues at different ages. ns indicates no statistical difference, *p<0.05, **p<0.01.

[0051] Fig.11 Figure 2 is the expression of PCOS-related susceptibility genes in zebrafish ovarian tissue. ns indicates no statistical difference. *p<0.05, **p<0.01, ***p<0.001.

[0052] Fig.12 The expression of SAA in ovarian tissue of zebrafish at different ages. NS indicates no statistical difference, **p<0.01, ***p<0.001.

[0053] Fig.13 is the expression of pro-inflammatory chemokine cxcl8a in ovarian tissues of different ages, where A is the expression level of cxcl8a mRNA in ovarian tissues of zebrafish of different ages; B is the expression level of pcbp2 detected by ELISA kit + / + and pcBP2 - / - The concentration of pro-inflammatory chemokine CXCL8A in ovarian tissue, ns indicates no statistical difference, *p<0.05.

[0054] Fig.14 pcBP2 + / + and pcBP2 - / - Transcriptome sequencing analysis results of ovarian tissue, where A is pcbp2 + / + and pcBP2 - / - Volcano plot of differentially expressed genes in ovarian tissue transcriptome sequencing; B is the top 20 pathways of differentially expressed genes in GO biochemical process functional enrichment, and the underlined ones are pathways related to inflammatory response.

[0055] Fig.15 The expression of genes related to inflammatory response in the ovaries of zebrafish with pcbp2 knockout. A is the transcriptome sequencing result, and B is the qPCR test result. The results were normalized to the expression level of the housekeeping gene eef1a1l1 and expressed as mean ± SD, *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below by specific examples. Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or can be obtained by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0057] Materials and Definitions

[0058] In the following examples, the zebrafish models used were all transformed from wild-type zebrafish AB strains. - / - and its sister line pcbp2 + / + All were raised in the zebrafish platform of the Animal Experiment Center of the North Campus of Sun Yat-sen University, with an ambient temperature of 28°C, a pH value of 7.5, 14 hours of light per day (8:00am-10:00pm), and 10 hours of darkness. Zebrafish were fed three times a day.

[0059] CRISPR / Cas9 gene editing in zebrafish

[0060] (1) Synthesis of gRNA:

[0061] The CCATCTTCAAGGCCTTCTCC (SEQ ID NO: 1) sequence (5'-3') on the fourth exon of the zebrafish pcbp2 gene was selected as the knockout site, and specific gRNA primers were designed:

[0062] Upstream primer: 5'-TTCTAATACGACTCACTATAGGAGAAGGCCTTGAAGATGGGTTTTAGAGCTAGAAATAG-3' (SEQ ID NO: 2);

[0063] Downstream primer: 5'-AGCACCGACTCGGTCCACT-3' (SEQ ID NO: 3).

[0064] PCR amplification was performed using the gRNA plasmid (commercially available PMD 19-T vertor) as a template. The PCR system was as follows: 0.5 μL (10 ng) of plasmid template, 1 μL each of upstream primer and downstream primer, and iProof TM DNA polymerase 0.5μL, 5×iProof HFBuffer 10μL, 10mM dNTP 1μL, ddH2O to 50μL. PCR reaction program is 98℃, 30 seconds; 98℃, 10 seconds, 60℃, 30 seconds, 72℃, 30 seconds, 36 cycles; 72℃, 10 minutes. After PCR amplification, a product of about 125bp was obtained, which was verified by DNA agarose gel electrophoresis and confirmed to be a specific single band.

[0065] The PCR product was purified and recovered (using a commercially available agarose gel DNA recovery kit). Then, a commercially available kit (Kangwei Century) was used for transcription to obtain the transcription product. All operations were performed according to the instructions.

[0066] The gRNA in the obtained transcription product was purified and recovered using the Ambion RNA recovery kit.

[0067] (2) Microinjection

[0068] The day before the injection, wild-type zebrafish AB strains were paired in a ratio of one male to one female, placed in a breeding tank and separated by a transparent baffle. The baffle was removed half an hour before the injection the next morning to allow fertilization to obtain wild-type zebrafish embryos. Cas9 mRNA and gRNA were mixed and injected into zebrafish embryos at the one-cell stage. The injected zebrafish embryos were placed in an incubator and cultured until 24 hours after fertilization. Ten zebrafish embryos were taken as a group to extract genomic DNA for PCR amplification and Sanger sequencing.

[0069] Based on the sequencing results, we analyzed whether frameshift mutation occurred at the target site and the mutation efficiency, and selected a batch of zebrafish embryos (F0 generation) with higher mutation efficiency to continue breeding until sexual maturity.

[0070] (3) Genotyping:

[0071] The chimeric mutant F0 generation was hybridized with the wild-type zebrafish AB strain, and the genotype of the offspring was analyzed by gene sequencing.

[0072] The specific steps are:

[0073] DNA extraction: Take 2 scales of adult zebrafish or zebrafish embryos in an EP tube, add 30 μL of PCR buffer containing proteinase K (500 μg / mL, Roche), lyse in a 55°C water bath for 4 h, and finally use a 98°C metal bath for 12 minutes to inactivate proteinase K to obtain zebrafish genomic DNA.

[0074] PCR amplification: Using the genomic DNA extracted above as a template, PCR was performed using pcbp2 genomic sequencing primers to obtain an amplified product. The pcbp2 genomic sequencing primers used were:

[0075] Pcbp2-gRNA2-genome-F:5'-GCATTTACTGTTCAGCGGTCTTC-3' (SEQ ID NO: 16);

[0076] Pcbp2-gRNA2-genome-R:5'-TCCTTTCTGGCTGATCTTTCTGAG-3' (SEQ ID NO: 17).

[0077] The amplified products were subjected to DNA agarose gel electrophoresis and genomic Sanger sequencing (BGI, China).

[0078] The heterozygous zebrafish (F1 generation) with hereditary frameshift mutations were screened out through typing results and continued to breed until sexual maturity. The male and female heterozygous zebrafish that could produce the same nonsense mutation were self-fertilized to obtain the F2 generation, which included the sister line (pcbp2 + / + ), heterozygous (pcbp2 + / - ) and homozygous mutants (pcbp2 - / - ).

[0079] After Sanger gene sequencing analysis, it was confirmed that two different types of mutant zebrafish strains were obtained, namely, pcbp2 with an additional 8 bases. +8bp and pcBP2 with a 20-base deletion Δ20bp ( Figure 1 B and Figure 1 C).

[0080] The wild-type zebrafish pcbp2 gene normally encodes 318 amino acids and contains three KH domains of approximately 70 amino acids in length. +8bp and pcBP2 Δ20bp These two mutations are caused by the addition or deletion of bases in the pcbp2 genome, which can cause frameshift mutations in the gene, leading to premature termination of protein translation and the production of truncated proteins. +8bp The mutant pcbp2 gene encodes 76 amino acids, pcbp2 Δ20bpThe mutant pcbp2 gene encodes 69 amino acids. Both mutations lead to the premature termination of pcbp2 protein translation at the first KH domain, resulting in the loss of three complete KH domains that play a role in gene function ( Figure 2 ), which seriously disrupts the normal function of the pcbp2 gene.

[0081] In order to verify the knockout effect of the pcbp2 gene, the inventors further collected tissue proteins from wild-type and mutant zebrafish, and analyzed the Pcbp2 protein content in their bodies by Western blot detection (with β-Tubulin as an internal reference).

[0082] The results are as follows Figure 3 As shown, it can be found that the Pcbp2 protein with a molecular weight of about 33 kDa can be detected in the wild-type zebrafish, but the Pcbp2 protein cannot be detected in the mutant zebrafish, which indicates that the established pcbp2 knockout strain zebrafish successfully simulates the loss of Pcbp2 protein in vivo. Therefore, it can be explained that this embodiment successfully constructed two mutant zebrafish with pcbp2 gene knockout.

[0083] Effects of pcbp2 knockout on normal development of embryonic zebrafish

[0084] In earlier studies, mice with knockout of Pcbp1 and Pcbp2 genes could not survive to the embryonic stage. Therefore, the inventors observed and counted the embryonic growth of the pcbp2 knockout strain of zebrafish obtained above to determine whether knocking out pcbp2 would affect the growth and development of zebrafish in the embryonic stage.

[0085] In order to confirm whether the embryonic stage of pcbp2 mutants is affected, the inventors counted the heterozygous self-fertilized progeny of the two mutant strains (pcbp2 +8bp : 155, pcbp2 Δ20bp The specific experimental method is: collect zebrafish embryos 3 days after fertilization, extract their genomic DNA according to the method in the above embodiment, perform Sanger gene sequencing, confirm their genotypes and perform statistics.

[0086] The results are as follows Figure 4 And as shown in Table 1.

[0087] Table 1 PCBP2 in two mutant lines + / - Genetic profile of offspring produced by self-fertilization of heterozygous zebrafish

[0088] + / + + / - - / - n <![CDATA[X 2 ]]> P Theoretical value 25 50 25 100 - - <![CDATA[pcbp2 +8bp ]]> 35 85 35 155 0.57 0.75 <![CDATA[pcbp2 Δ20bp ]]> 42 83 47 172 0.18 0.92

[0089] It can be found that the genotype distribution ratios of the heterozygous self-fertilization offspring of the two mutant lines are consistent with the theoretical ratios of Mendel's law of inheritance, indicating that the pcbp2 gene knockout zebrafish strain established in the above embodiment has no off-target effects and pcbp2 - / - There was no homozygous lethality in the offspring.

[0090] At the same time, the inventors further compared the morphology of wild-type and mutant zebrafish at different ages (embryonic, juvenile and adolescent stages). Figure 5 As shown in Figure 2, there is no significant difference between the two.

[0091] In summary, the above embodiments can illustrate that two pcbp2 gene knockout zebrafish strains were successfully constructed, and the pcbp2 knockout zebrafish strains can grow and develop normally in the embryonic stage and survive to adulthood, providing a good animal model for further research on the gene function of pcbp2.

[0092] Feasibility of pcbp2 knockout zebrafish as a model of polycystic ovary syndrome

[0093] (1) PCBP2 knockout leads to reduced fertility in female zebrafish

[0094] When breeding pcbp2 knockout strain zebrafish, the inventors found that the female zebrafish had poor egg-laying ability. Combined with the result that pcbp2 was highly expressed in the zebrafish ovaries, the inventors speculated that knocking out the pcbp2 gene would affect the fertility of female zebrafish. Therefore, the inventors further monitored the fertility of female zebrafish of different ages through experiments.

[0095] In this example, wild-type and pcBP2 cells of different ages were used. - / - Female zebrafish were naturally mated with wild-type male zebrafish with normal fertility and monitored continuously for more than three weeks. The average number of eggs laid by each female zebrafish after each mating and the embryo survival rate 24 hours after successful fertilization were then counted.

[0096] The specific steps are as follows: wild-type female fish and mutant female fish of different ages and wild-type male fish with normal fertility are randomly selected for fertility testing. On the afternoon of the day before breeding, wild-type male fish are paired with wild-type female fish, and wild-type male fish are paired with mutant female fish, and placed in spawning tanks and separated by partitions. At eight o'clock the next morning, take out the baffle and let the male and female fish chase each other and spawn naturally. After the breeding is over, collect all the eggs and record the total number of eggs and fertilization status. Remove the unfertilized eggs and continue to culture, and record the survival of the fertilized eggs 24 hours after fertilization. Each experimental group with different genotypes has at least 10 pairs of naturally paired male and female zebrafish, and monitor them continuously for more than three weeks.

[0097] The results are as follows Figure 6 By comparing the spawning of female zebrafish of the same age, it can be found that pcbp2 - / - When female zebrafish reach sexual maturity 4 months post-fertilization (mpf), their spawning capacity and follicle quality are not significantly different from those of wild-type female zebrafish. However, from 6 mpf onwards, each pcbp2 - / - - The average number of eggs laid per mating of female zebrafish decreased significantly, and the difference with wild-type female zebrafish increased with age. - / - The survival rate of successfully fertilized embryos after mating of female zebrafish was also significantly reduced at 24 hpf, indicating that pcbp2 - / - The quality of follicles produced by female zebrafish is poor. These results indicate that the knockout of pcbp2 affects the egg-laying ability and follicle quality of female zebrafish to a certain extent, and the degree of influence may gradually increase with age. Therefore, it can be determined that the knockout of pcbp2 leads to reduced fertility in adult female zebrafish.

[0098] (2) PCBP2 knockout leads to enlarged zebrafish ovaries with cystic changes

[0099] In order to investigate pcBP2 - / - To understand the cause of reduced fertility in female zebrafish, the inventors first examined pcbp2 - / - The body size and morphology of adult female zebrafish were compared with those of wild-type adult female zebrafish. The results showed that compared with wild-type zebrafish of the same age, pcbp2 - / - The body is relatively large, with a slightly bulging abdomen.

[0100] The inventors further dissected zebrafish of different ages to observe the status of their ovaries. The results showed that pcbp2 - / - The ovaries show cystic lesions of varying degrees. In normal zebrafish ovaries, there are follicles at different stages of development, with distinct follicle granules. Stage I and II oocytes are transparent, while stage III and IV oocytes are light yellow due to the presence of yolk granules. Based on a large number of live dissection results, it can be found that 6mpf pcbp2 - / - A few follicles in the ovarian tissue undergo abnormal changes in morphology. The yolk material in the diseased oocytes is greatly reduced and forms white flocculent material. The surrounding matrix cells increase and become hard (such as Figure 7 A). At 12 mpf, a clear space-occupying cystic mass appeared in the ovary ( Figure 7 B). At 15 MPF, PCBP2 - / -The normal structure of the ovary is completely destroyed, there are almost no normal oocytes, most of the follicles are necrotic and form large white flocculent deposits ( Figure 7 C) According to the above different ages of pcBP2 - / - The results of ovarian morphological changes confirmed that knocking out pcbp2 would lead to cystic lesions in the zebrafish ovaries, and the severity of the lesions worsened with age. Δ20bp In the ovaries, it was also observed that many follicles were necrotic, the yolk material in the follicles was reduced, and obvious space-occupying cystic masses appeared ( Figure 7 D), the ovarian structure was severely damaged. Therefore, it can be considered that pcbp2 knockout causes cystic lesions in the ovaries of female zebrafish.

[0101] In order to further analyze whether the overall morphology and ovary of zebrafish changed after knocking out pcbp2, the inventors also counted the pcbp2 + / + and pcBP2 - / - The individual body weight of female zebrafish was compared with wild-type female zebrafish of the same period. - / - Female zebrafish are heavier ( Figure 8 A). We further dissected the zebrafish and separated the ovarian tissues to count the expression of pcbp2 + / + and pcBP2 - / - The ovarian weight of female zebrafish. The results showed that pcbp2 - / - The ovary weights were heavier than those of wild-type ovaries, and there was a significant difference ( Figure 8 B).

[0102] The gonadosomatic index (GSI) is an indicator of sexual maturity, indicating the ratio of gonad weight to body weight. The significance of GSI is to evaluate the development and functional status of gonads, and it has a certain reference value for diagnosing and monitoring gonadal diseases. An increase in GSI indicates an increase in ovarian volume and weight, which reflects abnormal conditions such as ovarian hyperplasia and cystic lesions, and is also an important feature of polycystic ovary syndrome.

[0103] The specific determination method is: select 8 wild-type female fish and 8 mutant female fish of the same age, weigh and record the body weight of zebrafish of different ages and their corresponding ovarian weights, and calculate the gonadal index (GSI) of zebrafish female fish by the formula = gonadal weight / individual body weight.

[0104] In this embodiment, the inventors calculated the PCBP2 + / + and pcBP2 - / -GSI of female zebrafish. The results showed that pcBP2 - / - The GSI of female zebrafish increased slightly and was statistically significant ( Figure 8 C).

[0105] For the pcbp2 found in the above embodiment - / - The ovaries of female zebrafish are significantly enlarged, and the inventors further explored the pathological causes. The specific method is: the inventors dissected and obtained pcbp2 - / - The ovaries were then examined for morphology, size, and number of follicles. - / - The diameter of the ovarian follicles did not increase significantly. - / - The number of follicles in the ovaries was found to be significantly higher in pcbp2 zebrafish compared with wild-type zebrafish of the same age. - / - The number of follicles in the ovaries increases significantly ( Figure 8 D). Therefore, pcBP2 - / - The marked enlargement of female zebrafish ovaries is due to pcbp2 - / - The number of follicles in the ovaries increases. The morphological structure of the ovaries of PCOS patients usually shows some obvious changes. Generally speaking, the ovaries will show uniform enlargement, which is specifically manifested by ovarian stroma hypertrophy, ovarian cell hyperplasia and ovarian cortical thickening. Knocking out pcbp2 leads to enlarged ovaries and increased GSI in female zebrafish, and the number of follicles in the ovaries increases. These abnormal phenotypes are highly similar to PCOS symptoms. In addition, knocking out pcbp2 leads to reduced fertility in adult female zebrafish, and rare ovulation or anovulation is an important diagnostic criterion for PCOS, which suggests that knocking out pcbp2 in the present invention may lead to the occurrence of PCOS in female zebrafish.

[0106] (3) PCBP2 knockout leads to an increase in atretic follicles in zebrafish ovaries

[0107] To understand pcBP2 - / - The inventors fixed 15-month-old female zebrafish and made paraffin sections, and observed the histological morphology of the diseased ovaries by HE staining.

[0108] The results showed that there were oocytes at different developmental stages in the ovaries of wild-type zebrafish, including primary growth phase I, cortical follicle phase II, yolk growth phase III and mature phase IV ( Fig. 9 A). Stage I oocytes are small in size, mostly triangular or rectangular, and the oocytes are highly basophilic; stage II oocytes begin to have cortical vesicles, and the zona pellucida begins to form and gradually thickens; stage III oocytes begin to form yolk material, which gradually fills the entire cytoplasm, and the zona pellucida becomes thicker ( Fig. 9a) Green arrow; Stage IV is the mature stage, with the yolk material increasing continuously and the ovum area decreasing. - / - In the ovaries, the normal physiological structure of the ovaries is severely damaged, and only a small number of normal oocytes exist ( Fig. 9 B); There are many typical atretic follicles (AF) in the ovaries, with atrophy of oocytes, folded zona pellucida, irregular follicle shape, and liquefaction of yolk granules ( Fig. 9 b1); and the stromal cells in the ovaries increase and accumulate in large numbers ( Fig. 9 b2); A large number of lysed zona pellucida appear, and the follicle contents are released into the matrix ( Fig. 9 b3).

[0109] (4) PCBP2 knockout leads to changes in gonad-related hormone levels in zebrafish ovaries

[0110] Elevated androgen levels are the most important clinical feature of PCOS patients. There are many causes for the disease, the most common of which is ovarian hyperplasia and cystic lesions, which interfere with the normal hormone secretion level in the body and induce a large amount of androgen secretion. In addition, abnormal regulation of the hypothalamus-pituitary-ovarian axis and insulin resistance can also lead to excessive androgen levels. Testosterone (Testo) is a type of androgen, and it is also the most abundant and important type of androgen. The inventor used a commercially available ELISA kit to detect pcbp2 - / - The testosterone level in the ovary was investigated to explore whether knocking out pcbp2 affected the androgen level in zebrafish.

[0111] The results are as follows Fig.10 A. PCBP2 at different ages - / - The testosterone level in the ovaries was increased compared with the wild type, and there was a statistically significant difference ( Fig.10 A) shows that knocking out pcbp2 leads to increased androgen levels in the zebrafish ovary, suggesting the occurrence of PCOS.

[0112] In addition, the secretion of gonadotropins in PCOS patients is usually abnormal. The level of luteinizing hormone (LH) is usually elevated, while the follicle-stimulating hormone (FSH) remains at a low level or close to normal. Therefore, the ratio of LH to FSH is usually greater than 2-3, which will affect physiological processes such as ovulation and menstrual cycle. The inventors also used ELISA to detect PCBP2 in different ages. - / - The levels of LH and FSH in the ovaries were found to be pcbp2 - / -The LH level in the ovaries did not change significantly, while the FSH level showed a significant downward trend at different ages ( Fig.10 B and 10C). By comparing wild type and pcBP2 - / - LH / FSH ratio in ovaries, found that pcbp2 in different ages - / - The LH / FSH ratio in the ovaries was significantly increased, and there was a statistical difference ( Fig.10 D) The imbalance in the ratio of LH to FSH further exacerbates the abnormal development of follicles, making it impossible for the follicles to mature or ovulate.

[0113] In summary, pcBP2 - / - The testosterone level in the ovary increased, the FSH level decreased, and the LH / FSH ratio increased. The changing trends of these hormones were consistent with the hormone changes in PCOS patients, further suggesting that knocking out pcbp2 leads to the occurrence of PCOS in female zebrafish.

[0114] (5) PCOS susceptibility gene in pcbp2 - / - Significantly upregulated in ovary

[0115] PCOS is a hereditary disease with the characteristic of familial clustering. At present, studies have found multiple PCOS genetic susceptibility genes from population studies through genome-wide association studies (GWAS). Most of these genes regulate and affect the reproductive function of the ovaries, mainly divided into genes involved in steroidogenesis (CYP11a, CYP17, CYP19, CYP21, etc.), gonadal hormone synthesis and regulation (AMH, FSHR, AR, SHBG, LHCGR, etc.) and some gene expression regulatory genes (DENND1A, TOX3). These genetic variations further increase the risk of PCOS and related complications. The inventors constructed relevant primers and detected pcbp2 - / - Expression levels of some PCOS-related susceptibility genes (tox3, dennd1a, amh, and fshr) in zebrafish ovaries.

[0116] Among them, the primers used are:

[0117] tox3-qPCR-upstream: 5'-GTCTGCATATGCCCTGTTCT-3' (SEQ ID NO: 4); tox3-qPCR-downstream: 5'-TCCCACATGGAGGCTACTAT-3' (SEQ ID NO: 5).

[0118] dennd1a-qPCR-upstream: 5'-CGCTATCCAGCTACAGTTCTTC-3' (SEQ ID NO: 6); dennd1a-qPCR-downstream: 5'-CCATGTTGATCTCCTCCTCAAA-3' (SEQ ID NO: 7).

[0119] amh-qPCR-upstream: 5'-AAAGAGCCCAGCGAGCAGCGAGAG-3' (SEQ ID NO: 8); amh-qPCR-downstream: 5'-AGGAAAGCCGCAGGTTCCTTCGCA-3' (SEQ ID NO: 9).

[0120] fshr-qPCR-upstream: 5'-TGCCACTTGGCTTTCGCCGACCTT-3' (SEQ ID NO: 10); fshr-qPCR-downstream: 5'-CATGGCAGCCTGCTCCTGTTTGCC-3' (SEQ ID NO: 11).

[0121] The qPCR detection system and procedures were performed according to routine procedures in the art.

[0122] The results are as follows Fig.11 As shown. It can be found that in pcbp2 - / - In zebrafish ovaries, the expression levels of four genes, tox3, dennd1a, amh and fshr, were significantly upregulated. The upregulation of the expression levels of these PCOS-related susceptibility genes suggests that knocking out pcbp2 may affect the expression regulation of PCOS-related susceptibility genes, thereby causing pcbp2 to - / - Zebrafish are more susceptible to PCOS.

[0123] In summary, knockout of pcbp2 leads to reduced fertility, enlarged ovaries, cystic changes in the ovaries, increased atretic follicles, ovarian fibrosis, changes in gonadal hormone levels, and upregulated expression of PCOS susceptibility genes in female zebrafish. These phenotypes are highly consistent with the symptoms and diagnostic criteria of PCOS. Therefore, it is reasonable to believe that knockout of pcbp2 will lead to the occurrence of PCOS in female zebrafish.

[0124] (6) PCOS inflammatory biomarker SAa in PCBP2 - / - Significantly upregulated in ovary

[0125] Serum amyloid A (SAA) is an acute phase response protein, and its production level increases significantly after acute injury and infection. Under chronic pathological conditions, the level of SAA will also increase, and its local and circulating concentrations are positively correlated with the degree of inflammatory response. In addition, SAA also has the effect of inducing monocytes and polymorphonuclear leukocytes to migrate, adhere to and infiltrate tissues at the site of inflammation. The inventors measured the expression level of saa in the ovaries of zebrafish of different ages by q-PCR, where the primers used were:

[0126] saa-qPCR-upstream: 5'-GCAGCCAAAGTTATCAGTGATGG-3' (SEQ ID NO: 12); saa-qPCR-downstream: 5'-CTTTATGGGCAGGCCTTTAGGT-3' (SEQ ID NO: 13).

[0127] The results are as follows Fig.12 At 3MPF, pcbp2 + / + and pcBP2 - / - There was no significant difference in the expression of SAa in ovarian tissue; at 6mpf and 12mpf, PCBP2 - / - The expression level of SAA in ovarian tissue is significantly increased. Studies have shown that SAA is not only a biomarker of infection and inflammation, but also participates in the inflammatory process by promoting immune cell migration and cytokine production. In addition, SAA is also an inflammatory biomarker of PCOS. Its expression level is significantly increased in PCOS patients, and it plays an important role in the progression of hyperandrogenism, insulin resistance, obesity, etc., thus affecting the occurrence and development of PCOS. pcbp2 - / - The expression level of SAa in ovarian tissue was significantly increased, suggesting that PCBP2 - / - The inflammatory response in the ovaries of female zebrafish is significantly enhanced, which may be a risk factor for the development of PCOS.

[0128] (7) Increased concentrations of pro-inflammatory chemokines in the ovaries of pcbp2-knockout zebrafish

[0129] Proinflammatory cytokines and chemokines are responsible for recruiting neutrophils and macrophages in infected tissues. When neutrophils and macrophages arrive at the site of infection, they immediately exert their antibacterial and pathogen-clearing or damaged cell effects. In this process, proinflammatory cytokines and chemokines are further released to form a positive feedback loop, which helps maintain the continued action of inflammatory cells. However, if the inflammatory response is excessive or prolonged, it may lead to tissue damage. CXCL8A, also known as interleukin 8 (IL-8), is a proinflammatory chemokine that is mainly produced by monocytes, macrophages, epithelial cells, and endothelial cells. It promotes the migration of immune cells to the site of inflammation, especially the recruitment of neutrophils in diseases of inflammation, infection, and tumor formation. In addition, CXCL8A can also induce the activation of endothelial cells, leading to vasodilation and increased permeability, thereby promoting the infiltration of immune cells into the site of inflammation. The inventors used q-PCR to detect the mRNA expression level of cxcl8a in the ovaries of zebrafish of different ages, wherein the primers used were: cxcl8a-qPCR-upstream: 5'-GAAAGCCGACGCATTGGAAA-3' (SEQ ID NO: 14); cxcl8a-qPCR-downstream: 5'-GGCATTCATGGTTTTCTGTTGA-3' (SEQ ID NO: 15).

[0130] The results showed that in zebrafish of 3mpf, 6mpf, and 12mpf, pcbp2 - / - The mRNA expression level of CXCL8A in the ovary was higher than that of PCBP2 + / + Significantly upregulated ( Fig.13 A).

[0131] In addition, the concentration of chemokine CXCL8A in zebrafish ovarian tissue was detected by commercially available ELISA kit, and the results showed that at 3mPf, PCBP2 + / + and pcBP2 - / - There was no significant difference in the concentration of the pro-inflammatory chemokine CXCL8A in ovarian tissue; at 6MPF, PCBP2 - / - The concentration of CXCL8A in ovarian tissue was slightly increased; at 12mPf, PCBP2 - / - The concentration of CXCL8A in ovarian tissue was significantly increased ( Fig.13 B), there is a significant difference. The above results show that at 12mPf, PCBP2 - / - The strong increase in pro-inflammatory chemokines in ovarian tissue may recruit more inflammatory cells into the atretic and degenerated stroma in the ovary, further aggravating the inflammatory response.

[0132] (8) Inflammatory response pathways in zebrafish ovaries with PCBP2 knockout were significantly activated

[0133] In this example, the inventors used conventional methods to extract 15 mpf of pcBP2 + / + and pcBP2 - / - Zebrafish ovary total RNA, library construction and sequencing analysis, obtained pcbp2 + / + and pcBP2 - / - Analysis of gene expression and differences in ovaries. Based on the expression of gene transcripts, fold change (FC)>2 and false discovery rate (FDR)<0.05 were used as screening criteria for differentially expressed genes. + / + and pcBP2 - / - A total of 2150 differentially expressed genes were screened between the two groups of samples, of which 1409 were up-regulated genes and 741 were down-regulated genes ( Fig.14 A).

[0134] After further cluster analysis, it was found that pcbp2 - / - Several pathways related to inflammatory response were enriched, including neutrophil chemotaxis, antigen processing and peptide antigen presentation by MHC class I, lymphoid cell migration, acute inflammatory response, negative regulation of cell migration, positive regulation of positive chemotaxis ( Fig.14 B), there are many inflammatory response-related genes with abnormal expression under these enriched pathways, and they are directly or indirectly involved in the inflammatory response process. Therefore, after knocking out pcbp2, the inflammatory response pathway in the zebrafish ovary is significantly activated, which may lead to abnormal inflammatory response in the ovary.

[0135] RNA-seq and qPCR methods were further used to identify some classic genes in the inflammatory response-related pathways (such as serum amyloid A (saa), lysozyme (lyz), myeloid-specific peroxidase (mpx), neutrophil cytosolic factor 2 (ncf2), neutrophil cytosolic factor 4 (ncf4), macrophage expressed 1 (mpeg1.1, tandem duplicate 1), lymphocyte cytosolic protein 1 (lcp1), matrix metalloproteinases (mmp9), mmp13a, chemokine (CXC motif) ligand 8a [cxcl8a, chemokine (CXC motif) ligand 8a] and the expression (mRNA) of interleukin 1β (il1b, interleukin1beta) were confirmed by testing.

[0136] The results are as follows Fig.15 As shown. The results showed that the trend was consistent with the transcriptome sequencing results and had statistical differences. Therefore, it can be determined that. Therefore, the abnormal upregulation of these genes will enhance the inflammatory response process in a direct or indirect way, further verifying that knocking out pcbp2 leads to enhanced inflammatory response in the ovary.

[0137] In summary, knocking out PCBP2 led to a significant enhancement of the inflammatory response in the ovaries, among which the expression of the PCOS inflammatory marker SAA was significantly upregulated. A large number of neutrophils infiltrated the ovarian stroma and secreted a large amount of matrix metalloproteinases and proinflammatory cytokines that accumulated in the ovaries. The long-term existence of persistent abnormal inflammatory response may eventually cause PCOS.

[0138] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for constructing a zebrafish disease model, comprising the following steps: Knockout zebrafish pcBP2 Gene; The disease is polycystic ovary syndrome and / or its related disease conditions; Conditions associated with PCOS include: Subfertility, ovarian inflammation, ovarian enlargement, ovarian cyst-like changes, abnormal increase in atretic follicles, abnormal follicular development, ovarian fibrosis, abnormal gonadotropin secretion and abnormal androgen levels.

2. The construction method according to claim 1, characterized in that: The knockout zebrafish pcBP2 Gene knockout in zebrafish pcBP2 At least one of the 12 exons of a gene.

3. The construction method according to claim 1, characterized in that: The knockout includes knocking out using at least one gene editing technology or physicochemical mutagenesis technology selected from plasmid-mediated gene knockout, embryonic stem cell knockout, CRISPR system, transcription activator-like effector nuclease technology (TALENs) or zinc finger nuclease (ZFN) technology.

4. The construction method according to claim 3, characterized in that: The construction method uses the CRISPR system for knockout, and the gRNA primers in the CRISPR system are shown in SEQ ID NOs: 2 and 3.

5. Application of the zebrafish disease model obtained by the construction method according to any one of claims 1 to 4 in drug screening.

6. The use according to claim 5, characterized in that: The zebrafish disease model pcBP2 The gene has mutated, and the mutation is the addition or deletion of bases.

7. The use according to claim 6, characterized in that: Compared with wild type pcBP2 Genes, the zebrafish disease model pcBP2 The gene has at least one base added or deleted.

8. Use of the zebrafish disease model obtained by the construction method according to any one of claims 1 to 4 in preparing a polycystic ovary syndrome risk prediction product.

Images