Application of HERC4 gene or protein as a target in screening drugs that inhibit foot-and-mouth disease virus replication

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to the use of a HERC4 gene or protein as a target in screening drugs that inhibit the replication of foot-and-mouth disease virus. First, the present invention found that knocking out the HERC4 protein can significantly inhibit the replication of FMDV, and can be used as a target for preparing drugs that inhibit the replication of Picornaviridae viruses. Secondly, the present invention uses CRISPR / Cas9 technology to design an sgRNA targeting the HERC4 gene, achieving the knockout of the HERC4 protein. The obtained HERC4 protein knockout monoclonal cell line not only has a resistance phenotype to FMDV, but can also significantly inhibit the replication of other Picornaviridae viruses in cells, providing research tools and materials for studying the molecular mechanism of HERC4 protein in regulating the replication of pathogenic microorganisms in cells, and also providing a potential target for animal disease-resistant breeding.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to an application of a HERC4 gene or protein as a target in screening drugs for inhibiting the replication of foot-and-mouth disease virus. Background Art

[0002] Foot-and-mouth disease virus (FMDV) poses a serious threat to the livestock industry, spreading rapidly and causing disease in susceptible animals such as cattle and pigs. The virus needs to invade host cells and replicate, assemble, and release cells within them to complete its life cycle. On the one hand, the virus utilizes the host cell's material energy to aid its replication; on the other hand, the host cell can also resist viral invasion through its own defense mechanisms. The interaction between the virus and the host affects the virus's species specificity, tissue tropism, and ability to infect and replicate. Therefore, in-depth exploration of the regulatory mechanisms between FMDV and the host is of great significance for clarifying the pathogenic mechanisms of viral infection and epidemic prevention and control.

[0003] Since its discovery in 2012, CRISPR / Cas9 technology has become the most popular gene editing tool in life science research due to its simplicity, efficiency, and low cost. It has been widely used in genome editing of different species, including humans, crab-eating macaques, pigs, rats, mice, zebrafish, rice, and Arabidopsis, covering areas including gene therapy, drug development, animal model establishment, and plant trait modification.

[0004] The HERC4 protein belongs to the HERC family, which is involved in regulating various cellular functions, including DNA damage repair, male sperm development, antiviral immunity, and cancer development. The HERC4 protein has a molecular weight of approximately 120 kDa and is expressed in all human tissues. Within cells, HERC4 is located in the cytoplasm and in cytoplasmic vesicle-like structures. Regarding the biological functions of HERC4, studies have shown that HERC4 plays a crucial role in spermatogenesis. Female mice deficient in HERC4 exhibit normal fertility, while male mice have a fertility reduction of approximately 50%. Furthermore, research on HERC4 has primarily focused on cancer research. HERC4 is involved in the development and progression of various cancers, including liver, lung, breast, and cervical cancer. It is highly expressed in many cancer cells and is considered a molecular marker for the clinical differential diagnosis of lung and breast cancer. Inhibiting HERC4 expression can inhibit cancer cell proliferation and cell death to varying degrees. HERC4 is lowly expressed in multiple myeloma cells and tissues, and overexpression can inhibit the growth of multiple myeloma. Currently, research on the involvement of HERC4 in the regulation of viral replication is blank.

[0005] The present invention found that knocking out the HERC4 protein can significantly inhibit the replication of FMDV and can be used as a target for preparing drugs that inhibit the replication of Picornaviridae viruses. The present invention uses CRISPR / Cas9 technology to design a sgRNA targeting the HERC4 gene. The sgRNA can target the HERC4 gene and ultimately achieve the knockout of the HERC4 protein. The HERC4 protein knockout monoclonal cell line obtained by the present invention not only has a resistance phenotype to FMDV, but can also significantly inhibit the replication of other Picornaviridae viruses, such as Seneca virus A (SVA) in cells. This provides research tools and materials for studying the molecular mechanism of HERC4 protein in regulating the replication of pathogenic microorganisms in cells, and also provides a potential target for animal disease resistance breeding. Summary of the Invention

[0006] In response to the above technical problems, the present invention uses CRISPR / Cas9 gene editing technology to prepare a HERC4 knockout cell line. The obtained knockout cell line can significantly inhibit the replication of FMDV in cells, providing basic research materials for studying the molecular mechanism of host protein HERC4 regulating FMDV replication.

[0007] Specifically include the following:

[0008] In a first aspect, the present invention provides an application of a HERC4 gene / protein as a target in the preparation or screening of drugs for preventing or treating Picornaviridae viral infection; the drug targets the HERC4 gene / protein and inhibits or silences the expression of the HERC4 gene / protein.

[0009] Preferably, the Picornaviridae virus includes foot-and-mouth disease virus and Seneca virus.

[0010] In a second aspect, the present invention provides a use of a HERC4 gene / protein expression inhibitor in the preparation of a medicament for preventing or treating Picornaviridae viral infection.

[0011] Preferably, the Picornaviridae virus includes foot-and-mouth disease virus and Seneca virus.

[0012] Preferably, the drug comprises a small interfering RNA designed to target the HERC4 gene / protein; or the HERC4 gene / protein expression inhibitor comprises an sgRNA targeted to knock out the HERC4 gene / protein.

[0013] Preferably, the sgRNA sequence is TTTGGACAGCTAGGCTTGGG.

[0014] Preferably, the forward primer of the sgRNA is HERC4-sgRNA-F: CACCGTTTGGACAGCTAGGCT TGGG, and the reaction primer is HERC4-sgRNA-R: AAACCCCAAGCCTAGCTGTCCAAAC.

[0015] In a third aspect, the present invention provides an application of a HERC4 gene / protein knockout cell line in breeding against Picornaviridae viruses.

[0016] Preferably, the Picornaviridae virus includes foot-and-mouth disease virus and Seneca virus.

[0017] In a fourth aspect, the present invention provides an application of a HERC4 gene / protein knockout cell line in studying the molecular mechanism by which the host protein HERC4 regulates the replication of Picornaviridae viruses.

[0018] Preferably, the Picornaviridae virus includes foot-and-mouth disease virus and Seneca virus.

[0019] In a fifth aspect, the present invention provides a use of a HERC4 protein in the preparation of a Picornaviridae virus or a Picornaviridae virus vaccine production enhancer.

[0020] Preferably, the Picornaviridae virus includes foot-and-mouth disease virus and Seneca virus.

[0021] The beneficial effects of the present invention are as follows: ① The present invention finds that the replication of FMDV and SVA can be inhibited by inhibiting or silencing the host HERC4 gene / protein, and the HERC4 gene / protein can be used as a target for preparing drugs that inhibit the replication of Picornaviridae viruses; ② The present invention provides an sgRNA targeting the HERC4 gene, and the sgRNA can specifically target the HERC4 gene. Combined with the CRISPR-Cas9 technology, the HERC4 gene in the host cell can be knocked out with accurate targeting and high knockout efficiency; ③ The present invention provides a method for transfecting the sgRNA into a host cell by the CRISPR-Cas9 technology to construct a cell line with loss of HERC4 gene / protein function. By losing the function of the HERC4 gene / protein, a cell line with a phenotype of resistance to FMDV and SVA is obtained, which can significantly inhibit the replication of FMDV and SVA, providing research tools and materials for further studying the molecular mechanism of HERC4 gene / protein regulating the replication of pathogenic microorganisms in cells, and can also be used for animal breeding resistant to FMDV and SVA, providing some theoretical basis for the future prevention or inhibition of FMDV and SVA infection; ④ The present invention finds that complementing HE After the expression of HERC4 protein, the replication of FMDV in the cells was significantly enhanced, indicating that HERC4 protein can promote the replication of FMDV and can be used as a synergist for the production of Picornaviridae viruses and for the production of Picornaviridae viruses or vaccines, which has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Design of sgRNA targeting site of porcine HERC4 gene;

[0023] Figure 2 Schematic diagram of porcine HERC4 gene targeting plasmid;

[0024] Figure 3 Target site sequencing results of HERC4 knockout cell lines;

[0025] Figure 4 Detection of HERC4 protein expression in knockout cell lines;

[0026] Figure 5 After 16 h of FMDV infection in HERC4 knockout cells and control cells, the levels of FMDV VP1 protein and SVA VP2 protein in the two cells were detected;

[0027] Figure 6 After 24 h of FMDV infection in HERC4 knockout cells and control cells, the FMDV mRNA levels in the two cells were detected;

[0028] Figure 7 After 24 h of FMDV infection in HERC4 knockout cells and control cells, the TCID50 of FMDV in both cells was determined;

[0029] Figure 8 Detection of FMDV protein content in HERC4 knockout cells after HERC4 protein was restored. DETAILED DESCRIPTION

[0030] To make the objectives, technical solutions, and advantages of the present invention more apparent, various embodiments of the present invention will be described in detail below with reference to the accompanying drawings. However, those skilled in the art will appreciate that many technical details are provided in the various embodiments of the present invention to help readers better understand the present application. However, even without these technical details and the various variations and modifications based on the following embodiments, the technical solutions claimed in the present application can still be implemented.

[0031] The experimental methods in the following examples, unless otherwise specified, are all conventional methods; the experimental materials used in the following examples, unless otherwise specified, are all purchased from conventional biochemical reagent companies.

[0032] Example

[0033] 1. Design of pig HERC4 gene targeting sites

[0034] The gene structure of pig HERC4 is as follows Figure 1 As shown, first, an sgRNA targeting the second exon of the pig HERC4 gene was designed after the HERC4 protein start codon, and the sgRNA sequence was TTTGGACAGCTAGGCTTGGG (shown in SE Q ID NO.1).

[0035] 2. Construction of porcine HERC4 gene targeting plasmid

[0036] pX459 is a CRISPR / Cas9 system plasmid that can express Cas9 protein and transcribe sgRNA for gene knockout. The present invention cloned HERC4-sgRNA into this plasmid. Specific steps: artificially synthesize the forward primer and reaction primer of HERC4-sgRNA, the forward primer is HERC4-sgRNA-F: CACCGTTTGGACAGCTAGG CTTGGG (shown in SEQ ID NO.2), and the reaction primer is HERC4-sgRNA-R: AAACCCCAAGCCTAGCT GTCCAAAC (shown in SEQ ID NO.3); anneal the forward primer and reaction primer into a double-stranded fragment, the annealing system is: 10×Annealing Buffer 5μL, forward primer (10μM) 22.5μL, reverse primer (10μM) 22.5μL, mix evenly; annealing procedure: 95℃ 5min, store at 4℃; perform T4 ligation on the double-stranded fragment and the pX459 vector backbone digested with Bbs I, and transform the ligation product into competent cells to obtain the HERC4 gene targeting plasmid pX459-HERC4-gRNA (as shown in Figure 2 shown).

[0037] 3. Construction of HERC4 knockout cell lines

[0038] When wild-type PK-15 cells are in good condition and confluent to 60-80%, transfect the cells with jetPRIME transfection reagent, referring to the instructions of jetPRIME transfection reagent. In vitro DNA & siRNA transfection reagent PROTOCOL, PT-114-15. 2 μg of pX459-HERC4-gRNA plasmid was transfected into PK15 cells. 24 hours after transfection, the cells were passaged and puromycin (2 μg / mL) was added to the culture medium to screen for transfection-positive cells. After 2-3 days of drug screening, the cells were counted and diluted into a 96-well plate at an average of 1 cell per well. The cells were then cultured and expanded in 20% FBS culture medium to obtain a monoclonal cell line.

[0039] 4. Target site sequencing of HERC4 knockout cell lines

[0040] The genome of the monoclonal cell line was extracted, the target site and flanking sequences were PCR amplified, and the PCR products were sequenced. The upstream primer for PCR amplification was HERC4-tarF: AGTACTTAGAAGCATGCAAATGT (shown in SEQ ID NO.4), and the downstream primer was HERC4-tarF: TTGTAGCCTAGCACTTGAAAGAG (shown in SEQ ID NO.5). The sequencing results of the PCR products were compared with the sequence information of the corresponding position in the genome of wild-type PK-15 cells. The HERC4 knockout cell line HERC4-KO obtained had a T base insertion at the target sequence (shown in SEQ ID NO. Figure 3 ), causing changes in the HERC4 reading frame and resulting in a series of codon changes downstream.

[0041] 5. Detection of HERC4 protein expression in knockout cell lines

[0042] In order to confirm the loss of HERC4 protein in HERC4-KO cell lines, total protein of control cells (the target site sequencing results of the selected monoclonal cell line were wild type) and HERC4-KO cells were extracted, and western blotting was performed on them. The results showed that no HERC4 protein was detected in HERC4-KO cells (such as Figure 4 The results show that the HERC4-KO cell line was successfully constructed. Although this method uses PK-15 cells as an example, it can also be used to obtain corresponding HERC4 gene function-deficient host cells for other types of animal cells.

[0043] 6. Detection of the Effect of HERC4 Knockout Cell Lines on FMDV Replication

[0044] After the HERC4-KO cell line was successfully constructed, the HERC4 knockout cells and control cells were infected with FMDV and SVA, respectively. Immunoblotting was performed 16 hours after infection; qPCR and TCID were performed 24 hours after infection. 50 The results showed that knocking out HERC4 could significantly inhibit the replication of FMDV and SVA (such as Figure 5-7 HERC4 knockout cells were transfected with HERC4 expression plasmids and then infected with FMDV. Compared with the control group, FMDV replication in the experimental group was significantly enhanced (as shown in Figure 8 shown).

[0045] Specifically:

[0046] After FMDV and SVA were infected with HERC4 knockout cells and control cells, the intracellular viral protein content was detected. The same number of HERC4 knockout cells and control cells were infected with FMDV and SVA, respectively. After 16 hours of infection, the cell culture medium was discarded, the cells and viral proteins were extracted, and the viral proteins were detected by immunoblotting. The results are as follows Figure 5 As shown, clear viral protein bands were detected in the control cells, while FMDV protein was undetectable in the HERC4 knockout cells, and SVA protein was significantly reduced compared to the control cells. The results indicate that the HERC4 protein knockout monoclonal cell line can significantly inhibit the replication of Picornaviridae viruses, including FMDV and SVA.

[0047] After FMDV infected HERC4 knockout cells and control cells, the intracellular FMDV RNA content was detected. The same number of HERC4 knockout cells and control cells were infected with FMDV, and 24 hours after infection, the cells and supernatant were collected, the cell and viral RNA were extracted, reverse transcribed, and the content of FMDV RNA in the cells relative to the intracellular GAPDH mRNA was detected by relative quantitative PCR, wherein the quantitative primer sequences are, FMDV-3D-qF: TGGGACCATACAGGAGAAG T (shown in SEQ ID NO.6); FMDV-3D-qR: GTAGCTTGGAATCTCGAAGAGG (shown in SEQ ID NO.7); pigGAPDH-qF: TCGGAGTGAACGGATTTGGC (shown in SEQ ID NO.8); pigGAPD H-qR: TGCCGTGGGTGGAATCATAC (shown in SEQ ID NO.9). The test results are shown in Figure 2. Figure 6 As shown, the viral RNA content in the knockout cells was significantly reduced compared with the control cells.

[0048] After FMDV infection of HERC4 knockout cells and control cells, the intracellular FMDV TCID50 was detected. The same number of HERC4 knockout cells and control cells were infected with FMDV, and 24 hours after infection, the cells and supernatant were collected and repeatedly frozen and thawed at -80℃ and room temperature for 3 times. The obtained virus samples were subjected to 10 -1 -10 -8 The virus samples were diluted 1-fold and inoculated into BKH cells in a 96-well cell culture plate. Eight wells were inoculated for each dilution, with 100 μL in each well. The cell culture plate was placed in a 37°C, 5% CO2 incubator and observed for 96 hours. The cytopathic effect was observed and recorded every 12 hours, and the TCID of the virus was calculated using the Reed-Muench method. 50 The results are as follows Figure 7As shown, viral replication was significantly inhibited in knockout cells relative to control cells.

[0049] HERC4 protein was replenished in HERC4 knockout cells, and the intracellular viral protein content was detected. HERC4 expression plasmid was transfected into HERC4 knockout cells. 24 hours after transfection, the cells were passaged and puromycin (2 μg / mL) was added to the culture medium to screen out transfection-positive cells. FMDV was then infected. 16 hours after infection, the cell culture medium was discarded, cells and viral proteins were extracted, and viral proteins were detected by immunoblotting. The results are as follows Figure 8 As shown, FMDV replication in cells was significantly enhanced after replenishing HER C4 protein.

Claims

1. Use of a HERC4 gene / protein expression inhibitor in the preparation of a medicament for preventing or treating infection by a Picornaviridae virus; the Picornaviridae virus being foot-and-mouth disease virus or Seneca virus; the HERC4 gene / protein expression inhibitor targets and knocks out the HERC4 gene / protein via CRISPR-Cas9, and comprises an sgRNA with the sequence TTTGGACAGCTAGGCTTGGG.

2. The use according to claim 1, characterized in that The forward primer of the sgRNA is HERC4-sgRNA-F: CACCGTTTGGACAGCTAGGCTTGGG, and the reaction primer is HERC4-sgRNA-R: AAACCCCAAGCCTAGCTGTCCAAAC.

Images