Homologous recombinant Bacillus subtilis expressing cecropin B gene and construction method thereof

Abstract

The present invention discloses a homologous recombinant Bacillus subtilis expressing cecropin B gene and a construction method thereof, and belongs to the field of genetic engineering technology. The present invention discloses a homologous recombinant Bacillus subtilis expressing cecropin B gene and a construction method thereof, using Bacillus subtilis 1A1 as a starting strain, knocking out the coding region of the endo-1,4-β-xylanase gene, and integrating the expression of the cecropin B gene, and using xylan induction to obtain the Bacillus subtilis genetic engineering bacteria expressing the cecropin B gene and having the antibacterial activity of inhibiting Salmonella, Escherichia coli and Listeria monocytogenes. The recombinant bacteria can be used as an animal health product for preventing and treating bacterial diseases of the digestive tract of livestock, poultry and aquatic animals.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a homologous recombinant Bacillus subtilis expressing a cecropin B gene and a construction method thereof. Background Art

[0002] Cecropins are composed of 34 to 39 amino acid residues and are divided into six types: A, B, C, D, E, and P1. Cecropins A, B, and D are the main members of the cecropin family, with very similar molecular weights and very high homology in their amino acid sequences. Cecropin B was isolated from the body of Cecropinus cecropinus in 1990. It is a heat-stable soluble mature peptide containing only 35 amino acids. It has the strongest antibacterial activity among the many antimicrobial peptides obtained, and has significant inhibitory and killing effects on bacteria, fungi, viruses, protozoa, and certain tumor cells. Cecropin B has inhibitory effects on a variety of bacteria, including Escherichia coli, Salmonella, and Staphylococcus aureus. Adding Cecropin B to feed can enhance animal immunity, significantly improve animal growth performance, and increase feed utilization and animal survival rate.

[0003] Bacillus subtilis is widely found in soil, water environment and corrupt organisms. It is a type of Gram-positive bacteria of the genus Bacillus. It is an aerobic or facultative anaerobic bacterium, does not contain endotoxins and is non-pathogenic. Bacillus subtilis can produce a variety of antimicrobial active substances, such as surfactin, iturin, fengycin, bacillomycin, polymyxins, etc., which can inhibit the growth of harmful bacteria such as streptococci. Bacillus subtilis can also secrete a variety of endogenous enzymes, such as amylase, cellulase, lipase, etc. It is recognized as a GRAS-level probiotic strain by the US FDA and is widely used in agriculture, animal husbandry and other industries.

[0004] Bacillus subtilis mainly inhibits Gram-positive bacteria, and has little inhibitory effect on Gram-negative bacteria. By expressing antimicrobial peptides such as Cecropin B against Gram-negative bacteria in Bacillus subtilis through genetic engineering technology, the anti-Gram-negative effect of Bacillus subtilis will be significantly enhanced. In the past, the expression of Cecropin B in Bacillus subtilis was carried out by using plasmid transformation to transfer Cecropin B into Bacillus subtilis for expression, but there are disadvantages such as easy loss of plasmids and instability of recombinant strains.

[0005] The homologous recombination method based on chromosome integration to express foreign genes has advantages over the plasmid-based method. Double-crossover homologous recombination with upstream and downstream homologous fragments has better recombination efficiency and stability than single-crossover homologous recombination. There has been no report on the application of homologous recombination technology to express Cecropin B in Bacillus subtilis.

[0006] Endo-1,4-β-xylanase (xynA, EC 3.2.1.8) can catalyze the decomposition of β-1.4-D-xylosidic bonds of xylan and is an important component of microbial xylanase and plant cell wall degrading enzyme systems. Endo-1,4-β-xylanase is often found in hosts that feed on plants and plant matter, such as Bacillus subtilis, saprotrophic bacteria, plant pathogens or parasites, intestinal microbiota, and some plant symbiotic bacteria. At present, domestic and foreign research is devoted to the study of the induced expression or exogenous expression of xylanase genes. Xylan as a substrate can induce the gene expression of xylanase. At present, there is no research on homologous recombination of the endo-1.4-β-xylanase gene site. Summary of the invention

[0007] The purpose of the present invention is to provide a homologous recombinant Bacillus subtilis expressing cecropin B gene and a construction method thereof to solve the problems existing in the above-mentioned prior art. The present invention uses homologous recombination technology to transfer the cecropin B gene, which has an inhibitory effect on Gram-negative bacteria, into Bacillus subtilis. The generated recombinant engineered bacteria can not only inhibit Gram-positive bacteria, but also prevent diseases such as diarrhea caused by pathogenic bacteria such as Escherichia coli and Salmonella, which is beneficial to improve the economic value of Bacillus subtilis.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] In one of the technical solutions of the present invention, the recombinant expression cassette of the cecropin B gene comprises the following elements in sequence from 5' to 3': an upstream homology arm sequence xynAUp from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene, a cecropin B coding region sequence, and a downstream homology arm sequence xynADown from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene.

[0010] The second technical solution of the present invention is a recombinant expression vector of cecropin B gene, which is constructed with pHY300PLK as the skeleton and comprises the recombinant expression cassette.

[0011] The third technical solution of the present invention is a recombinant Bacillus subtilis, which uses Bacillus subtilis 1A1 as a starting strain and comprises the recombinant expression cassette or the recombinant expression vector.

[0012] A fourth technical solution of the present invention is the use of the recombinant expression cassette, the recombinant expression vector or the recombinant Bacillus subtilis in the production of cecropin B.

[0013] A fifth technical solution of the present invention is a method for preparing cecropin B, which utilizes the recombinant Bacillus subtilis to produce cecropin B under the induction of xylan.

[0014] The sixth technical solution of the present invention is the use of the recombinant Bacillus subtilis in the preparation of drugs for preventing and treating diseases caused by Gram-negative bacteria.

[0015] The seventh technical solution of the present invention is a drug for preventing and treating diseases caused by Gram-negative bacteria, comprising the recombinant Bacillus subtilis.

[0016] Based on the above technical solution, the present invention has the following technical effects:

[0017] The present invention discloses a homologous recombinant Bacillus subtilis expressing cecropin B gene and a construction method thereof. Bacillus subtilis 1A1 is used as a starting strain, the coding region of the endo-1,4-β-xylanase gene is knocked out, and the cecropin B gene is integrated and expressed. The Bacillus subtilis genetic engineering bacteria expressing the cecropin B gene and having the antibacterial activity of inhibiting Salmonella, Escherichia coli and Listeria monocytogenes are obtained by xylan induction. The present invention obtains a homologous recombinant Bacillus subtilis that can stably secrete and express the cecropin B gene. The genetic engineering strain will be beneficial to the application of Bacillus subtilis to prevent and treat digestive tract diseases caused by Gram-negative bacteria such as piglet diarrhea. The recombinant bacteria can be used as an animal health product for preventing and treating bacterial diseases of the digestive tract of livestock, poultry and aquatic animals. Homologous recombination at the Bacillus subtilis xylan gene site can be used to express other exogenous proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 is the identification result of the starting bacteria, where negative represents the negative control Escherichia coli DH5α, positive represents the positive control Bacillus subtilis, 1 represents a single colony on the resistance plate, 2 represents the bacterial solution;

[0020] Figure 2 It is the transformation identification of the recombinant vector pHY300PLK-CB, where Yang represents the positive control pHY300PLK-CB vector, Yin represents the negative control Bacillus subtilis, 1 represents a single colony on the resistance plate; 2 represents the bacterial solution;

[0021] Figure 3 To identify the integration results of the homologous recombination expression cassette, A represents the identification primer CB Q2, the target band size is 1811bp; B represents the identification primer CB S3, the target band size is 842bp; C represents the identification primer CB D6, the target band size is 735bp; Yin represents the negative control Bacillus subtilis; Blank represents the blank control water; 1-2 represents the recombinant bacterial sample;

[0022] Figure 4 The growth curves of wild bacteria and recombinant bacteria;

[0023] Figure 5 Cecropin B gene passage stability test, where positive represents positive control Cecropin B gene amplification; negative represents negative control Bacillus subtilis; 1-8 are: 0th, 5th, 10th, 15th, 20th, 25th, 30th and 35th generation cell fragments;

[0024] Figure 6 The stability of the recombinant Bacillus subtilis was detected by sequence analysis, wherein 1 and 2 represent the PCR products of the recombinant bacteria; 3 represents the target replacement fragment sequence;

[0025] Figure 7 is the expression level of Cecropin B gene under the induction of different concentrations of xylan;

[0026] Figure 8 The Oxford cup method was used to observe the inhibitory activity of recombinant bacteria against Salmonella, where A represents cephalosporin (10 mg / mL); B represents the concentrated supernatant of the fermentation broth induced by the recombinant bacteria; C represents the precipitate and broken sample of the fermentation broth induced by the recombinant bacteria; D represents the blank control (LB); E represents the precipitate and broken sample of the fermentation broth of wild bacteria; F represents the concentrated supernatant of the fermentation broth of wild bacteria;

[0027] Fig. 9 The Oxford cup method was used to observe the inhibitory activity of recombinant bacteria on Escherichia coli, where A represents ciprofloxacin (10 mg / mL); B represents the concentrated supernatant of the fermentation broth induced by the recombinant bacteria; C represents the precipitate and broken sample of the fermentation broth induced by the recombinant bacteria; D represents the blank control (LB); E represents the precipitate and broken sample of the fermentation broth of wild bacteria; F represents the concentrated supernatant of the fermentation broth of wild bacteria;

[0028] Fig.10 The Oxford cup method was used to observe the inhibitory activity of recombinant bacteria on Listeria monocytogenes, where A represents tetracycline (100 mg / mL); B represents the supernatant of the fermentation broth after induction of recombinant bacteria; C represents the cell fragmentation broth after induction of recombinant bacteria; D represents the blank control (LB); E represents the cell fragmentation broth after induction of wild bacteria; F represents the supernatant of the fermentation broth after induction of wild bacteria;

[0029] Fig.11 The Oxford cup method was used to observe the inhibitory activity of recombinant bacteria on Clostridium perfringens, wherein A represents tetracycline (100 mg / mL); B represents the supernatant of the fermentation broth after induction of the recombinant bacteria; C represents the cell disruption broth after induction of the recombinant bacteria; D represents the blank control (LB); E represents the cell disruption broth after induction of the wild bacteria; and F represents the supernatant of the fermentation broth after induction of the wild bacteria. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0036] The embodiment of the present invention provides a recombinant expression cassette of the cecropin B gene, which comprises the following elements from 5' to 3': an upstream homology arm sequence xynAUp from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene, a cecropin B coding region sequence, and a downstream homology arm sequence xynADown from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene.

[0037] In some specific embodiments, the nucleotide sequence of xynAUp is shown as SEQ ID NO.1; the nucleotide sequence of xynADown is shown as SEQ ID NO.2; and the nucleotide sequence of the cecropin B coding region is shown as SEQ ID NO.3.

[0038] The embodiment of the present invention further provides a recombinant expression vector of cecropin B gene, wherein the recombinant expression vector is constructed with pHY300PLK as a skeleton and comprises the recombinant expression cassette.

[0039] In some specific embodiments, the upstream and downstream homologous arms of 500 bp sequence of the signal peptide downstream sequence of the xynA gene coding region are amplified and spliced ​​together with the Cecropin B gene sequence by overlapping PCR method to construct a homologous recombination expression cassette. The recombinant expression cassette is connected to the BamH I site of the Escherichia coli-Bacillus subtilis shuttle expression vector pHY300PLK by seamless splicing to form a recombinant expression vector named pHY300PLK-CB.

[0040] The embodiment of the present invention further provides a recombinant Bacillus subtilis, which uses Bacillus subtilis 1A1 as a starting strain and comprises the recombinant expression cassette or the recombinant expression vector.

[0041] Furthermore, the recombinant Bacillus subtilis knocked out the coding region of the cellulose decomposition gene endo-1,4-β-xylanase (endo-1,4-β-D-xylanase, xynA), and integrated the expression of the Cecropin B gene. The Cecropin B gene replaced the signal peptide downstream sequence of the coding region of the xynA gene through homologous recombination.

[0042] In some specific embodiments, the recombinant expression vector pHY300PLK-CB is used to electro-transform Bacillus subtilis 1A1, which is further subcultured using LB liquid culture medium containing tetracycline and agar culture medium, and the pHY300PLK-CB recombinant sequence is amplified by PCR to screen positive transformation clones, and the culture is continued to be subcultured using LB liquid culture medium without antibiotics and agar culture medium, and the genome-Cecropin B recombinant sequence is amplified by PCR to screen homologous recombination positive clones.

[0043] The invention establishes a method for preparing a competent state of Bacillus subtilis with a high conversion rate and a complete Bacillus subtilis electrotransformation system containing trehalose, mannitol and sorbitol. The pHY300PLK-CB vector is transferred into Bacillus subtilis by electrotransformation, and multiple pairs of primers are designed to screen out the homologous recombination double exchange pHY300PLK-CB recombinant strain by combining PCR with antibiotics, successfully replacing the Bacillus subtilis endo-1,4-β-xylanase gene coding region, and inserting the exogenous gene Cecropin B into the Bacillus subtilis chromosome.

[0044] The embodiments of the present invention also provide the use of the recombinant expression cassette, the recombinant expression vector or the recombinant Bacillus subtilis in producing cecropin B.

[0045] The embodiment of the present invention also provides a method for preparing cecropin B, which uses the recombinant Bacillus subtilis to produce cecropin B under the induction of xylan.

[0046] In some specific embodiments, the mass concentration of xylan in the culture medium is 0.5% to 1%.

[0047] In some specific embodiments, the induction time is 12 hours.

[0048] Under culture conditions, Bacillus subtilis does not need xylanase, while the cellulose decomposition gene endo-1,4-β-xylanase can be induced to express in large quantities by xylan. Therefore, this enzyme is an inducible non-essential metabolic enzyme under culture conditions, and the technology of expressing foreign proteins by homologous recombination at the xylan gene site has a good application prospect.

[0049] In order to stably and efficiently express the Cecropin B gene in Bacillus subtilis, the present invention utilizes a homologous recombination method to replace the signal peptide downstream sequence of the coding region of the endo-1,4-β-xylanase (Endo-1,4-β-xylanase, xynA) gene of Bacillus subtilis strain 1A1 with the Cecropin B gene coding region, thereby obtaining a genetically engineered Bacillus subtilis strain that secretes the Cecropin B protein.

[0050] The embodiment of the present invention also provides the use of the recombinant Bacillus subtilis in preparing a drug for preventing and treating diseases caused by Gram-negative bacteria.

[0051] In some specific embodiments, the Gram-negative bacteria include Salmonella, Escherichia coli and Listeria monocytogenes.

[0052] The embodiment of the present invention also provides a drug for preventing and treating diseases caused by Gram-negative bacteria, comprising the recombinant Bacillus subtilis.

[0053] The primer sequences used in the examples of the present invention are shown in Table 1.

[0054] Table 1 Bacterial species, primers for homology arm amplification and homologous recombination identification

[0055]

[0056]

[0057] Example 1

[0058] Construction of homologous recombination expression vector pHY300PLK-CB:

[0059] (1) The xynA (secreted endo-1,4-beta-xylanase) gene sequence of Bacillus subtilis 1A1 genomic DNA was searched in NCBI (GenBank: QHM08527.1), and the 500 bp sequences of the upstream and downstream homology arms that replaced the signal peptide downstream sequence in the coding region of the xynA gene were selected. The upstream and downstream homology arm primers xynAUp and xynADown were designed using Primer Premier 5 software, and the amplified sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0060] SEQ ID NO.1:aagacacagtaaactaccttatggactgattttttggacatgaaacgttgcattacagcttcaaagtcaa gagcaccacctggcccagcaacaatgacttcacaatctctaatatatatatcttttatacgaaaagattcaatgggaattcattgcagatattactccatctgaattagaaataagaattgtgatcctacgaaaaaaggatcaggatatggtggaagaagaccacttataatgtgtttctaggtatttgtaattaaattacaaatacttttaatatttgctcatgaattcgtggtattatactaaaggggacgatcaaaagctttggcgttagtaattaagaatgttttaaatgtatacgagtgctacctcaaagtcggaaaaaatattataggaggtaacatatgtttaagtttaaaaagaatttcttagttggattatcggcagctttaatgagtattagcttgttttcggcaaccgcctctgcagct;

[0061] SEQ ID NO.2: cagatcatctttaatcaggggtagctaacgggctgatgatcgttccttgagaagttttataatcaatgat tattaaaatcgttagtaatggttaaaggttgttttctactaggtgaacggccttggaattactggaggtagggtattctccatctggttttataactttttctatag gttaatagaatggtatttaaatgagaatgctatcaattttttgtagtcagcgcttgctcacaacagacacctttacataacccttctttatcaaacataagccttact caaaataaaaatatctcagtagttaaccagaatcctcataactttatactagttaacggtgggactgttaagaacaaaaagtctaatttataaatggggactctacgg aacaagacaggttagttcgaaaagaacctaactttaggatttccttagaggattgtatcagctcgaaccaagttttttaatgcgactagctatggaaattaagaaaa.

[0062] (2) The coding region of the Cecropin B gene (Gene ID: 114253025) with a transcription terminator sequence was synthesized by BGI after codon optimization as shown in SEQ ID NO. 3.

[0063] SEQ ID NO. 3: cccaggtggaagatcttcaagaaaattgaaaaaatgggcaggaacatccgtgacggcatcgtcaaa gcgggtccggcgatcgaggtccttggttcggctaaagctattggaaaatga.

[0064] (3) Overlap extension PCR was used to obtain the xynAUp-Cecropin B-xynADown tandem sequence.

[0065] (4) The linearized plasmid pHY300PLK (4872 bp) was obtained by BamHI digestion and seamlessly cloned with the tandem sequence of xynAUp-Cecropin B-xynADown (1117 bp). xynAUp-Cecropin B-xynADown contains the homologous sequences above and below the BamHI restriction site of pHY300PLK. A homologous recombination expression vector was constructed and named pHY300PLK-CB.

[0066] Example 2

[0067] Vector transformation and positive clone screening:

[0068] Identification of Bacillus subtilis strains: Bacillus subtilis 1A1 strains were cultured in LB liquid medium. The starting strain of the present invention, Bacillus subtilis 1A1 strain (Bacillus subtilis 1A1), was purchased from the Bacillus Collection Center of Ohio State University, BGSC website (https: / / bgsc.org / search.php?Search=Bacillus+subtilis), strain number BGSCID: 1A1. rpoA is a primer for identification of Bacillus subtilis strains (target band size is 256bp). Using bacterial liquid as a template, primer rpoA was used for PCR identification of Bacillus subtilis strains.

[0069] Preparation of competent cells of Bacillus subtilis: (1) Take out the frozen bacterial solution from -80℃, thaw it on ice, and then use an inoculation loop to streak the bacterial solution on LB solid culture medium, and place it in a 37℃ water-proof incubator for overnight culture. (2) Pick a single colony with good growth and inoculate it into 20mL LB liquid culture medium, and culture it at 37℃, 180rpm for 12-16h. (3) Pipette 2.5mL of bacterial solution into 40mL growth medium, and culture it at 37℃, 180rpm for 4-5h. (4) After ice bathing the bacterial solution for 10min, divide 40mL of bacterial solution into two 50mL centrifuge tubes. Centrifuge at 4℃, 4200rpm for 15min. (5) Discard the supernatant, resuspend the bacterial pellet with 40mL pre-cooled electroporation solution, mix it by blowing, and centrifuge it again at 4℃, 5000rpm for 15min. Repeat 4 times. (6) Discard the supernatant and resuspend the pellet with 1 mL of electroporation washing solution. Aliquot 80 μL into 1.5 mL EP tubes and use immediately or freeze in a -80°C refrigerator.

[0070] Transformation of recombinant vector pHY300PLK-CB into Escherichia coli: The recombinant vector pHY300PLK-CB was transformed into competent Escherichia coli DH5α by heat shock method, and the bacterial solution was spread on LB solid culture medium with tetracycline (AMP) concentration of 100 μg / mL.

[0071] Extraction of the recombinant vector pHY300PLK-CB from Escherichia coli: Extract the plasmid of Escherichia coli transformed with pHY300PLK-CB, perform concentration detection and electrophoresis verification, send the positive plasmid for testing, use DNAMAN software for sequence alignment of sequencing results, and save the mismatched plasmid for subsequent electroporation experiments.

[0072] Electroporation of Bacillus subtilis with pHY300PLK-CB: (1) Take out the competent cells of Bacillus subtili and thaw slowly on ice. (2) Add pHY300PLK-CB vector to the competent cells of Bacillus subtili and mix by gently blowing. (3) Transfer to a sterile electroporation cup that has been cleaned and pre-cooled at -20℃ for 2h. Move gently and slowly throughout the process. (4) Place the electroporation cup in an ice box for 10min and place the electroporation cup in an electroporator for electroporation. Electroporation conditions: 2.2kv, 25μF, 200Ω, 4ms. (5) Immediately after electroporation, remove the electroporation cup and add 1mL of recovery solution to the cup. Mix by gently blowing and transfer to a 1.5mL EP tube. (6) Culture at 37℃, 90rpm for 3-5h. (7) Centrifuge at 10,000 rpm for 2 min, discard 800 μL of supernatant, resuspend the precipitate in the remaining 200 μL of supernatant, mix well by pipetting, and spread on LB solid medium containing 15 μg / mL tetracycline. Incubate overnight at 37°C for 12-16 h. (8) The next day, pick a single colony from the plate and inoculate it into LB liquid medium containing 15 μg / mL tetracycline for subsequent testing.

[0073] Identification of positive colonies after electroporation: Take the electroporation bacterial solution as a template for bacterial species identification and xynA Up-CecropinB-xynADown tandem sequence target fragment identification. If both the bacterial species identification and target fragment identification results are positive, the remaining bacterial solution is dispensed into 1.5mL EP tubes, and an equal volume of 50% glycerol is added and stored in a -80℃ refrigerator for subsequent experiments.

[0074] Homologous recombination replacement identification PCR primers: Design corresponding homologous recombination identification primers based on the actual measured upstream and downstream homologous arm sequences and Cecropin B gene sequences. xynAUp-CB-xynADown is a replacement identification primer. After homologous recombination, the recombinant bacteria with successful replacement of the target gene produce a target band of 1811bp. xynAUp-CB is a homologous recombination upstream homologous arm exchange identification primer. When the upstream homologous arm exchange is successful, a target band of 842bp is produced; CB-xynADown is a homologous recombination downstream homologous arm exchange identification primer. After the downstream homologous arm exchange is successful, a target band of 735bp is produced.

[0075] Identification of homologous recombination replacement: (1) Take out the electroporation-positive bacterial solution from the -80℃ refrigerator and place it on an ice box to thaw. Use an inoculation loop to streak the bacterial solution on a LB solid culture medium containing tetracycline at a concentration of 15μg / mL, and place it in a 37℃ water-proof incubator for 12-16h. (2) The next day, pick several single colonies and number them, and inoculate them into 4mL LB liquid culture medium containing tetracycline (concentration of 15μg / mL), and culture them at 37℃, 180rpm, and shake for 12h. (3) Subculture every 12h. When the fifth generation is passed, use the bacterial solution as a template and use primers to perform homologous recombination replacement PCR identification. If there are no double bands or positive bands, continue to subculture until double bands or positive bands are produced. (4) When positive bands or double bands appear in the bacterial solution, it proves that homologous recombination has occurred in the bacterial solution. Dip the bacterial liquid and streak it on a LB solid medium containing tetracycline at a concentration of 15 μg / mL, and place it in a 37°C incubator for overnight culture. (5) Pick a single colony and use primers xynAUp-CB-xynADown, xynAUp-CB and CB-xynADown to identify the strain at this time. The strain is in the stage of complete homologous recombination, upstream homologous arm exchange is completed, downstream homologous arm exchange is completed or homologous recombination has not occurred. (6) If a single colony is identified with double bands using primers xynAUp-CB-xynADown, it means that there is a partial homologous recombination strain in the single colony. Separate and streak the colony on a tetracycline resistance plate and culture it at 37°C for 12-16h. (7) If the colony identification result is that one of the upstream homologous recombination or downstream homologous recombination is positive, the colony is in the stage of successful single exchange. The colony can be continued to be subcultured and the identification method of step (5) can be repeated. (8) The single colony produced in step (6) continues to be identified for homologous recombination until only one positive band is found in the PCR amplification product using primers xynAUp-CB-xynADown, and both xynAUp-CB and CB-xynADown have positive bands. This strain is the recombinant bacterium that has successfully undergone homologous recombination exchange, and is named pHY300PLK-CB. (9) The pHY300PLK-CB strain is inoculated into 20 mL LB liquid culture medium and cultured at 37°C and 180 rpm for 12-16 hours. After adding glycerol, the bacterial solution is frozen in a -80°C refrigerator for subsequent experiments.

[0076] Screening of homologous recombination Bacillus subtilis without resistance vector: (1) Streak the identified pHY300PLK-CB strain with successful homologous recombination replacement on LB solid medium containing tetracycline (TET, concentration of 15μg / mL) and culture overnight at 37℃ for 12-16h. (2) Pick 3-5 single colonies with good growth the next day, number them and inoculate them into 10mL EP tubes containing 4mL of LB liquid medium without resistance, and subculture at 37℃. Subculture once every 12h. When the 10th generation is passed, dip a small amount of bacterial liquid and inoculate it on LB solid medium, and incubate it inverted at 37℃ for 12-16h. (3) In the clean bench, pick a single colony with a toothpick, first lightly touch it on the LB solid medium without resistance, then touch it on the corresponding position on the TET solid medium, and incubate it inverted at 37℃ for 12-16h. (4) Observe the plates the next day and pick out the colonies that grow only on the non-resistant plates and die on the tetracycline-resistant plates. Inoculate the qualified colonies into the non-resistant LB liquid medium and TET liquid medium at the same time and culture at 37°C, 180rpm for 12 hours. If there are no qualified colonies on the plate, continue to follow steps (2) and (3) until qualified colonies appear. (5) Observe the bacterial solution every other day. If it grows in the non-resistant LB liquid medium but not in the LB liquid medium containing tetracycline, the screening of the non-resistant vector recombinant Bacillus subtilis is successful. In order to eliminate the possibility of bacterial solution contamination, take part of the bacterial solution and perform strain and replacement identification PCR again.

[0077] Analysis of the growth curve of recombinant bacteria: The pHY300PLK-CB bacterial solution frozen at -80 was inoculated on the TET resistance plate, and the wild bacteria solution was inoculated on the LB plate, and placed in a 37°C incubator for overnight culture. Single colonies of pHY300PLK-CB bacteria and wild bacteria that grew well on the plate culture medium were picked and inoculated into LB liquid culture medium, cultured at 37°C and 180r / min overnight, and then inoculated into LB culture medium with a 1% inoculation volume (100mL of the conical flask has a liquid volume of 50mL), and cultured at 37°C and 200r / min for 24h, sampling every 2h, and measuring OD 600 With the culture time as the horizontal axis, OD 600 The value is the vertical axis, and the growth curves of pHY300PLK-CB bacteria and wild bacteria are drawn to verify whether the Cecropin B gene affects the overall growth level of the strain.

[0078] The results are as follows Figure 4 As shown, the results showed that the growth performance of the pHY300PLK-CB recombinant bacteria was no different from that of the wild-type Bacillus subtilis, and the Cecropin B gene had no effect on the overall growth level of the strain.

[0079] Determination of the stability of the Cecropin B gene in the recombinant bacteria: The pHY300PLK-CB bacterial solution was inoculated on the TET resistance plate and cultured overnight at 37°C. A single colony of pHY300PLK-CB bacteria that grew well on the plate medium was selected and inoculated into the TET resistance liquid medium. After overnight culture at 37°C and 180r / min, it was inoculated into an EP tube containing 4mL LB liquid medium. It was used as the 0-generation bacterial solution sample, and 1% was taken every 12 hours and inoculated into a new LB liquid medium. The target gene sequence was amplified using Cecropin B gene primers after continuous culture to the 35th generation of bacterial solution, and the amplified product was tested by agarose gel electrophoresis.

[0080] The results are as follows Figure 5 , 6 As shown, the results showed that the Cecropin B gene was still stably inherited after 35 generations of culture.

[0081] Example 3

[0082] Xylan-induced method for homologous recombinant Bacillus subtilis expressing Cecropin B:

[0083] qRT-PCR analysis of the difference in Cecropin B expression induced by different concentrations of xylan: After the activated pHY300PLK-CB bacterial solution was transferred to LB liquid medium for 12 hours, the bacterial solution was aspirated into 20mL LB+xylan medium (xylan mass concentration gradient was 0, 0.5%, 1%, 1.5%, 2%) at a 1% inoculation amount and induced for 12 hours. RNA was extracted and reverse transcribed for subsequent experiments. Cecropin B gene fluorescence quantitative PCR primers were designed, and the 16S rRNA of Bacillus subtilis was used as the internal reference gene. qRT-PCR was used to detect the mRNA expression level of Cecropin B gene in recombinant bacteria after adding different concentrations of xylan and different induction times.

[0084] The results are as follows Figure 7 As shown, the expression of Cecropin B gene mRNA was better after adding 0.5% to 1% xylan for 12 hours.

[0085] Analysis of antibacterial function of recombinant Bacillus subtilis: The experimental groups were: wild-type Bacillus subtilis fermentation broth, pHY300PLK-CB bacterial induced fermentation broth. The activated pHY300PLK-CB bacterial broth was inoculated at 1% in 25ml LB liquid medium supplemented with 0.5% xylan, and cultured at 180r / min and 37℃ for 12h. The concentrated supernatant of the fermentation broth and the broken cell liquid were used as samples, and the Oxford cup method was used for the test.

[0086] The specific operation steps are as follows: (1) Salmonella, Escherichia coli, Clostridium perfringens and Listeria monocytogenes were inoculated into LB liquid culture medium respectively, and cultured at 37°C and 120 r / min for 4-6 h until the bacterial concentration was about OD1.0 (OD 600nm ) Take it out and place it at 4℃ for later use. (2) Place the pre-sterilized and dried Oxford cups evenly in the clean and sterile empty culture dishes according to the experimental groups. (3) Take the LB agar that has been melted and cooled to 50-56℃, add the indicator bacteria solution (about 20μL per plate), pour the plate, air-dry the condensed water on the surface, mark and set aside. (4) After the culture medium solidifies, take out the Oxford cup and add the positive control (antibiotics), negative control (LB), fermentation liquid supernatant, and bacterial cell disruption liquid in turn. (5) Carefully remove the culture dish and place it at room temperature for 1 hour. (6) Carefully place the culture dish in a 37℃ constant temperature incubator and observe every 2-3 hours to see if the inhibition zone appears.

[0087] The results are as follows Figures 8 to 11 As shown, the recombinant engineered bacteria of Bacillus subtilis can stably secrete Cecropin B protein, and its fermentation supernatant and bacterial precipitate fragments show antibacterial activity against Salmonella, Escherichia coli and Listeria monocytogenes.

[0088] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A recombinant Bacillus subtilis, characterized in that: Bacillus subtilis 1A1 is used as the starting strain, and a recombinant expression vector constructed with pHY300PLK as the backbone is included; The recombinant expression vector comprises a recombinant expression cassette, which comprises the following elements in sequence from 5' to 3': an upstream homology arm sequence xynA Up from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene, a sequence of the cecropin B coding region, and a downstream homology arm sequence xynADown from the downstream sequence of the signal peptide of the coding region of the Bacillus subtilis xynA gene; The nucleotide sequence of the xynA Up is shown in SEQ ID NO.1; the nucleotide sequence of the xynA Down is shown in SEQ ID NO.2; The nucleotide sequence of the cecropin B coding region is shown in SEQ ID NO.

3.

2. Use of the recombinant Bacillus subtilis as claimed in claim 1 in the production of cecropin B.

3. A method for preparing cecropin B, characterized in that: The recombinant Bacillus subtilis according to claim 1 is used to produce cecropin B under the induction of xylan.

4. The preparation method according to claim 3, characterized in that: The mass concentration of the xylan in the culture medium is 0.5% to 1%.

5. Use of the recombinant Bacillus subtilis as claimed in claim 1 in the preparation of drugs for preventing and treating diseases caused by Gram-negative bacteria.

6. The use according to claim 5, characterized in that: The Gram-negative bacteria include Salmonella and Escherichia coli.

7. A drug for preventing and treating diseases caused by Gram-negative bacteria, characterized in that: Comprising the recombinant Bacillus subtilis according to claim 1.

Images