Use of gga-miR-24-3p as a biomarker for chicken sperm motility or chicken fertilization rate

Abstract

The present invention discloses the use of gga-miR-24-3p as a biomarker for chicken sperm motility or chicken fertilization rate. The present invention screened out the key miRNA-gga-miR-24-3p of seminal plasma exosomes related to chicken sperm motility through high-throughput transcriptome sequencing. The results showed that gga-miR-24-3p was significantly upregulated in individuals with high sperm motility, and in vitro insemination experiments proved that SPEVs can significantly improve the fertilization rate of chicken sperm. When the corresponding gga-miR-24-3p inhibitor was loaded, the effect of SPEVs on the improvement of fertilization ability was significantly reduced, thereby proving that gga-miR-24-3p can be used as a biomarker for evaluating sperm motility and improving fertilization rate. The present invention has application prospects in the selection of individual standards for high sperm motility, improving the fertilization rate of roosters, promoting the protection of chicken genetic resources and the selection of excellent varieties.

Description

Technical Field

[0001] The present invention relates to a new use of gga-miR-24-3p as a biomarker, and in particular to a use of gga-miR-24-3p as a biomarker of chicken sperm motility or chicken fertilization rate, belonging to the field of new uses of gga-miR-24-3p. Background Art

[0002] The sperm motility of roosters directly affects the reproductive performance of hens and the production performance of offspring. Improving the sperm motility and fertilization rate of roosters is beneficial to the breeding of fine roosters. At present, the protection of endangered chicken germplasm resources mainly relies on sperm freezing technology. Due to the morphological differences of chicken sperm, the current chicken sperm freezing technology is still unstable. The improvement of sperm freezing technology is a very important task.

[0003] Seminal plasma (SP) is a complex substance composed of secretions from the testis, epididymis, and accessory glands. The interaction between seminal plasma and sperm may affect sperm transport, maturation, storage, and fertilization in the male and female reproductive tracts. Exosomes (EVs) are bowl-shaped vesicles with a double-layer structure. Almost all cell types, especially hepatocytes, tumor cells, erythrocytes, and epithelial cells, can produce EVs. EVs are key mediators of intercellular communication and contain proteins, lipids, small RNAs, and other substances. Seminal plasma exosomes (SPEVs) are related to many reproductive activities, such as gamete maturation, fertilization, and embryonic and fetal development. SPEVs can improve the vitality of human frozen sperm and help with frozen sperm preservation; adding SPEVs from high-fertility bulls to the semen of low-fertility bulls can improve their in vitro fertilization rate. SPEVs originating from the epididymis or accessory glands have been reported in humans, mice, and fish.

[0004] MicroRNA (miRNA) is a class of endogenous ncRNA composed of 20-25 nucleotides, which has regulatory functions in eukaryotes. So far, there has been no report on gga-miR-24-3p as a biomarker for chicken sperm motility or chicken fertilization rate. Summary of the invention

[0005] One of the objects of the present invention is to provide the use of gga-miR-24-3p as a biomarker;

[0006] The second object of the present invention is to provide a method for improving the sperm motility or fertilization rate of roosters;

[0007] The third object of the present invention is to provide a detection kit for evaluating the activity of chicken sperm;

[0008] The above object of the present invention is achieved through the following technical solutions:

[0009] One aspect of the present invention is to provide use of gga-miR-24-3p as a biomarker for chicken sperm motility or high or low chicken fertilization rate.

[0010] A preferred specific embodiment of the present invention includes: detecting the expression level of gga-miR-24-3p in seminal plasma exosomes (SPEVs) of the rooster to be tested; if the expression level of gga-miR-24-3p in seminal plasma exosomes is high, the sperm motility or chicken fertilization rate of the rooster to be tested is high; if the expression level of gga-miR-24-3p in seminal plasma exosomes is low, the sperm motility or chicken fertilization rate of the rooster to be tested is low.

[0011] Regarding the methods for detecting the expression level of gga-miR-24-3p in seminal plasma exosomes, these are all methods well known in the art, including but not limited to: semi-quantitative RT-PCR, real-time fluorescence quantitative PCR, Northern blot, RNA-seq, microarray chips, etc.

[0012] The nucleotide sequence of gga-miR-24-3p described in the present invention is as follows: TGGCTCAGTTCAGCAGGAACAG (SEQ ID No. 1).

[0013] Another aspect of the present invention is to provide a method for improving rooster sperm motility or fertilization rate, comprising: increasing the expression level of gga-miR-24-3p in rooster seminal plasma exosomes; or adding rooster seminal plasma exosomes with high expression of gga-miR-24-3p as exogenous additives to fresh or frozen semen of roosters.

[0014] A person skilled in the art may use the method of overexpressing gga-miR-24-3p in rooster seminal plasma exosomes to increase the expression amount or expression level of gga-miR-24-3p in rooster seminal plasma exosomes. As for how to overexpress gga-miR-24-3p in rooster seminal plasma exosomes, these are conventional methods well known to those skilled in the art.

[0015] Another aspect of the present invention is to provide a detection kit for evaluating the motility of chicken sperm. These kits can be RT-PCR detection kits, real-time fluorescence quantitative PCR kits, etc. These kits contain PCR primers for amplifying gga-miR-24-3p or probes for detecting gga-miR-24-3p, etc.

[0016] The present invention screened out the key miRNA-gga-miR-24-3p of seminal plasma exosomes related to chicken sperm motility through high-throughput transcriptome sequencing. The results showed that gga-miR-24-3p was significantly upregulated in individuals with high sperm motility, and in vitro insemination experiments proved that SPEVs can significantly improve the fertilization rate of chicken sperm. When loaded with the corresponding gga-miR-24-3p inhibitor, the effect of SPEVs on improving fertilization ability was significantly reduced, which proved that gga-miR-24-3p can be used as a biomarker for evaluating sperm motility and improving fertilization rate. The present invention has application prospects in selecting individual standards for high sperm motility, improving the fertilization rate of roosters, promoting the protection of chicken genetic resources and germplasm resources, and selecting and breeding excellent varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Characterization of SPEVs in chickens with high and low sperm motility; Note: (A) TEM observation of SPEVs in chickens with high and low sperm motility; (B) NTA analysis of SPEVs in chickens with high and low sperm motility; (C) Protein immunoblot analysis of SPEVs.

[0018] Figure 2 Volcano plot and heat map of the correlation and difference of differentially expressed miRNAs; (A) Volcano plot of differentially expressed miRNAs; (B) Heat map of cluster analysis of differential miRNA expression patterns.

[0019] Figure 3 Seminal plasma exosomes are taken up by sperm.

[0020] Figure 4 Effect of SPEVs addition on the fertilization rate of fresh semen.

[0021] Figure 5 Effect of SPEVs addition on the fertilization rate of frozen semen.

[0022] Figure 6 Expression levels of miRNA inhibitors before and after loading.

[0023] Figure 7 Effect of knockdown of gga-miR-24-3p followed by addition on the fertilization rate of fresh semen.

[0024] Figure 8 Effect of knockdown of gga-miR-24-3p followed by addition on the fertilization rate of frozen semen. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0026] Experimental Example 1 Screening and Identification of Differential Markers of Chicken Sperm Motility and Fertilization Capacity

[0027] 1 Test method

[0028] 1.1 Screening for individuals with high and low sperm motility

[0029] Abdominal massage was used to collect semen from 50 healthy Beijing roosters aged 40 weeks, and the sperm motility was evaluated using the CASA system. The specific operation was as follows:

[0030] 10 μL of fresh semen was diluted with 990 μL of 37°C preheated DMEM. 10 μL of the above semen dilution was dropped on the CASA special counting plate, placed on the 37°C constant temperature stage of the phase contrast microscope, and image data of 5 different fields of view were collected and analyzed. Finally, 8 high sperm motility (HSM) and 7 low sperm motility (LSM) individuals were screened (Table 1).

[0031] Table 1 Results of individual determination of high and low sperm motility

[0032]

[0033] 1.2 SPEVs separation

[0034] 5 mL of semen was collected from each rooster in the HSM group (H1, H2, and H3) and the LSM group (L1, L2, and L3) for isolation of SPEVs. The semen was mixed and centrifuged at 1,000 g for 10 minutes at 4°C, and the supernatant was collected and stored on ice. The sperm pellet was gently resuspended in 500 μL PBS, and then centrifuged again to collect the supernatant. This process was repeated three times. The supernatant was mixed, centrifuged at 20,000 g for 15 minutes at 4°C, and the pellet was discarded. The supernatant was centrifuged at 100,000 g for 90 minutes at 4°C. The white precipitate attached to the wall of the tube was resuspended in PBS and stored in a -80°C refrigerator.

[0035] 1.3 Identification of chicken SPEVs

[0036] 1.3.1 Transmission electron microscopy (TEM)

[0037] The SPEVs sample was fixed in 2% paraformaldehyde and dropped onto the copper grid for 5 minutes. The excess liquid was absorbed from the edge of the copper grid with filter paper, and the phosphotungstic acid negative staining solution was added, and the grid was incubated again for 5-10 minutes. The excess staining solution was absorbed, and then the grid was allowed to dry naturally. The copper grid was placed on the sample holder and observed using a transmission electron microscope.

[0038] 1.3.2 Particle size analysis (NTA)

[0039] The particle size and concentration of SPEVs were measured using ZetaView PMX 110 (Particle Metrix, Germany) and the corresponding software ZetaView8.04.02. The samples were appropriately diluted with 1× PBS buffer before measurement. NTA measurements were recorded and analyzed at 11 locations.

[0040] 1.3.3 Identification of marker proteins by immunoblotting

[0041] Western blot was used to verify three exosome-specific marker proteins, including ALG-2 interacting protein X (ALIX), heat shock protein 70 (HSP70), and tumor susceptibility protein 101 (TSG101). 100 μL RIPA lysis buffer was added to the sample, and the sample was broken for 3 minutes using a disruptor after reacting on ice for 30 minutes. The supernatant was collected after centrifugation at 2,0000g for 15 minutes at 4°C. The protein concentration was detected using a BCA protein detection kit, 5× protein loading buffer was added, and the sample was boiled at 95°C for 10 minutes. 4%-12% protein precast gel was used, 5 μL protein marker and 20 μg SPEVs sample were spotted. The electrophoresis voltage was set to 90V, and the electrophoresis was stopped after the protein bands were completely run out. The PVDF membrane was placed in pure methanol solution for 15 seconds to activate the membrane. On the transfer instrument, add the transfer solution in the order of filter paper-membrane-gel-filter paper, set the current to 200mA, and transfer for 2h. Put the transferred PVDF membrane into the blocking solution with 5% skim milk powder, incubate it on a shaker at room temperature for 1h, take out the PVDF membrane after blocking and wash it three times with PBST and PBS, each time for 5min. After washing, dilute the primary antibody in proportion, ALIX (A2215, 1: 500), HSP70 (A20819, 1: 2500) and TSG101 (ab275018-1kit, 1: 1000) at 4℃ overnight, wash it in the same way after the primary antibody incubation, and incubate the membrane with the secondary antibody at room temperature for 1 hour. After treatment with ECL luminescent solution, use the imaging system to observe the experimental results.

[0042] 1.4 RNA-seq Total RNA extraction, library preparation and sequencing

[0043] 1.4.1 Trizol method for total RNA extraction

[0044] (1) Add 1 mL of Trizol to SPEVs and mix thoroughly immediately;

[0045] (2) leaving the mixed liquid at room temperature for 10 min to allow for complete lysis;

[0046] (3) Add 200 μL of chloroform, shake thoroughly to mix, and centrifuge at 4°C, 12,000 rpm for 10 min;

[0047] (4) Take the upper aqueous phase, add an equal volume of phenol:chloroform (25:24), mix thoroughly, and centrifuge at 4°C, 12,000 rpm, for 10 min;

[0048] (5) Take the upper aqueous phase, add an equal volume of chloroform, mix thoroughly, and centrifuge at 4°C, 12000 rpm for 10 min;

[0049] (6) Take the upper aqueous phase, add an equal volume of isopropanol, stand at -20°C for 1 h, and centrifuge at 4°C, 12,000 rpm for 10 min;

[0050] (7) Discard the supernatant, add 1 mL of 75% ethanol, wash the precipitate, centrifuge at 4°C, 8000 rpm for 5 min, and discard the supernatant;

[0051] (8) Repeat the previous step

[0052] (9) After brief centrifugation, remove ethanol and vacuum dry for 2-4 min;

[0053] (10) Add 20-50 μL RNase-Free Water, dissolve at room temperature for 10 min, mix well, and centrifuge briefly;

[0054] (11) Store at -80℃.

[0055] 1.4.2 RNA quality testing

[0056] The purity of total RNA was detected by NanoDrop (Nanodrop 2000, Thermo Fisher Scientific, USA), and the integrity of RNA was detected by Agilent 2100 (Agilent Technologies).

[0057] 1.4.3 Library construction

[0058] sRNA was obtained from the total RNA by gel electrophoresis, and the 5' adapter and 3' adapter were connected respectively. RT-PCR was performed using the adapter primers to construct a small RNA library.

[0059] 1.5 Sequencing data analysis, miRNA identification and target gene prediction

[0060] All Clean reads were aligned to small RNAs in the GeneBank database (version 209.0) to identify and remove ribosomal RNA (rRNA), cytoplasmic small RNA (scRNA), nucleolar small RNA (snoRNA), nuclear small RNA (snRNA), and transfer RNA (tRNA). At the same time, all Clean reads were aligned to small RNAs in the Rfam database (version 11.0) to identify and remove rRNA, scRNA, snoRNA, snRNA, and tRNA. All Clean reads were also aligned to the reference genome (Ensembl_release106), and reads mapped to exons or introns and repeats were removed. All Clean reads were then searched against the miRBase database (version 22) to identify known chicken miRNAs. So far, miRNA sequences of some species are still not included in the miRBase database. All unannotated reads were aligned to the reference genome. Novel miRNA candidates were identified based on the genomic position and hairpin structure predicted by the software MiReap_v0.2.

[0061] Miranda (version 3.3a) and TargetScan (version 7.0) were used to predict the target genes of miRNAs. The intersection of the prediction results was more credible and was selected as the predicted miRNA target genes.

[0062] 2 Test results

[0063] 2.1 Identification of seminal plasma exosomes

[0064] TEM, NTA and WB were used to verify the isolated high and low sperm motility chicken SPEVs. TEM results showed that SPEVs had a distinct teacup structure ( Figure 1 -A). The SPEVs concentrations of HSM and LSM were 3.2×10 7 and 7.2×10 7 particles / mL; the average diameters were 136.3 and 129.1 nm, respectively, ranging from 50 to 150 nm ( Figure 1 -B). Three EVs-specific protein markers, ALIX, TSG101, and HSP70, were expressed in both groups ( Figure 1 -C). This proves that the SPEVs of high and low vitality chickens were separated successfully.

[0065] 2.2 Brief introduction to the data of small RNA sequencing library

[0066] A total of about 6.68 million clean reads were found after sequencing, including 10540199, 9197147, 13190397, 11999834, 11198343 and 10693787 clean reads in H1, H2, H3, L1, L2 and L3, respectively. RNA was classified by biotype, with known miRNAs accounting for 14.53%–47.64% of total RNA and novel miRNAs accounting for 0.12%–0.19% of total RNA. Other types of RNA were also detected, including rRNA, scRNA, snoRNA, snRNA and tRNA reads. tRNA reads accounted for about 5% of total RNA (Table 2).

[0067] Table 2 Summary of small RNA sequencing data

[0068]

[0069] 2.3 Small RNA identification

[0070] Almost all SPEVs miRNAs range in length from 18 to 35 nt, with a peak at 22 nt. A total of 1006 miRNAs (706 known miRNAs and 300 novel miRNAs) were detected in HG, and a total of 1084 miRNAs (692 known miRNAs and 392 novel miRNAs) were detected in LSM. Among them, there were 685 and 671 known miRNAs in HSM and LSM, respectively, and 301 and 393 were novel miRNAs. The Venn diagram results showed that there was overlap in miRNAs between the two groups, with 709 miRNAs (501 known miRNAs and 188 novel miRNAs) in HSM and LSM. In HSM and LSM, 34 differentially expressed miRNAs were identified, of which 15 were upregulated and 19 were downregulated. Details of the heat map and volcano map showing the correlation and differences of the differential miRNAs are shown in Figure 2 .

[0071] The results of this experiment showed that gga-miR-24-3p was upregulated in individuals with high sperm motility (P < 0.05). In this experiment, it was found that the fertilization rate was significantly reduced after knocking out gga-miR-24-3p. Therefore, it is speculated that gga-miR-24-3p can be used as a marker for identifying differences in chicken sperm motility or fertilization ability.

[0072] Experimental Example 2 Effect of SPEVs and SPEVs gga-miR-24-3p on sperm fertilization rate

[0073] 1 Test method

[0074] 1.1 Sperm-exosome PKH67 staining and tracing experiment

[0075] (1) According to the instructions of the exosome green fluorescent marker dye (PKH67) kit, SPEVs were mixed with 50 μL of the staining working solution, mixed by vortexing for 1 min, and then incubated for 10 min. 10 mL of PBS was added to the incubated SPEVs-dye complex, and then ultracentrifuged again and 200 μL of PBS was added to resuspend the precipitate to obtain the stained SPEVs.

[0076] (2) According to the instructions of DAPI staining solution, the diluted sperm was mixed with 3 times the volume of DAPI staining solution, incubated at room temperature for 20 min, washed twice with PBS, and then 50 μL PBS was added to resuspend the precipitate to obtain the stained sperm.

[0077] (3) The stained sperm was mixed evenly with SPEVs, incubated at 37°C, and the binding was observed using a laser confocal microscope system.

[0078] 1.2 Effect of SPEVs on sperm fertilization rate

[0079] 1.2.1 Effect of SPEVs on the fertilization rate of fresh semen

[0080] HSM SPEVs were collected by ultracentrifugation and stored at -20°C. Artificial insemination (AI) was used to test the fertilization ability of the following three groups of semen: (1) positive control group (HSM), fresh semen from the HSM group; (2) negative control group (LSM), fresh semen from the LSM group; (3) experimental group (LSM-SPEVs), SPEVs obtained from the HSM group were added to the fresh semen of the LSM group and incubated at 25°C for 15 minutes. Each experimental group was repeated 3 times, with 10 hens in each repeat. After 2 days of continuous AI, hatching eggs were collected starting on the third day for a total of 18 days, and the fertilization rate was calculated after 4 days of incubation.

[0081] 1.2.2 Effect of SPEVs on the fertilization rate of frozen semen

[0082] HSM SPEVs were collected by ultracentrifugation and stored at -20°C. The experimental groups were (1) control group (C), which did not undergo programmed thawed semen addition; (2) experimental group 1 (BF), which collected fresh semen and added HSM SPEVs for programmed freezing; and (3) experimental group 2 (AF), which added SPEVs to thawed semen and incubated for 15 minutes. After 2 days of continuous AI, eggs were collected on the third day for a total of 8 days, and the fertilization rate was calculated 4 days after incubation.

[0083] 1.3 Effect of SPEVs gga-miR-24-3p on sperm fertilization rate

[0084] In order to verify the effect of gga-miR-24-3p on sperm fertilization, a gga-miR-24-3p inhibitor (CUGUUCCUGCUGAACUGAGCCA) (SEQ ID No. 2) was designed and synthesized. The miRNA inhibitor was mixed with SPEVs and then sonicated on ice, and then ultracentrifuged to obtain SPEVs containing the inhibitor. The SPEVs RNA loaded with the inhibitor was extracted for reverse transcription and RT-qPCR amplification to verify the expression of the miRNA inhibitor before and after sonication.

[0085] 1.3.1 Effect of SPEVs miR-24-3p on fresh sperm fertilization rate

[0086] The effect of gga-miR-24-3p knockdown in SPEVs on fresh semen fertilization rate was examined using AI in the following three groups: (1) control group (C), fresh semen was collected for AI without any addition; (2) experimental group 1 (SPEVs), semen was incubated with normal SPEVs at 25°C for 15 min before AI; (3) experimental group 2 (knockout SPEVs), semen was incubated with gga-miR-24-3p knockout SPEVs at 25°C for 15 min. The fertilization rate was calculated as above.

[0087] 1.3.2 Effect of SPEVs miR-24-3p on the fertilization rate of frozen sperm

[0088] The experimental design was the same as in 1.3.1, except that frozen semen was used instead of fresh semen. The three groups were named FC, F-SPEVs, and F-knock SPEVs. The fertilization rate was calculated in the same way as above.

[0089] 2 Test results

[0090] 2.1 Results of sperm-exosome PKH67 staining and tracing test

[0091] In vitro co-incubation experiments were performed using HSM-SPEVs and LSM semen. The experimental results showed that 10 μg of SPEVs had the best binding to sperm, and obvious signals were mainly observed on the sperm head ( Figure 3 ).

[0092] 2.2 Effect of SPEVs on sperm fertilization rate

[0093] Effects of SPEVs on the fertilization rate of fresh and frozen semen Figure 4-Figure 5 Compared with the other two groups, the average fertilization rate of the HSM group was the highest at 18 days (68.08%), and the average fertilization rate of LSM-SPEVs (66.28%) was significantly higher than that of LSM (59.52%) ( Figure 4For frozen semen, the highest fertilization rate was achieved when SPEVs were added to the cryo-dilution medium (BF, 23.2%), compared with the control group without SPEVs (C, 15.7%) and the group with SPEVs added before AI (AF, 18.2%). Figure 5 ).

[0094] 2.3 Effect of SPEVs miRNA on sperm fertilization rate

[0095] After loading, RT-qPCR demonstrated that the expression of gga-miR-24-3p inhibitor was significantly increased ( Figure 6 ).

[0096] For fresh semen, the average fertilization rate of the normal SPEVs-added group was significantly increased (SPEVs, 72.35%) compared with the control group without addition (C, 59.52%), while the average fertilization rate of the gga-miR-24-3p SPEVs knockout group was significantly decreased (knock SPEVs, 56.36%) ( Figure 7 For frozen semen, the fertilization rate of the normal SPEVs group (F-SPEVs, 63%) was significantly increased compared with the control group without any semen (FC, 37.5%), while the fertilization rate of the gga-miR-24-3p knockout SPEVs group (F-knock SPEVs, 38.1%) was similar to that of the C group ( Figure 8 ).

Claims

1. A method for evaluating chicken sperm motility or chicken fertilization rate for non-diagnostic or therapeutic purposes, characterized in that: include: Detect the expression level of gga-miR-24-3p in seminal plasma exosomes of the tested roosters; If the expression level of gga-miR-24-3p in seminal plasma exosomes is high, the sperm motility of the tested rooster or the fertilization rate of the chicken is high; if the expression level of gga-miR-24-3p in seminal plasma exosomes is low, the sperm motility of the tested rooster or the fertilization rate of the chicken is low; The nucleotide sequence of the gga-miR-24-3p is shown in SEQ ID No.

1.

2. A method for improving the sperm motility or fertilization rate of a rooster, characterized in that: include: The rooster seminal plasma exosomes highly expressing gga-miR-24-3p are added as exogenous additives to the fresh semen or frozen-thawed semen of the rooster; the nucleotide sequence of the gga-miR-24-3p is shown in SEQ ID No.1.

Images