A miRNA related to sperm motility and fertilization rate of parrots and its application

Abstract

The present invention relates to the field of molecular markers, and specifically provides a miRNA related to sperm motility and fertilization rate of budgies (Melopsittacus undulatus) and its application. The present invention utilizes the miRNA screened to regulate the sperm motility trait of parrots, and the miRNA can be used as a molecular marker related to sperm motility of parrots, and has important application value in the genetic breeding of sperm motility traits of parrots.

Description

Technical Field

[0001] The invention relates to the field of molecular markers, and in particular to miRNA related to sperm motility and fertilization rate of parrots and applications thereof. Background Art

[0002] Sperm motility refers to the percentage of sperm in semen that move forward in a straight line, usually expressed in ten. Since only sperm with forward movement can have normal survival and fertilization ability, sperm motility is the primary indicator for evaluating the reproductive potential of male parrots. Sperm motility has an important impact on the reproduction and protection of endangered parrot species and the genetic selection and breeding of ornamental parrots. In particular, with the development of semen dilution and storage technology and the popularization of artificial insemination technology, the male-female ratio of excellent male parrots can reach 1:50. Therefore, the influence of the sperm motility of male parrots on the fertilization rate of eggs is far greater than that of female parrots. Surveys and studies have shown that parrots generally have low sperm motility, which has affected the reproduction and breeding progress of parrots to a certain extent. Therefore, improving the sperm motility of male parrots is an important goal for the protection of endangered parrot species and the selection and breeding of ornamental parrots.

[0003] Conventional phenotypic selection methods for sperm motility traits have the following disadvantages:

[0004] 1. Long measurement time: Before measuring sperm motility traits, the male parrots need to undergo 2-3 weeks of semen collection training; and due to stability reasons, each male parrot needs to be measured at least 4 times in a row, with an interval of 2 days between each measurement, and even multiple measurements need to be performed at different ages;

[0005] 2. The test results are greatly affected by subjective factors: Sperm motility requires staff to use a professional phase contrast microscope to measure it. Personal subjective judgment and proficiency in technology will have a certain impact on the test results and reduce accuracy;

[0006] 3. Computer-assisted semen quality analysis systems can objectively measure sperm motility traits, but currently related analysis software is mainly for mammals such as humans, cattle and pigs. Since the sperm morphology of parrots is quite different from that of mammals, mainstream analysis software is not suitable for parrots. Semen quality analysis systems developed solely for parrot sperm motility analysis are expensive;

[0007] The above shortcomings lead to problems such as inaccurate measurement, huge consumption of manpower and material resources in the breeding of male parrot fertility, which increases the breeding cost and reduces the progress of breeding.

[0008] miRNA is a class of endogenous non-coding single-stranded small RNA molecules with a length of 21 to 25 nucleotides, which has the function of regulating gene expression after transcription. Studies have shown that miRNA is widely expressed in testicular germ cells and plays an important regulatory role in spermatogenesis and sperm motility. MiRNA and its regulated target gene mRNA are usually negatively correlated. Therefore, by high-throughput sequencing and joint analysis of miRNA and mRNA expression profiles in testicular tissues of parrots with different sperm motility, miRNA and key genes related to sperm motility traits can be accurately identified. Relevant miRNA can be used as a molecular marker to achieve early and accurate selection of target traits and accelerate the breeding progress of sperm motility traits. Summary of the invention

[0009] The present invention mainly aims at the above technical problems and provides a miRNA related to sperm motility or fertilization rate of parrots. The miRNA is mun-miR-215-5p, and its nucleotide sequence is 5'-AUGACCUAUGAAUUGACAGAC-5' (SEQ ID NO.1).

[0010] On the other hand, the present invention provides the use of mun-miR-215-5p in regulating sperm motility of parrots.

[0011] Furthermore, the regulation of parrot sperm motility is achieved by increasing the expression of mun-miR-215-5p.

[0012] On the other hand, the present invention provides a primer set for detecting sperm motility or fertilization rate of parrots, characterized in that the primer set comprises an upstream primer sequence 5'-ACACTCCAGCTGGGTTCTGA ACGAGACT-3' (SEQ ID NO.2) of the target miRNA, a downstream primer 5'-TGGTGTCGTGGAGTCG-3' (SEQ ID NO.3), a neck loop primer sequence 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3' (SEQ ID NO.4), an internal reference upstream primer 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO.5), and an internal reference downstream primer 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO.6).

[0013] On the other hand, the present invention provides another set of primers for detecting sperm motility or fertilization rate of parrots, wherein the primers include an upstream primer sequence for detecting ICAM1 gene of 5'-CCTTCCTCACCGTGTACTGG-3' (SEQ ID NO.7), a downstream primer sequence of 5'-AGCGTAGGGTAAGGTTCTTGC-3' (SEQ ID NO.8), an upstream primer sequence of an internal reference gene of 5'-ATGCAGCAGATCCGCATGT-3' (SEQ ID NO.9), and a downstream primer sequence of 5'-TCATGGTGTTCTTGCCCATCA-3 (SEQ ID NO.10)'.

[0014] On the other hand, the present invention provides a fluorescent quantitative PCR kit for detecting sperm motility or fertilization rate of parrots, wherein the kit comprises a primer set for detecting mun-miR-215-5p.

[0015] Preferably, the kit further comprises a primer set for detecting the ICAM1 gene.

[0016] Furthermore, the kit also includes a reverse transcription reagent and a fluorescent quantitative PCR reaction solution.

[0017] On the other hand, the present invention provides a method for breeding a parent parrot with high sperm motility or high fertilization rate, characterized in that the method comprises the following steps:

[0018] 1) Detecting the expression level of mun-miR-215-5p in parrot testicular tissue using the aforementioned primer set or kit;

[0019] 2) Screen parent parrots with high sperm motility or high fertilization rate based on the expression level of mun-miR-215-5p.

[0020] Furthermore, the step 1) further comprises the following steps:

[0021] a) collecting testicular tissue of parrots to be tested and extracting RNA;

[0022] b) performing miRNA reverse transcription;

[0023] c) using the aforementioned primer set or kit to detect the expression level of mun-miR-215-5p in parrot testicular tissue.

[0024] Furthermore, the step 1) further comprises the following steps:

[0025] d) The screening criteria are to retain the top 30% of individuals with mun-miR-215-5p expression levels from high to low as parent parrots with high sperm motility or high fertilization rate.

[0026] In another aspect, the present invention provides the use of the aforementioned primer set or kit in predicting the sperm motility or fertilization rate of parrots. In another aspect, the present invention provides the use of the aforementioned primer set or kit in selecting parent parrots with high sperm motility or high fertilization rate in genetic marker-assisted breeding.

[0027] Compared with the prior art, the present invention uses a single molecular marker to simply and effectively predict the energy and vitality of parrots. The differential expression of this marker between samples with high and low sperm motility is 5.8 times, so that this molecular marker can be used in assisted selection breeding related to sperm motility traits of parrots, reducing breeding costs and improving breeding progress. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The relative expression results of mun-miR-215-5p in parrots with high and low sperm motility groups.

[0029] Figure 2 The relative expression results of ICAM1 gene in parrots with high and low sperm motility groups.

[0030] Figure 3 Figure 2 ROC curve of mun-miR-215-5p for predicting sperm motility in parrots. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and beneficial technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention.Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.The experimental methods used in the following examples are conventional methods unless otherwise specified.The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0032] Example 1 Based on transcriptome high-throughput sequencing technology and bioinformatics analysis, the miRNA (mun-miR-215-5p) gene related to sperm motility traits of parrots and its target gene ICAM1 were obtained

[0033] 1. Experimental animal screening and sample collection

[0034] 100 20-week-old male budgies (Melopsittacus undulatus) raised at the teaching base of Guangdong Ecological Engineering Vocational College were used as experimental animals. At 20-24 weeks of age, the breeder performed abdominal massage training every other day for semen collection. Starting from 25 weeks of age, semen was collected every two days, and sperm motility was measured 6 times by phase contrast microscopy. According to the results of sperm motility test, 10 male parrots with high sperm motility and 10 male parrots with low sperm motility were selected. 100 female parrots of the same generation were selected and artificially inseminated with the 20 male parrots selected in the previous step at a male-female ratio of 1:5. According to the sperm density, the semen was diluted proportionally to ensure that a uniform number of sperm was input into each female parrot. More than 20 breeding eggs were collected for incubation for each male parrot. On the 12th day after incubation, the eggs were illuminated, the number of unfertilized eggs was counted, and the fertilization rate (%) of the corresponding breeding eggs of each male parrot was calculated = [(number of incubated eggs - number of unfertilized eggs) / number of incubated eggs] × 100%. One-way ANOVA using SPSS22.0 software was used for data analysis, and the results were expressed as "mean ± standard deviation".

[0035] According to the results of sperm motility and egg fertilization rate, three male parrots were selected in the high sperm motility and high fertilization rate group and the low sperm motility and low fertilization rate group. The sperm motility and egg fertilization rate of the sequencing samples are shown in Table 1. The testicular tissue samples were collected and quickly stored in liquid nitrogen. The total RNA of the testicular tissue was extracted using an RNA extraction kit, and the RNA sequencing library was constructed for transcriptome sequencing.

[0036] Table 1 Sperm motility and egg fertilization rate of sequenced samples

[0037]

[0038] 2. Analysis of differentially expressed miRNA and mRNA based on high-throughput sequencing results

[0039] The miRNA expression was normalized by TPM method, and the edgeR software was used to analyze the expression, and the miRNAs differentially expressed in the testicular tissue of the high sperm motility group and the low sperm motility group (control) were screened out. The mRNA expression was normalized by FPKM, and the DESeq2 software was used for differential expression analysis, and the mRNAs significantly differentially expressed in the testicular tissue of the high sperm motility group and the low sperm motility group (control) were screened out. We focused on analyzing the miRNAs related to energy and vitality that have been reported or previously studied in other species by our laboratory. The results are as follows: mun-miR-215-5p was differentially expressed in parrots, and other miRNAs were non-differentially expressed, indicating that miRNAs in different species have functional differences:

[0040]

[0041] 3. Combined analysis of differentially expressed mRNA and miRNA for key miRNA screening

[0042] DIANATOOLS software was used to predict differentially expressed miRNA target genes. Differentially expressed mRNA information was used for miRNA-mRNA interaction analysis. The target gene prediction results showed that mun-miR-215-5p could target and bind to the 3'UTR region of the ICAM1 gene. The expression of mun-miR-215-5p was upregulated in the high sperm motility group, and the expression of the ICAM1 gene was downregulated in the high sperm motility group, which was consistent with the functional expectations of miRNA negative regulatory genes. ICAM1 is a cell surface adhesion molecule, and the expression of the ICAM1 gene may lead to weakened sperm motility. This study found that mun-miR-215-5p may affect parrot sperm motility by regulating ICAM1.

[0043] Example 2: Verification of the correlation between mun-miR-215-5p and sperm motility traits using different populations

[0044] qRT-PCR was used to verify the expression levels of mun-miR-215-5p and its target gene ICAM1, which were associated with sperm motility traits and identified by high-throughput sequencing analysis, in a large population.

[0045] 1. Test materials

[0046] Semen of 100 25-week-old parrots was collected, and sperm motility was measured six times using a phase contrast microscope. According to the results of sperm motility test, 30 male parrots with high sperm motility and 30 male parrots with low sperm motility were selected. A small amount of parrot testicular tissue was collected using a testicular puncture needle and frozen in liquid nitrogen for subsequent research.

[0047] 2. Verification of differential expression of mun-miR-215-5p

[0048] Total RNA from the testicular tissue of the 60 male parrots was extracted using an RNA extraction kit. TM RT reagent Kit with gDNA Eraser was used for reverse transcription (including neck loop primer and random primer) to obtain cDNA that can be used for qPCR. Fast qPCR Mix kit was used for qPCR reaction. qPCR reaction was carried out on Bio-Rad CFX96 fluorescence quantitative PCR instrument.

[0049] The upstream primer sequence of mun-miR-215-5p was 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', the downstream primer was 5'-TGGTGTCGTGGAGTCG-3', the internal reference upstream primer was 5'-CTCGCTTCGGCAGCACA-3', and the downstream primer was 5'-AACGCTTCACGAATTTGCGT-3'. The qPCR reaction program was: 95℃5min; 35 cycles (94℃15s, 60℃30s). The T test of SPSS22.0 software was used to test the significant difference in the expression of mun-miR-215-5p between high sperm motility and low sperm motility. The results showed that mun-miR-215-5p was significantly higher in the high sperm motility level of parrots (P<0.05) than in the low sperm motility group, and the differential expression reached 5.8 times ( Figure 1 ).

[0050] 3. Verification of differential expression of ICAM1 gene

[0051] The cDNA of parrot testis tissue obtained in the previous step was used as a template to specifically amplify the relevant genes. The upstream primer sequence of ICAM1 gene was 5'-CCTTCCTCACCGTGTACTGG-3', and the downstream primer sequence was 5'-AGCGTAGGGTAAGGTTCTTGC-3'; the upstream primer sequence of internal reference gene GAPDH was 5'-ATGCAGCAGATCCGCATGT-3', and the downstream primer sequence was 5'-TCATGGTGTTCTTGCCCATCA-3'. The qPCR reaction program was: 95℃5min; 35 cycles (94℃15s, 60℃30s). The T test of SPSS22.0 software was used to test the significant difference of the expression of ICAM1 gene between high sperm motility and low sperm motility, and P < 0.05 was considered significant. The results showed that the ICAM1 gene mRNA content in the testis tissue of the high sperm motility parrots was significantly lower (P < 0.05) than that in the testis tissue of the low sperm motility parrots, and the difference in expression was 2.5 times ( Figure 2 ).

[0052] Example 3: qRT-PCR kit for detecting the expression level of mun-miR-215-5p in parrots

[0053] The kit comprises: a parrot testis puncture needle, a tissue RNA extraction and reverse transcription reagent, a reverse transcription collar primer, a specific primer of a target miRNA, an internal reference primer and a qRT-PCR reaction solution.

[0054] Reverse transcription reagent: PrimeScript purchased from TAKARA TMRT reagent Kit with gDNAEraser, the specific components are Reverse Transcriptase Mix and gDNA Eraser.

[0055] The upstream primer sequence of mun-miR-215-5p was 5′-ACACTCCAGCTGGGTTCTGA ACGAGACT-3′, the downstream primer was 5′-TGGTGTCGTGGAGTCG-3′, the internal reference upstream primer was 5′-CTCGCTTCGGCAGCACA-3′, and the downstream primer was 5′-AACGCTTCACGAATTTGCGT-3′.

[0056] qRT-PCR reaction solution: purchased from TAKARA TB Fast qPCR Mix, whose specific ingredients are TBGreen PCR Master Mix and miRNA Primer.

[0057] The working procedure of the qPCR of the kit is 95°C for 5 min; 35 cycles (94°C for 15 s, 60°C for 30 s).

[0058] Example 4: Using miRNA as a molecular marker to screen parrot parents with high sperm motility / high fertilization rate

[0059] 60 20-week-old male parrots raised at the teaching base of Guangdong Ecological Engineering Vocational College were used as experimental animals. The semen collected from each male parrot was used to evaluate sperm motility traits, and artificial insemination was performed at a male-female ratio of 1:5. For the first time, each female parrot was inseminated for two consecutive days, and then inseminated every three days. The breeding eggs within 10 days after the first insemination were collected and incubated. On the 12th day after incubation, the eggs were illuminated and the number of unfertilized eggs was counted. The fertilization rate (%) of the corresponding breeding eggs of each male parrot was calculated = [(number of incubated eggs - number of unfertilized eggs) / number of incubated eggs] × 100%. At 25 weeks of age, trace testicular tissues of the above 60 breeding male parrots were collected, and total RNA was extracted using an RNA extraction kit. PrimeScript RNA extraction kit from TAKARA was used. TM RT reagentKit with gDNA Eraser was used for reverse transcription, and then TAKARA's TB Fast qPCR Mix kit was used for qPCR reaction. qPCR reaction was performed on Bio-Rad CFX96 fluorescence quantitative PCR instrument. The upstream primer sequence of mun-miR-215-5p was 5'-ACACTCCAGCTGGGTTCTGA ACGAGACT-3', the downstream primer was 5'-TGGTGTCGTGGAGTCG-3', the internal reference upstream primer was 5'-CTCGCTTCGGCAGCACA-3', and the downstream primer was 5'-AACGCTTCACGAATTTGCGT-3'. The qPCR reaction program was: 95℃5min; 35 cycles (94℃15s, 60℃30s). The individual mun-miR-215-5p expression levels were ranked from high to low, and the 18 male parrots with the highest expression of mun-miR-215-5p were selected according to the 30% seed retention rate. As shown in Table 2, the difference in sperm motility of male parrots was analyzed, and it was found that the sperm motility of the 18 male parrots with the highest expression of mun-miR-215-5p was significantly higher than that of the remaining 42 male parrots. This shows that mun-miR-215-5p can be used as a marker to judge the sperm motility or fertilization rate of parrots.

[0060] Table 2 Sperm motility and egg fertilization rate of sequenced samples

[0061]

[0062] Further, taking sperm motility as the standard, the ROC curve of mun-miR-215-5p was drawn according to the first 30% motility as qualified and the rest as unqualified, as shown in Figure 3 As shown, AUC = 0.85, indicating that the method of using mun-miRN-215-5p to judge the sperm motility or fertilization rate of parrots has good performance.

[0063] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. The application of mun-miR-215-5p in regulating sperm motility of parrots, characterized in that: The nucleotide sequence of the mun-miR-215-5p is AUGACCUAUGAAUUGACAGAC, the regulation of parrot sperm motility is achieved by increasing the expression of mun-miR-215-5p, and the application is the diagnosis and treatment of non-diseases.

2. A method for breeding parent parrots with high sperm motility or high fertilization rate, characterized in that: The method comprises the following steps: 1) Detecting the expression level of mun-miR-215-5p in parrot testicular tissue using a primer set, the primer set comprising an upstream primer sequence 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', a downstream primer sequence 5'-TGGTGTCGTGGAGTCG-3', a neck loop primer sequence 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3', an internal reference upstream primer 5'-CTCGCTTCGGCAGCACA-3', and an internal reference downstream primer 5'-AACGCTTCACGAATTTGCGT-3'; 2) Screening parent parrots with high sperm motility or high fertilization rate according to the expression level of mun-miR-215-5p, wherein mun-miR-215-5p is upregulated in parent parrots with high sperm motility or high fertilization rate, and the method is for non-disease diagnosis and treatment purposes.

3. The use of a primer set in predicting sperm motility or fertilization rate of parrots, characterized in that: The primer set comprises an upstream primer sequence 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', a downstream primer sequence 5'-TGGTGTCGTGGAGTCG-3', a neck loop primer sequence 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3', an internal reference upstream primer 5'-CTCGCTTCGGCAGCACA-3', and an internal reference downstream primer 5'-AACGCTTCACGAATTTGCGT-3'. The application is for non-disease diagnosis and treatment purposes.

4. The use of the kit in predicting sperm motility or fertilization rate of parrots, characterized in that: The kit comprises a primer set, which comprises an upstream primer sequence of 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', a downstream primer sequence of 5'-TGGTGTCGTGGAGTCG-3', a neck loop primer sequence of 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3', an internal reference upstream primer of 5'-CTCGCTTCGGCAGCACA-3', and an internal reference downstream primer of 5'-AACGCTTCACGAATTTGCGT-3'. The application is for non-disease diagnosis and treatment purposes.

5. The use of a primer set for selecting parent parrots with high sperm motility or high fertilization rate in genetic marker-assisted breeding, the primer set comprising an upstream primer sequence 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', a downstream primer sequence 5'-TGGTGTCGTGGAGTCG-3', a neck loop primer sequence 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3', an internal reference upstream primer 5'-CTCGCTTCGGCAGCACA-3', and an internal reference downstream primer 5'-AACGCTTCACGAATTTGCGT-3', and the use is for non-disease diagnosis and treatment purposes.

6. The use of a kit for selecting parent parrots with high sperm motility or high fertilization rate in genetic marker-assisted breeding, the kit comprising a primer set, the primer set comprising an upstream primer sequence 5'-ACACTCCAGCTGGGTTCTGAACGAGACT-3', a downstream primer sequence 5'-TGGTGTCGTGGAGTCG-3', a neck loop primer sequence 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTCA-3', an internal reference upstream primer 5'-CTCGCTTCGGCAGCACA-3', and an internal reference downstream primer 5'-AACGCTTCACGAATTTGCGT-3', and the use is for non-disease diagnosis and treatment purposes.

Images