sgRNA, vector, lentivirus, and methods and applications thereof for targeted knockout of RBPH1 gene

Abstract

The present invention discloses a sgRNA for targeted knockout of the RBPH1 gene. The sgRNA comprises two nucleotide sequences, RBPH1-sgRNA1 and RBPH1-sgRNA2. The nucleotide sequences of RBPH1-sgRNA1 are shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequences of RBPH1-sgRNA2 are shown in SEQ ID No. 3 and SEQ ID No. 4. The present invention also discloses a vector for targeted knockout of the RBPH1 gene, a method for constructing the vector, a lentiviral packaging method, and applications thereof. The vector can effectively regulate the proliferation and migration ability of prostate cancer cells, providing a new method for frontline research on prostate cancer.

Description

Technical Field

[0001] The present invention belongs to the field of gene editing technology, and specifically relates to sgRNA for targeted knockout of the RBPH1 gene. The present invention also relates to vectors, lentiviruses, and methods and applications thereof for targeted knockout of the RBPH1 gene. Background Art

[0002] Prostate cancer is a common malignancy in men, and the most common malignancy of the genitourinary system. Radical prostatectomy (RP) and endocrine therapy are currently the first-line treatments for prostate cancer. However, while these therapies are effective in patients with early-stage prostate cancer, they are less effective in patients with metastatic prostate cancer due to drug resistance. Therefore, the development of new diagnostic and prognostic targets for prostate cancer is crucial.

[0003] Endoplasmic reticulum ribosome-binding glycoprotein 1 (RBPH1) is a component of the oligosaccharyl transferase complex (OST) and is crucial for N-linked glycosylation. N-linked glycosylation is a common protein modification in eukaryotic cells, primarily catalyzed by the OST complex. It plays an important role in protein folding, degradation, trafficking, and cell signaling. Existing studies have shown that RBPH1 is associated with the development and progression of bladder and breast cancer.

[0004] TCGA population data show that RBPH1 is significantly correlated with the malignancy, Gleason score and disease-free survival of prostate cancer. Therefore, inhibiting or knocking out the expression of this receptor has a good effect on regulating the proliferation, migration and invasion of prostate cancer cells, and is an effective target for the diagnosis and treatment of prostate cancer. However, there are no relevant technical patents or research reports on CRISPR / Cas9 vectors for knocking out the RBPH1 gene in cancer cells in existing gene editing technologies. Summary of the Invention

[0005] The first objective of the present invention is to provide a sgRNA for targeted knockout of the RBPH1 gene. A vector comprising the sgRNA can specifically, continuously, stably and efficiently knock out the RBPH1 gene in cancer cells.

[0006] The second object of the present invention is to provide a vector for targeted knockout of the RBPH1 gene.

[0007] The third object of the present invention is to provide a method for constructing a vector for targeted knockout of the RBPH1 gene.

[0008] The fourth object of the present invention is to provide a lentiviral packaging method for targeted knockout of the RBPH1 gene.

[0009] The fifth object of the present invention is to provide a lentivirus for specifically knocking out the RBPH1 gene obtained by the above-mentioned lentivirus packaging method for targeted knockout of the RBPH1 gene.

[0010] The sixth object of the present invention is to provide the use of a lentivirus for targeted knockout of the RBPH1 gene in the preparation of a drug for regulating the proliferation and migration of prostate cancer.

[0011] The seventh object of the present invention is to provide the use of sgRNA that targets and knocks out the RBPH1 gene in the preparation of drugs for regulating prostate cancer proliferation and migration.

[0012] The eighth objective of the present invention is to provide the use of CRISPR / Cas9 vectors in the preparation of drugs for regulating prostate cancer proliferation and migration.

[0013] The first technical solution adopted by the present invention is to use sgRNA to target and knock out the RBPH1 gene. The above-mentioned sgRNA includes two nucleotide sequences, namely RBPH1-sgRNA1 and RBPH1-sgRNA2. The nucleotide sequence of RBPH1-sgRNA1 is shown in SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of RBPH1-sgRNA2 is shown in SEQ ID No.3 and SEQ ID No.4.

[0014] The second technical solution adopted by the present invention is a vector for targeted knockout of the RBPH1 gene, which is a CRISPR / Cas9 vector containing the above-mentioned sgRNA.

[0015] The second technical solution adopted by the present invention is also characterized in that:

[0016] Furthermore, the CRISPR / Cas9 vector was obtained by inserting sgRNA targeting the knockout of RBPH1 gene into the CRISPR / Cas9 vector lentiCRISPRv2.

[0017] Furthermore, the CRISPR / Cas9 vector can specifically knock out the expression of RBPH1 in prostate cancer cells in the genome, thereby regulating the proliferation, migration and clone formation of prostate cancer cells.

[0018] The third technical solution adopted by the present invention is a method for constructing a vector for targeted knockout of the RBPH1 gene, which is specifically implemented according to the following steps: synthesizing a nucleotide fragment encoding the RBPH1 gene; cutting the lentiCRISPRv2 vector with the restriction endonuclease BsmB I; preparing sgRNA for the RBPH1 gene; connecting the cut lentiCRISPRv2 vector and the prepared sgRNA fragment; and the plasmid extracted after transformation and identification is the CRISPR / Cas9 vector for the sgRNA that specifically knocks out the RBPH1 gene.

[0019] The fourth technical solution adopted by the present invention is a lentiviral packaging method for targeted knockout of the RBPH1 gene, which uses the above-mentioned CRISPR / Cas9 vector, the lentiviral packaging plasmid pMD2.G, psPAX2 and the CRISPR / Cas9 vector of the recombinant RBPH1 gene through liposome Lipofectamine 2000 TM After co-transfection of HEK293T cells, a lentivirus that specifically knocks out the RBPH1 gene can be obtained.

[0020] The fifth technical solution adopted by the present invention is to obtain a lentivirus that specifically knocks out the RBPH1 gene by using the above-mentioned lentivirus packaging method for targeted knockout of the RBPH1 gene.

[0021] The sixth technical solution adopted by the present invention is the use of the above-mentioned lentivirus for targeted knockout of the RBPH1 gene in the preparation of drugs for regulating the proliferation and migration of prostate cancer.

[0022] The seventh technical solution adopted by the present invention is the use of the above-mentioned sgRNA for targeted knockout of the RBPH1 gene in the preparation of drugs for regulating prostate cancer proliferation and migration.

[0023] The eighth technical solution adopted by the present invention is the use of the above-mentioned CRISPR / Cas9 vector in the preparation of drugs for regulating prostate cancer proliferation and migration.

[0024] The beneficial effects of the present invention are:

[0025] This invention provides a CRISPR / Cas9 vector for targeted knockout of the RBPH1 gene. Compared to RNAi technologies (such as siRNA and shRNA), this CRISPR / Cas9 vector can silence target genes genomically, with higher specificity and knockdown efficiency and lower off-target rates. This CRISPR / Cas9 vector can effectively regulate the proliferation and migration of prostate cancer cells, providing a new approach for frontline prostate cancer research.

[0026] The present invention provides a new method for preparing a drug for treating human prostate cancer. The human prostate cancer cell line provided by the present invention, which specifically, consistently, stably, and efficiently knocks out the RBPH1 gene, can provide new experimental material for studying the function of the RBPH1 gene, filling a gap in the functional research of the RBPH1 gene in prostate cancer.

[0027] The sgRNA described in the present invention can not only be used to prepare drugs for treating human prostate cancer, but also can be used to study the role and mechanism of the RBPH1 gene in the occurrence and development of human prostate cancer and other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the DNA map of the packaging vector lentiCRISPRv2 plasmid used in the construction of the CRISPR / Cas9 vector targeting the RBPH1 gene of the present invention;

[0029] Figure 2 This is a diagram showing partial sequencing results of the lentiCRISPRv2-RBPH1-sgRNA1 expression vector of the present invention;

[0030] Figure 3 This is a diagram showing partial sequencing results of the lentiCRISPRv2-RBPH1-sgRNA2 expression vector of the present invention;

[0031] Figure 4 3 is a graph showing the protein expression of RBPH1 in prostate cancer cell DU145 after infection with two lentiviruses in Example 3 of the present invention;

[0032] Figure 5 4 is a graph showing the detection results of cell proliferation ability of prostate cancer cell DU145 after infection with two lentiviruses respectively in Example 4 of the present invention;

[0033] Figure 6 4 is a graph showing the detection results of cell migration ability of prostate cancer cell DU145 infected with two lentiviruses in Example 4 of the present invention;

[0034] Figure 7 4 is a quantitative analysis result of the cell migration ability of prostate cancer cell DU145 infected with two lentiviruses in Example 4 of the present invention;

[0035] Figure 8 This is a staining result diagram of the cell clone formation ability of prostate cancer cell DU145 infected with two lentiviruses in Example 4 of the present invention;

[0036] Figure 9 This is a diagram showing the quantitative analysis results of the cell clone formation ability of prostate cancer cell DU145 after being infected with two lentiviruses in Example 4 of the present invention. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] This paper provides a CRISPR / Cas9 vector that uses CRISPR / Cas9 targeted gene editing technology to specifically, consistently, stably, and efficiently knock out the RBPH1 gene in cancer cells, filling a gap in this field. The vector is also used in prostate cancer cell lines as an example. It can also be used in the development of cancer therapeutics and the diagnosis of related cancers.

[0039] The present invention provides an sgRNA for targeted knockout of the RBPH1 gene, wherein the sgRNA includes two nucleotide sequences, namely RBPH1-sgRNA1 and RBPH1-sgRNA2. The nucleotide sequence of RBPH1-sgRNA1 is shown in SEQ ID No. 1 and SEQ ID No. 2, and the nucleotide sequence of RBPH1-sgRNA2 is shown in SEQ ID No. 3 and SEQ ID No. 4.

[0040] RBPH1-sgRNA1 includes the F1 and R1 nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2, specifically as follows:

[0041] F1: 5'-GGCACCGCCGCTGATCAATGAGG-3'

[0042] R1: 5'-CCTCATTGATCAGCGGCGGTGCC-3'

[0043] RBPH1-sgRNA2 includes the F2 and R2 nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4, specifically as follows:

[0044] F2: 5'-TGGAAGACCCATTACATCGT-3'

[0045] R2: 5'-ACGATGTAATGGGTCTTCCA-3'

[0046] The present invention also provides a vector for targeted knockout of the RBPH1 gene, wherein the vector is a CRISPR / Cas9 vector comprising the sgRNA, and the DNA map of the packaging vector lentiCRISPRv2 plasmid used is as follows: Figure 1 shown.

[0047] Furthermore, the above-mentioned CRISPR / Cas9 vector is obtained by inserting an sgRNA that specifically knocks out the RBPH1 gene into the CRISPR / Cas9 vector lentiCRISPRv2.

[0048] Furthermore, the above-mentioned CRISPR / Cas9 vector can specifically knock out the expression of RBPH1 in prostate cancer cells in the genome, thereby regulating the proliferation, migration and clone formation of prostate cancer cells.

[0049] The present invention also provides a method for constructing the above-mentioned vector for targeted knockout of the RBPH1 gene, which is specifically implemented according to the following steps: synthesizing a nucleotide fragment encoding the RBPH1 gene; cutting the lentiCRISPRv2 vector with the restriction endonuclease BsmB I; preparing sgRNA for the RBPH1 gene; connecting the cut lentiCRISPRv2 vector and the prepared sgRNA fragment; and the plasmid extracted after transformation and identification is the CRISPR / Cas9 vector for the sgRNA that specifically knocks out the RBPH1 gene.

[0050] The present invention also provides a lentiviral packaging method for targeted knockout of the RBPH1 gene, which specifically comprises: using the lentiviral packaging plasmid pMD2.G, psPAX2 and the recombinant RBPH1 CRISPR / Cas9 vector to pass through liposome Lipofectamine 2000 TM After co-transfection of HEK293T cells, a lentivirus that specifically knocks out the RBPH1 gene can be obtained.

[0051] The present invention also provides a lentivirus for specifically knocking out the RBPH1 gene obtained by the above-mentioned lentivirus packaging method for targeted knockout of the RBPH1 gene.

[0052] The present invention also provides the use of a lentivirus for targeted knockout of the RBPH1 gene in the preparation of a drug for regulating the proliferation and migration of prostate cancer.

[0053] The present invention also provides the use of sgRNA that targets and knocks out the RBPH1 gene in the preparation of drugs for regulating prostate cancer proliferation and migration.

[0054] The present invention also provides the use of CRISPR / Cas9 vectors in the preparation of drugs for regulating prostate cancer proliferation and migration

[0055] The present invention also provides the construction of a prostate cancer cell line with specific knockout of the RBPH1 gene.

[0056] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and embodiments:

[0057] In the examples of the present invention, the experimental methods without specific conditions and the reagents without specified formulas were all in accordance with conventional conditions, such as those described in Molecular Cloning Laboratory Manual, 4th edition, Beijing: Science Press, 2017.

[0058] Example 1

[0059] Construction of CRISPR / Cas9 vector for RBPH1 gene sgRNA

[0060] (1) Design and synthesis of sgRNA

[0061] The present invention designed two sgRNA nucleotide sequences targeting the exon region of RBPH1, which are:

[0062] RBPH1-sgRNA1:

[0063] F1: 5'-GGCACCGCCGCTGATCAATGAGG-3'

[0064] R1: 5'-CCTCATTGATCAGCGGCGGTGCC-3'

[0065] RBPH1-sgRNA2:

[0066] F2: 5' TGGAAGACCCATTACATCGT 3'

[0067] R2: 5' ACGATGTAATGGGTCTTCCA 3'

[0068] After designing the sequence, insert the sequence according to the following structure to obtain two pairs of sgRNA oligonucleotide sequences (sense is the sgRNA forward sequence, and anti-sense is its reverse complementary sequence):

[0069] Forward oligo:5'-CACCG-sense-3'

[0070] Reverse oligo:5'-AAAC-anti-sense-C-3'

[0071] After the design was completed, it was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the resulting sgRNA oligonucleotide sequence targeting RBPH1 was as follows:

[0072] RBPH1-sgRNA1:

[0073] Forward oligo: 5'-CACCGGGCACCGCCGCTGATCAATGAGG-3'

[0074] Reverse oligo: 5'-AAACCCTCATTGATCAGCGGCGGTGCCC-3';

[0075] RBPH1-sgRNA2:

[0076] Forward oligo: 5'-CACCGTGGAAGACCCATTACATCGT-3'

[0077] Reverse oligo: 5'-AAACACGATGTAATGGGTCTTCCAC-3';

[0078] (2) Recombinant RBPH1 sgRNA and lentiCRISPRv2 vector

[0079] First, the designed and synthesized sgRNA oligonucleotide chains were annealed, as shown in Tables 1 and 2. Second, the lentiCRISPRv2 vector was cut with the restriction endonuclease BsmB Ⅰ, as shown in Table 3. The cut vector was verified by nucleic acid electrophoresis, and after successful verification, gel recovery was performed. Next, T4 DNA ligase was used to connect the vector and sgRNA fragments with the same sticky ends, as shown in Table 4. Finally, transformation was performed, plasmid was extracted, and sequencing was performed. The positive single clone was selected, and the sequencing results were shown in Figure 2 and Figure 3 shown.

[0080]

[0081] Table 1 sgRNA oligonucleotide chain annealing system

[0082] Table 2 sgRNA annealing PCR reaction program

[0083]

[0084] Table 3 lentiCRISPRv2 vector cutting system

[0085]

[0086] Table 4. Ligation system of sgRNA and cleaved lentiCRISPRv2 vector

[0087]

[0088] Example 2

[0089] Preparation of lentiviral particles targeting the RBPH1 gene

[0090] (1) HEK293T cell culture

[0091] HEK293T cells used in the present invention were purchased from the American Type Culture Collection (ATCC) and cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37 oC. Culture in a 5% CO2 incubator and passage cells when they reach the logarithmic growth phase. One day before lentiviral packaging, trypsinize HEK293T cells and seed them into 6-well plates. Culture for 24 hours until the cells are fully adherent and the cell density reaches 60-70%. Lentivirus packaging can be performed.

[0092] (2) Lentiviral packaging

[0093] When HEK293T cells have grown to 60-70% confluence, lentiviral packaging can be performed. The packaging system used in this example is a second-generation lentiviral packaging system. The following steps are performed for one well of a six-well plate: Take two 1.5 mL sterile centrifuge tubes. In centrifuge tube 1, add 125 μL of opti-MEM to dilute the lentiviral packaging plasmid pMD2.G (375 ng), psPAX2 (1125 ng), and sgRNA plasmid (1500 ng); in centrifuge tube 2, add 125 μL of opti-MEM and 6 μL of Lipofectamine 2000. TM Liposomes; The two centrifuge tubes were allowed to stand for 5 minutes and then mixed. After standing at room temperature for 20 minutes, they were slowly and gently added to the six-well plate and then placed in a cell culture incubator for overnight culture. After 24 hours, fresh low-glucose complete medium was replaced to remove the liposomes. Cell culture medium was collected 48 hours after transfection. After 3 consecutive days, the virus solution was filtered using a 0.45μm filter and stored at -80 o CSave for future use.

[0094] Example 3

[0095] Construction and identification of prostate cancer cell lines with specific targeted knockout of RBPH1 gene

[0096] (1) Culture of prostate cancer cells

[0097] Prostate cancer cell line DU145 was purchased from the American Type Culture Collection (ATCC) and cultured in DMEM complete medium containing 10% fetal bovine serum and 1% double antibody at 37 o C. In a 5% CO2 incubator, cells can be passaged when they reach the logarithmic growth phase.

[0098] (2) Construction of DU145 cell line with specific targeted knockout of RBPH1 gene

[0099] First, the DU145 cell line in the logarithmic growth phase was digested with trypsin for 5 minutes. After neutralization with 2 times the volume of trypsin and complete medium, the digested cells were carefully blown off and collected into a 15 mL centrifuge tube. Centrifuged at 800 rpm for 3 minutes, the supernatant was discarded, and the cells were collected at the bottom of the centrifuge tube. Then, 1 mL of Resuspend the cells in DMEM complete medium and seed the cells into 6-well plates at a seeding density such that the cells reach 60-70% confluence after 24 hours of attachment. After culturing for 24 hours, when the cells grow to 60-70% confluence, aspirate the original medium and add 1 mL of complete medium containing 12 μg / mL polybrene to each well, add 1 mL of virus solution at the same time, mix gently, and return to the cell culture incubator for continued culture. After culturing for 24 hours, replace with 2 mL of fresh DMEM complete medium and continue culture. After culturing for 24 hours, aspirate the original medium and add fresh DMEM complete medium containing 1 μg / mL puromycin to each well for screening. When all the cells in the negative control group that are not infected with the lentivirus die, pick monoclonal cells to 96-well plates for expansion culture. The cell clone that can completely knock out the RBPH1 gene at the protein level is the stable DU145 cell line with specific knockout of the RBPH1 gene or the control group.

[0100] (3) Identification of the effect of stable knockout of RBPH1 gene in DU145 cell line

[0101] The monoclonal cells with RBPH1 gene knockout or the stable DU145 cell line of the control group were collected and cultured, and the knockout effect of RBPH1 was detected by Western Blot. Figure 4 As shown in the results, compared with the control group, the protein expression level of RBPH1 in the two groups of cells infected with RBPH1-sgRNA was completely suppressed, indicating that the sgRNA or CRISPR / Cas9 vector or lentivirus targeting the RBPH1 gene designed and constructed in the present invention can specifically target and knock out the expression of the RBPH1 gene in the DU145 cell line.

[0102] Example 4

[0103] Knockout of the RBPH1 gene significantly promotes the proliferation and migration of DU145 cells

[0104] (1) CCK8 cell proliferation assay

[0105] Amplify and culture the constructed stable strains of DU145 cells with knockout of RBPH1 gene or control group, and collect different cell strains respectively. The collection method is shown in Example 3. After counting the cells using a hemocytometer, the cells were inoculated into a 96-well plate with a density of 800 cells per well. Add 10 μL of cck8 reagent to each well at the same time on days 0, 1, 3, and 5, and continue to culture for 4 hours. Use a microporous spectrophotometer to detect the absorbance value at 450 nm. Set up 3 replicate wells for each group, and the final result is output as Mean±SD. Figure 5 As shown, compared with the control group (Lenti), knocking out the endogenous RBPH1 gene in DU145 cells can significantly promote the proliferation ability of cells.

[0106] (2) Scratch healing experiment

[0107] The cell lines in the logarithmic growth phase were collected by trypsin digestion and counted using a hemocytometer. 5 The cells were inoculated into 12-well plates at a density of 100 cells / well, with 3 replicate wells set up for each group. Three straight positioning lines needed to be drawn on the bottom of the 12-well plate with a black marker in advance. After 24 hours of inoculation and culture, the cells can be scratched when they grow to 100% fusion. Use a 200μL pipette tip to draw at least three straight lines perpendicular to the positioning lines. Wash the scratched cell fragments with 1×PBS, add 1mL of complete culture medium to the culture wells, and take pictures at the same positioning position at 0h and 48h after scratching using an inverted microscope. Finally, use image J software for statistical analysis. Figure 6 and Figure 7 As shown, compared with the control group, knocking out the RBPH1 gene can significantly promote the scratch healing ability of DU145 cells. This result shows that knocking out the expression of RBPH1 can significantly promote the migration ability of prostate cancer cell DU145.

[0108] (3) Clone formation experiment

[0109] Trypsin digestion was used to collect cell lines in the logarithmic growth phase. After counting with a hemocytometer, the cells were inoculated into 24-well plates at a density of 500 cells / well. Three wells were repeated for each group. Fresh culture medium was replaced with cells every three days. Culture was stopped when a clone contained at least 50 cells. The cell culture plate was removed and rinsed twice with 1×PBS. 700μL of 3.7% formaldehyde was added to each well to fix for 15 minutes, and the formaldehyde was carefully aspirated. 700μL of 0.1% crystal violet stain was added to each well and stained for 30 minutes. After staining, the stain was aspirated and the culture wells were washed twice with double distilled water to wash off the floating color. After the culture wells were dried, they were photographed with a digital camera. Finally, the number of clones was counted using image J software. The number of cells contained in each clone colony should not be less than 50. Figure 8 and Figure 9As shown, compared with the control group, knocking out RBPH1 expression can significantly increase the number of clones formed by DU145 cells, indicating that knocking out RBPH1 expression can significantly promote the clone formation ability of prostate cancer cell DU145.

[0110] The present invention uses CRISPR / Cas9 gene editing technology to efficiently, stably and specifically knock out the RBPH1 gene, providing a new method for preparing anticancer drugs and promoting the development of new anticancer drugs.

[0111] Sequence Listing

[0112] Sequence Listing

[0113] <110> Xi'an Medical College

[0114] <120> sgRNA, vector, lentivirus, and methods and applications thereof for targeted knockout of RBPH1 gene

[0115] <160> 4

[0116] <170> SIPOSequenceListing 1.0

[0117] <210> 1

[0118] <211> twenty three

[0119] <212> DNA

[0120] <213> Artificial sequence

[0121] <400> 1

[0122] ggcaccgccg ctgatcaatg agg23

[0123] <210> 2

[0124] <211> twenty three

[0125] <212> DNA

[0126] <213> Artificial sequence

[0127] <400> 2

[0128] cctcattgat cagcggcggt gcc23

[0129] <210> 3

[0130] <211> 20

[0131] <212> DNA

[0132] <213> Artificial sequence

[0133] <400> 3

[0134] tggaagaccc attacatcgt20

[0135] <210> 4

[0136] <211> 20

[0137] <212> DNA

[0138] <213> Artificial sequence

[0139] <400> 4

[0140] acgatgtaat gggtcttcca20

Claims

1. Application of sgRNA targeting RBPH1 gene knockout in the preparation of RBPH1 gene knockout DU145 cell line; The sgRNA includes two nucleotide sequences, namely RBPH1-sgRNA1 and RBPH1-sgRNA2. The nucleotide sequence of the RBPH1-sgRNA1 is shown in SEQ ID No. 1, and the nucleotide sequence of the RBPH1-sgRNA2 is shown in SEQ ID No.

3.

2. Application of CRISPR / Cas9 vector targeting RBPH1 gene knockout in the preparation of RBPH1 gene knockout DU145 cell line; The CRISPR / Cas9 vector comprises the sgRNA of claim 1; The CRISPR / Cas9 vector is obtained by inserting the sgRNA targeting the knockout of the RBPH1 gene into the CRISPR / Cas9 vector lentiCRISPRv2; The CRISPR / Cas9 vector can specifically knock out the expression of RBPH1 in prostate cancer cells on the genome, thereby regulating the proliferation, migration and clone formation of prostate cancer cells; The method for constructing the CRISPR / Cas9 vector is specifically implemented by the following steps: synthesizing a nucleotide fragment encoding the RBPH1 gene; The lentiCRISPRv2 vector was cut with the restriction endonuclease BsmB Ⅰ; sgRNA targeting the RBPH1 gene was prepared; The cut lentiCRISPRv2 vector and the prepared sgRNA fragment were connected; the plasmid extracted after transformation and identification was the CRISPR / Cas9 vector of the sgRNA that specifically knocked out the RBPH1 gene.

3. Application of lentivirus targeting RBPH1 gene knockout in the preparation of RBPH1 gene knockout DU145 cell line; The lentiviral packaging method is specifically as follows: using the CRISPR / Cas9 vector described in claim 2, using the lentiviral packaging plasmid pMD2.G, psPAX2 and the CRISPR / Cas9 vector of the recombinant RBPH1 gene to co-transfect HEK293T cells through liposome Lipofectamine2000TM, a lentivirus that specifically knocks out the RBPH1 gene can be obtained.

Images