Bacillus subtilis strain tolerant to low ph and high concentrations of urea
By constructing Bacillus subtilis strain 5 using CRISPR/Cas9 gene editing technology, the problem of wasting non-essential genes was solved, and the growth performance of the strain under low pH and high urea concentration conditions was improved, thus optimizing the strain's performance and metabolic flux.
Patent Information
- Application Number
- CN202311452002.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-02
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2043-11-02
AI Technical Summary
Existing Bacillus subtilis strains exhibit waste of resources and energy due to the expression of non-essential genes and the accumulation of non-target chemicals. Furthermore, it is difficult to simultaneously delete multiple non-essential genes, which would affect the growth and metabolism of the strain.
Using CRISPR/Cas9 gene editing technology, large-fragment gene knockout was achieved by designing multiple sgRNA expression cascades and optimizing repair templates. Bacillus subtilis strain 5 was constructed, knocking out a 26.4Kb region from dinB to ydhUc in the genome, thereby improving editing efficiency and strain stress tolerance.
It significantly improved the growth performance of the strain under low pH and high urea conditions, enhanced the strain's stress tolerance and metabolic flux optimization capabilities, and is suitable for strain performance screening, protein expression platform construction, and metabolic engineering.
Smart Images

Figure CN118620810B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a 5th strain obtained by knocking out a large fragment of a non-essential gene of Bacillus subtilis 168, which can be used in the fields of chassis modification, tolerance improvement, strain performance optimization, metabolic engineering, etc., and belongs to the technical field of synthetic biology. BACKGROUND
[0002] Bacillus subtilis is a typical model industrial microorganism, which is identified as a host strain of biological safety (GRAS) and is widely used in various fields including protease preparations, fine chemicals, nutritional products, and pharmaceuticals. Although Bacillus subtilis has good application prospects, the expression of non-essential genes and the accumulation of non-target chemicals in production applications cause the loss of precursor substances, the dispersion of metabolic flow, and the expression of bypass pathways, resulting in the waste of resources and energy. Therefore, the redundancy of some non-essential genes in the chassis cell is one of the limiting bottlenecks for industrial application. Only by realizing the redistribution of resources in the chassis cell of Bacillus, improving the utilization of substrates and energy, knocking out some non-essential genes of Bacillus subtilis, and optimizing the metabolic flow of different products, can we finally obtain an efficient chassis cell of Bacillus.
[0003] The knockout method of non-essential genes mainly includes site-directed editing and random mutagenesis. Random mutagenesis mainly causes mutations in the genome through chemical or physical means, but the mutation site and the size of the deletion are not certain, so it is less used in the construction of knockout library. Site-directed editing mainly includes Cre / loxp-based homologous recombination and CRISPR gene editing technology, which can delete about 130 kb of genome at a time and is more suitable for non-essential gene simplification. Among them, the CRISPR / Cas9-based genome editing technology developed in recent years only needs to design N20 and repair templates for different sites, which can be used for gene editing, and is more convenient and efficient. Therefore, it has been widely used in the construction of knockout library.
[0004] Determining the knockout region is an important link in the establishment of a non-essential gene knockout library, and is crucial for the function and potential application of the knockout library. Although theoretically all non-essential genes can be knocked out individually, deleting multiple non-essential genes at the same time is limited by strain growth and metabolism, and not all non-essential genes can be deleted at the same time. Therefore, based on transcriptomic analysis, combined with gene function information and comparative genomics analysis, a reasonable gene deletion site is determined, an efficient editing site is determined by targeted design, and the editing method of long fragment knockout is optimized, so as to construct a chassis cell with predictable long fragment knockout.
[0005] Based on the strain after large fragment region knockout, the physiological characteristics and metabolism are different, the bacillus subtilis can be used for strain performance screening, including bulk chemical tolerance screening, stress acclimation, identification of essential genes of bacillus subtilis and genes affecting growth and metabolism of the strain, construction of protein expression platform, including improving the expression and activity of protein and industrial enzyme, microbial chassis modification, including protein secretion pathway modification, metabolite synthesis pathway modification, genome simplification, and application of metabolic engineering, such as screening and construction of high-yield strain of bulk chemicals, food additives and natural products. SUMMARY
[0006] The purpose of the present application is to provide a bacillus subtilis strain with high tolerance, which can be used for strain performance screening, protein expression platform construction, microbial chassis modification, metabolic engineering, etc.
[0007] The inventors of the present application analyzed the transcriptome of bacillus subtilis 168 strain in the research, combined with gene function information and comparative genomics analysis method, and carried out large fragment knockout on bacillus subtilis 168 strain. Meanwhile, the gene editing method of CRISPR / Cas9 is optimized, a kind of efficient method for constructing large fragment knockout system is provided, all expression elements are contained in a skeleton, different sgRNA expression frames are designed to avoid homologous recombination of repeated fragments, multiple N20 are introduced at one time, and the repair template is optimized, so as to improve the efficiency of large fragment knockout. This method can realize the knockout of large fragment within 4 days, accelerate the speed of large fragment editing, and the method is simple and easy to operate.
[0008] One of the technical solutions provided by the present application is a bacillus subtilis strain with high stress tolerance, which is obtained by knocking out the sequence shown in the sequence table SEQ ID NO. 1 on the genome of bacillus subtilis 168 strain as the starting strain, and the recombinant strain after knockout is named bacillus subtilis No. 5 strain (i.e. No. 5 strain, or Δ5 strain).
[0009] Further, the knockout sequence is located at 608,246 to 634,651 on the genome; the position number of the knockout sequence on the genome is referred to https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000009045.1 / , and the GenBank accession number of the whole genome of bacillus subtilis 168 strain is: NC_000964.3.
[0010] The second technical solution provided by the application is the application of Bacillus subtilis 5, in particular, the application in the construction of acid-resistant chassis, the production of amino acids, the production of lactic acid, the construction of urea-resistant chassis, the production of urease, and the degradation of urea.
[0011] Beneficial effects:
[0012] The constructed non-essential gene knockout strain is evaluated for performance, including the determination of the growth of the knockout strain under LB, pH stress, and urea stress conditions, and it is found that the knockout strain has good stress tolerance.
[0013] The Bacillus subtilis 5 strain obtained by knocking out the full-length 26.4Kb large fragment from dinB to ydhUc (shown in SEQ ID NO. 1) can solve the problem of poor growth of the wild-type Bacillus subtilis 168 strain under the condition of pH5 or high-concentration urea. 600 The OD value of the wild-type Bacillus subtilis 168 strain is 0.45, while the OD value of the 5 strain reaches about 1.5 after 12h of growth. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 The non-essential gene knockout process of Bacillus subtilis 168 strain;
[0015] Among them, (A) is the knockout schematic diagram of the 5 strain; (B) is the homologous arm outer verification gel diagram of the knockout fragment; (C) is the gene internal verification gel diagram of the knockout fragment;
[0016] In figures B and C, lane M is marker; lane C is the wild-type Bacillus subtilis 168 strain; lanes 1-8 are 26.4kb knockout strains.
[0017] Figure 2 The growth curve of the wild-type Bacillus subtilis 168 strain under different pH conditions;
[0018] Among them, (A) is the growth curve of the wild-type Bacillus subtilis 168 strain and the 5 strain in LB; (B) is the growth curve of the wild-type Bacillus subtilis 168 strain under different pH conditions.
[0019] Figure 3 The growth curve of the 5 strain and the wild-type Bacillus subtilis 168 strain under pH5 conditions.
[0020] Figure 4 Transcriptome profile at pH 5.
[0021] Figure 5 Growth curve of wild type Bacillus subtilis 168 strain under different concentrations of urea.
[0022] Figure 6 Growth curve of No.5 strain under 60 g / L urea.
[0023] Figure 7 Transcriptome profile under 60 g / L urea.
[0024] In the above figures, Δ5 refers to the No.5 strain of Bacillus subtilis constructed by the present application. DETAILED DESCRIPTION
[0025] The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0026] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.
[0027] The following examples are a detailed description and explanation of the technical solutions of the present application and are not intended to limit the present application.
[0028] Table 1 Part of the primers and sequences involved in the embodiments of the present application
[0029]
[0030] The Bacillus subtilis 168 in the present application and embodiments has been disclosed in a large number of prior art, such as in the document “Harwood CR, Wipat A. Sequencing and functional analysis of the genome of Bacillus subtilis strain 168. FEBS Lett. 1996 Jun 24; 389(1): 84-7. doi:10.1016 / 0014-5793(96)00524-8. PMID: 8682212.” and is also a commonly used model bacteria in the field of biotechnology, and the public can obtain it from the Enzymology and Metabolic Engineering Laboratory of Beijing University of Technology.
[0031] The present application is further explained and described by specific embodiments below.
[0032] Example 1: Knockout of non-essential genes dinB to ydhUc of Bacillus subtilis 168 strain
[0033] In this embodiment, the B. subtilis 168 strain is used as the starting strain, and the full-length 26.4Kb large fragment from dinB to ydhUc (as shown in the sequence table SEQ ID NO. 1, the sequence located at 608,246-634,651 of the genome NC_000964.3, including dinB, ydgG, ydgH, ydgI, ydgJ, ydgK, ydhB, ydhC, spoL, ydhE, ydhF, phoB, fra, ydhH, ydhI, ydhJ, ydhK, pbuE, aswA, gmuB, gmuA, gmuC, gmuD, gmuR, gmuE, gmuF, gmuG, ydhUc gene) is knocked out by using double N20, and the B. subtilis No. 5 strain is obtained.
[0034] Single N20 can cause a double-strand break in the genome, but for long editing regions, the break region is too far from the homologous recombination region at both ends, and cannot effectively initiate homologous recombination for double crossing over. Therefore, the system using single N20 has low editing efficiency for ultra-long fragment, and it is difficult to obtain a knockout strain. We plan to use double N20 to knockout long fragments of the strain, and the specific method for editing and knocking out a 26.4kb region in the genome of the B. subtilis 168 strain is as follows:
[0035] (1) Knockout dinB to ydhUc region (shown in SEQ ID NO. 1), two rounds of plasmid construction are needed for editing by circular template. First, introduce N20 sequence, select two N20 sequences with high efficiency and low off-target by website: N20-1 tcggttgaatatttgttgat and N20-2 gcattcatatcgcctaaccc, respectively at the head and tail of the knockout region, and design bidirectional primers Δ5-N20-1 and Δ5-N20-2 and Δ5-N20-3 and Δ5-N20-4. Introduce N20-1 into plasmid pJOE-8999 by PCR to construct knockout plasmid pJOE-8999-1, the total PCR system is 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL upstream primer Δ5-N20-1, 2 μL downstream primer Δ5-N20-2 and 1 μL template pJOE-8999. The PCR program is: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 20 s, set 30 cycles. Obtain the first round of construction plasmid pJOE-8999-N20-1. Then introduce N20-2 into plasmid pJOE-8999-N20-1 by PCR to construct knockout plasmid pJOE-8999-N20-2, the primers are Δ5-N20-3 and Δ5-N20-4, and the PCR program is the same as that for pJOE-8999-1 construction.
[0036] (2) Take the plasmid pJOE-8999-N20-2 constructed in step (1) as the template, and introduce the repair fragment on this basis.
[0037] ① First, perform PCR on the template pJOE-8999-N20-2, with upstream primer F1 5'-ATAAGGCCTTTCTAGATTAAGAAATAATCTTCATCTAAAATATACTTCAG-3' and downstream primer F2 5'-CGTTGGCCGTCGACC-3', the total PCR system is 50 μL, including 25 μL primestar high-fidelity enzyme, 20 μL ddH2O, 2 μL F1, 2 μL F2 and 1 μL pJOE-8999-N20-2 as template, the PCR program is: 98℃ 1 min, 56℃ 15 s, 72℃ 1 min 20 s, set 30 cycles. The target size is about 8K, which becomes the plasmid backbone R1 constructed in this round.
[0038] Secondly, the position of the repair fragment is selected at about 1 kb upstream and downstream of the knockout region. The primer Δ5-HA-1, Δ5-HA-2 and Δ5-HA-3, Δ5-HA-4 are used to perform PCR with the B. subtilis 168 genome as a template to obtain the upstream and downstream homology arm fragments. The band size is verified by gel electrophoresis. In order to improve the construction efficiency of the plasmid, the upstream and downstream homology arm fragments are subjected to oePCR to make them into a 2 kb fragment, i.e. the repair fragment R2.
[0039] III. Gibson assembly method is used to connect R1 and R2. The Gibson connection system is generally configured as 10 μL, and the specific ratio is: 0.065 pmol R2 and 0.035 pmol R1, 5 μL Gibson Master Mix, and water is added to 10 μL. After mixing, it is placed in a 50°C water bath for 30 minutes. The ligation product is transformed into 100 μL of commercial E. coli JM109 competent cells, which are subjected to ice bath for 20 min, 42°C heat shock for 45 s, immediately placed on ice for 2 min, then immediately added with 700 μL of SOC medium, and recovered at 37°C, 200 rpm for 45 min. After centrifugation at 4000 rpm for 2 min, 500 μL of supernatant is removed, and the remaining bacterial solution is evenly coated on the corresponding resistant plate and placed at 37°C for overnight culture. Single colonies are picked and plasmid extraction is performed for sequencing verification. If the corresponding N20 and homology arm are successfully introduced in the sequencing results, it means that the correct knockout plasmid is obtained.
[0040] (3) The knockout plasmid constructed in step (2) is transformed into the competent cells of B. subtilis 168, which is recovered at 37°C, 200 rpm for 2 h, and 200 μL is coated on the LB plate containing 20 μg / mL of kanamycin resistance and 0.2% mannose, and placed at 30°C for overnight culture. Single colonies are picked and verified by homology arm outer primers Δ5-Test-1 and Δ5-Test-2 and intragenic primers Δ5-Test-3 and Δ5-Test-4, and the editing success single colony is obtained, and the editing efficiency is 100% (the verification diagram is shown in Figure 1 B and 1C, wherein Figure 1 B is a 2 kb band obtained by homology arm outer PCR).
[0041] The single colony with correct verification was inoculated into LB medium without antibiotics and cultured at 37°C for 12 h, then streaked on a plate without antibiotics and cultured in a 37°C incubator for 12 h, then single colonies on the plate were picked and streaked on plates without antibiotics and kanamycin, respectively. If it could grow on the plate without antibiotics but not on the plate with antibiotics, it indicated that the plasmid was successfully lost. After the plasmid was lost, the obtained strain was named Bacillus subtilis No. 5 strain and stored in a -80°C refrigerator.
[0042] Example 2: Bacillus subtilis No. 5 strain can grow normally in a nutrient-rich medium.
[0043] This example is used to illustrate that after knocking out a full-length 26.4 Kb large fragment from dinB to ydhUc (shown in SEQ ID NO. 1) on the genome, Bacillus subtilis No. 5 strain has no significant effect on growth in a nutrient-rich LB medium.
[0044] (1) Knocking out of non-essential genes has no obvious effect on strain growth and metabolism, but there are a large number of non-essential genes in the genome. By knocking out the entire non-essential module, more biological energy can flow to functional modules and essential genes, avoiding the loss of energy and carbon source in metabolic engineering. At present, it has been identified that the essential genes of Bacillus subtilis 168 strain are 251, and other single genes are verified to be knocked out one by one. Therefore, we knocked out the dinB to ydhUc region, and evaluated the performance of the knockout strain.
[0045] (2) The wild-type Bacillus subtilis 168 strain and the constructed No. 5 knockout strain were respectively streaked on LB plates and placed in a 37°C incubator for 12 h. Three single colonies were respectively picked from the plates and inoculated into shaking tubes, which were cultured at 37°C and 220 rpm for 10-12 h. Then, they were transferred to a shaking flask containing 20 mL of LB medium at an inoculation amount of 1%, and continued to be cultured at 37°C and 220 rpm for 24 h. The growth was determined every 4 h. 200 μL was taken into a 96-well enzyme plate, and the OD 600 was measured by using an enzyme marker if the OD value was greater than 0.8. The bacterial solution needed to be diluted by an appropriate number of times to make the OD 600 value measured by the enzyme marker between 0.2 and 0.8. At the same time, blank LB was used as a control, and the real OD value was obtained by subtracting the blank control from the actual measured OD value, and the growth curves of Bacillus subtilis 168 strain and No. 5 strain were drawn.
[0046] (3) The results are shown in Figure 2 A, compared with the wild-type Bacillus subtilis 168 strain, the No. 5 knockout strain can grow normally Figure 2 A), and the OD 600about 2.5. It is illustrated that there is no gene related to normal growth of B. subtilis in the knockout region, and the strain can be applied in the field of metabolic engineering.
[0047] Example 3: pH tolerance determination of wild-type B. subtilis 168 strain
[0048] This example is used to illustrate that the wild-type B. subtilis 168 strain does not grow at all under the conditions of pH 3 and pH 4, and the growth is significantly inhibited under the condition of pH 5, compared with the control condition pH 7.
[0049] (1) In the production fermentation process, the growth environment of the strain changes with the fermentation process, the fermentation time is prolonged, various organic acids accumulate in the culture medium, the pH in the culture medium is constantly lowered, the cell survival is stressed and the metabolism is inhibited, ultimately leading to a decrease in the yield of the target product. Therefore, it is an important link in industrial production to obtain a strain capable of tolerating low pH by modification, and a strain capable of tolerating low pH is screened and its genotype is analyzed. In this example, the pH tolerance of the wild-type B. subtilis 168 strain is verified to determine the pH tolerance detection conditions.
[0050] (2) This experiment uses GMII as the basic medium, which only contains carbon sources and inorganic salts necessary for growth, and other growth factors such as amino acids and cofactors necessary for growth are not provided, but are synthesized by the strain itself. On the basis of the basic medium, pH is adjusted with citric acid and sodium citrate to prepare media with pH 3, pH 4, pH 5 and pH 7. The growth determination process is the same as in Example 2, and only the LB medium is replaced with GMII with different pH.
[0051] The composition of the GMII medium is: 1.5% K2HPO4·3H2O, 0.6% KH2PO4, 0.2% (NH4)2SO4, 0.2% MgSO4, 0.1% sodium citrate, 0.05 mL 10% yeast powder, 0.25 mL 20% glucose, 0.04 mL 1% hydrolyzed casein, 0.05 mL 0.1 mol / L CaCl2, 1 mL 25 mmol / L MgCl2.
[0052] (3) After drawing the growth curve, the results show that Figure 2 B), compared with the normal GMII culture condition (pH 7.0), B. subtilis 168 strain does not grow at all under the conditions of pH 3 and pH 4, indicating that the over-acid condition brings great growth pressure to B. subtilis 168 strain. Under the condition of pH 5, B. subtilis 168 strain still does not grow at all for the first 12 h, but after 12 h, growth occurs, and the OD 600At 0.45, it is shown that the growth pressure on B. subtilis is obvious under the condition of pH 5, but it is not lethal. With the extension of time, the B. subtilis 168 strain exhibits slow growth after further adapting to the environment. After combining the growth of the B. subtilis 168 strain under different pH conditions, the pH 5 condition is selected as the subsequent resistance test condition to screen for large fragment knockout strains that can tolerate pH 5.
[0053] Example 4: No. 5 strain with knockout of part of non-essential genes has growth advantage under acidic conditions.
[0054] This example is used to illustrate that the No. 5 strain has obvious growth advantage under the condition of pH 5 compared with the wild type B. subtilis 168 strain, and the acid tolerance is obviously improved.
[0055] (1) The wild type B. subtilis 168 strain and the constructed No. 5 knockout strain were streaked on LB plates and incubated at 37°C for 12h. Three single colonies were picked from each plate and inoculated into a shaking tube, which was incubated at 37°C, 220rpm for 10-12h. Then, it was transferred to a 20mL GMII basic medium with pH 5 at an inoculation amount of 1%, and continued to be incubated at 37°C, 220rpm for 24h. The growth was measured every 4h. 200μL was taken into a 96-well plate, and the OD 600 If the OD value is greater than 0.8, the bacterial solution needs to be diluted by an appropriate multiple, so that the OD 600 value measured by the enzyme label is between 0.2-0.8. At the same time, the blank basic medium is used as a control, and the real OD value is obtained by subtracting the actual measured OD from the blank control. The software is used for drawing.
[0056] (2) The results show that Figure 3 the No. 5 strain has significantly improved growth under the condition of pH 5 compared with the wild type B. subtilis 168 strain, and can grow normally, with an OD value of about 1.5 at 12h of growth, indicating that the acidic condition does not affect the normal physiological metabolic function of the strain.
[0057] (3) 2mL of the strain grown to the logarithmic phase was centrifuged to discard the supernatant, then frozen in liquid nitrogen, and then the sample was sent out for RNA extraction and transcriptional profiling. The transcriptional profiling result shows that Figure 4), the metabolic pathways of the two-component system of the No. 5 strain were significantly up-regulated compared with the wild-type Bacillus subtilis 168 strain, mainly including Lias, LiaR, LiaI, LiaH, LiaG, LiaF and Des related genes. The two-component system is involved in the cell signal transduction system, which is a survival mechanism for bacteria to adapt to selective pressure. Bacteria can mainly sense changes in the external environment through this system, thereby regulating the expression level of survival and virulence factors to maintain their survival.
[0058] Example 5: Urea tolerance determination of Bacillus subtilis 168 strain.
[0059] (1) In industrial production, it is usually necessary to decompose urea into NH3 for subsequent production and application of NH3. At present, urea is mainly decomposed by urease. Since Bacillus subtilis is a good exoprotein expression vector, it is often used for the secretion expression of urease. Therefore, improving the tolerance of Bacillus subtilis to urea is an effective means to improve the efficiency of urea decomposition.
[0060] (2) Similar to the pH tolerance determination, this experiment also uses GMII as the basic medium. On the basis of the basic medium, urea is added respectively to make the final concentration 20 g / L, 40 g / L and 60 g / L. The growth determination process is the same as that of Example 2 above, and only the LB medium is replaced with GMII with different urea concentrations to determine the growth curve.
[0061] (3) First, the urea tolerance of the wild-type Bacillus subtilis 168 strain was determined under the conditions of 20 g / L, 40 g / L and 60 g / L. The results showed that Figure 5 ), Bacillus subtilis 168 strain can grow normally under the conditions of 20 g / L and 40 g / L, and the growth of the strain is obviously inhibited under the condition of 60 g / L. High concentration of urea affects cell metabolism and growth. Therefore, we choose 60 g / L as the condition for subsequent tolerance screening.
[0062] Example 6: No. 5 strain with partial non-essential genes knocked out has growth advantage under 60 g / L urea.
[0063] (1) Taking the wild-type Bacillus subtilis 168 strain as a control, the growth of the No. 5 strain was determined under the condition of 60 g / L urea stress and the growth curve was drawn (the steps are the same as those of Example 5). The experimental results showed that (as shown in Figure 6The growth rate of the No. 5 strain was significantly higher than that of the wild type, and the OD reached about 1.7 at 28 h, showing good growth performance. The specific growth rate was 0.130, which was significantly higher than that of the wild type (0.065), so it had the potential to be an excellent strain for urea degradation.
[0064] (2) The No. 5 strain was grown for about 12 h under the stress of 60 g / L urea, 2 mL was centrifuged and the supernatant was discarded, then it was quickly frozen in liquid nitrogen, and then the sample RNA was extracted and the transcriptome was determined. The transcriptome results showed that Figure 7 ), the metabolic capacity of the metabolic pathway was significantly changed, mainly including amino acid metabolism (Amino acid metabolism) and carbohydrate metabolism (Carbohydrate metabolism) pathways. In addition, ABC Transporters were significantly up-regulated, promoting the transmembrane transport of substances. The main involved genes include: frlO, frlN, oppAI, frlP, frlM, pstBA, yxeM, pstA, yxeN, modB, yxeO, pstBB, tcyJ and cydc, etc.
[0065]
[0066] While the application has been disclosed in its preferred embodiments with reference to the drawings, it will be apparent to those skilled in the art that various changes in form and detail can be made therein without departing from the spirit and scope of the application as defined by the appended claims and their equivalents.
Claims
1. A highly resistant Bacillus subtilis strain, characterized in that, The strain is Bacillus subtilis (Bacillus subtilis) Bacillus subtilis )168 was the starting strain, obtained by knocking out the sequence shown in SEQ ID NO.1 on the genome.
2. The application of the highly resistant Bacillus subtilis as described in claim 1.
3. The application as described in claim 2, characterized in that, It is used in the construction of pH-tolerant or urea-tolerant chassis bacteria.
4. The application as described in claim 2, characterized in that, It is used in amino acid production, lactic acid production, urease production, and urea degradation.
Citation Information
Patent Citations
Bacillus subtilis and preparation method thereof
CN108441462A
Recombinant bacillus subtilis as well as construction method and application thereof
CN116622605A