A mutant of acetaldehyde dehydrogenase and its preparation method and application
By performing site-directed mutagenesis on the Escherichia coli acetaldehyde dehydrogenase Ec1ALDH and modifying its key amino acid sites, the catalytic efficiency and enzyme activity were improved, solving the problem that acetaldehyde dehydrogenase in the existing technology cannot meet the requirements of industrial production, and achieving efficient and clean conversion of acetaldehyde to acetic acid.
Patent Information
- Application Number
- CN202410799647.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-20
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-06-20
AI Technical Summary
Existing acetaldehyde dehydrogenase cannot meet the needs of industrial production in terms of catalytic efficiency, stability and specificity, and chemical oxidation methods have problems of environmental pollution and high cost.
By performing site-directed mutagenesis on Escherichia coli acetaldehyde dehydrogenase Ec1ALDH, especially modifying the amino acids at positions 119, 123, 268, 292 and 425, the catalytic efficiency and enzyme activity were improved, and a highly efficient acetaldehyde dehydrogenase mutant was prepared.
The conversion efficiency of acetaldehyde to acetic acid was significantly improved, the product inhibition effect was eliminated, and a clean and efficient conversion of the biocatalytic process was achieved.
Smart Images

Figure CN118620855B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of enzyme engineering and genetic engineering, and in particular to a mutant of acetaldehyde dehydrogenase, a preparation method and application thereof. Background Art
[0002] Aldehyde dehydrogenase (ALDH) is an important oxidoreductase that catalyzes the oxidation of acetaldehyde to acetic acid. ALDH plays a key role in multiple metabolic processes in organisms, such as ethanol metabolism, amino acid metabolism, and fatty acid metabolism. In recent years, ALDH has attracted widespread attention due to its potential application in industrial biosynthesis, particularly in reducing byproduct accumulation and increasing the yield of target products. Acetaldehyde accumulation not only inhibits the reaction system and reduces the yield of the target product, but also poses a potential threat to the environment and biosafety. Therefore, efficiently processing acetaldehyde byproducts and converting them into harmless or useful compounds, such as acetic acid, has become an urgent issue in industrial production.
[0003] Currently, common methods for treating acetaldehyde include chemical oxidation and biocatalysis. However, chemical oxidation requires the use of large amounts of chemical reagents, which poses environmental pollution and high treatment costs. In contrast, biocatalysis utilizes acetaldehyde dehydrogenase to oxidize acetaldehyde to acetic acid, offering significant advantages in a clean and efficient process. Despite this, natural acetaldehyde dehydrogenase often fails to meet the requirements of industrial production in terms of catalytic efficiency, stability, and specificity. Summary of the Invention
[0004] Objectives of the invention: The first objective of the present invention is to provide a mutant of acetaldehyde dehydrogenase, which addresses the problem of the catalytic efficiency of existing acetaldehyde dehydrogenase in metabolizing acetic acid, improves the activity of the enzyme, achieves rapid conversion of acetaldehyde to acetic acid, and eliminates the product inhibition effect; the second objective of the present invention is to provide a method for preparing the mutant of acetaldehyde dehydrogenase; the third objective of the present invention is to provide the use of the mutant of acetaldehyde dehydrogenase in the biocatalytic synthesis of acetic acid from acetaldehyde.
[0005] Technical solution: The mutant of acetaldehyde dehydrogenase described in the present invention is a mutant in which at least one of positions 119, 123, 268, 292, and 425 in the amino acid sequence shown in SEQ ID No. 1 is mutated; the aspartic acid Asp (gat) at the amino acid position 119 is mutated to histidine His (cat); the glycine Gly (ggc) at the amino acid position 123 is mutated to asparagine Asn (aac) or serine Ser (tct); the alanine Ala (gcg) at the amino acid position 268 is mutated to leucine Leu (ctg) or cysteine Cys (tgc); the alanine Ala (gcg) at the amino acid position 292 is mutated to tyrosine Tyr (tat); and the leucine Leu (ctg) at the amino acid position 425 is mutated to valine Val (gtt) or tyrosine Tyr (tat).
[0006] The present invention mutates the active site of the coding sequence (ID: P23883) of acetaldehyde dehydrogenase Ec1ALDH from Escherichia coli (strain K12).
[0007] Preferably, the mutant is a mutation of aspartic acid Asp (gat) at amino acid position 119 to histidine His (cat).
[0008] Preferably, the mutant is a mutation of leucine Leu (ctg) at amino acid position 425 to valine Val (gtt).
[0009] Preferably, the mutant is a mutation of leucine Leu (ctg) at amino acid position 425 to tyrosine Tyr (tat).
[0010] Preferably, the mutant is a mutation of the leucine Leu (ctg) at the 425th amino acid to the valine Val (gtt), and a mutation of the glycine Gly (ggc) at the 123rd amino acid to the asparagine Asn (aac).
[0011] Preferably, the mutant is a mutation of leucine Leu (ctg) at amino acid position 425 to valine Val (gtt), a mutation of glycine Gly (ggc) at amino acid position 123 to asparagine Asn (aac), and a mutation of aspartic acid Asp (gat) at amino acid position 119 to histidine His (cat).
[0012] Preferably, the mutant is a mutation of alanine Ala (gcg) at amino acid position 268 to leucine Leu (ctg), and the mutation of glycine Gly (ggc) at amino acid position 123 to asparagine Asn (aac), and the mutation of aspartic acid Asp (gat) at amino acid position 119 to histidine His (cat).
[0013] Preferably, the mutant is a mutation of alanine Ala (gcg) at amino acid position 292 to tyrosine Tyr (tat), and the mutation of glycine Gly (ggc) at amino acid position 123 to asparagine Asn (aac), and the mutation of aspartic acid Asp (gat) at amino acid position 119 to histidine His (cat).
[0014] Preferably, the amino acid sequence of the mutant is any one of the sequences shown in SEQ ID No. 2 to 19.
[0015] A gene encoding a mutant protein of the acetaldehyde dehydrogenase according to any one of claims 1 to 2.
[0016] The protein encoding gene of the present invention is a gene encoding the mutant protein of the acetaldehyde dehydrogenase.
[0017] Preferably, the nucleotide sequence of the gene is shown as SEQ ID No. 21 to 38.
[0018] The recombinant expression vector of the present invention contains the above-mentioned gene.
[0019] The host bacteria of the present invention contains the above-mentioned recombinant vector.
[0020] The method for preparing the mutant of acetaldehyde dehydrogenase of the present invention comprises the following steps:
[0021] (1) Designing point mutation primers, using the plasmid carrying the wild-type acetaldehyde dehydrogenase nucleotide sequence gene as a template, using the point mutation primers to perform PCR reactions, and obtaining a recombinant expression vector after purification;
[0022] (3) transferring the recombinant expression vector into a host bacterium to construct a recombinant engineered bacterium, and inducing expression;
[0023] (3) Collecting host bacteria expressing the acetaldehyde dehydrogenase mutant, resuspending the bacteria with a buffer, breaking the cells, and centrifuging to obtain the supernatant to obtain a crude enzyme solution containing the acetaldehyde dehydrogenase mutant.
[0024] Preferably, the method for culturing the recombinant engineered bacteria comprises the following steps: inoculating the seed liquid of the recombinant engineered bacteria into TB culture medium, placing it at 37°C and 400 rpm for 8 hours under shaking conditions, and when the OD600 value of the culture liquid reaches 0.8, adding IPTG and inducing expression at 18°C for 16 hours.
[0025] Preferably, the point mutation primers are:
[0026]
[0027]
[0028] Preferably, the PCR reaction system is:
[0029]
[0030] The mutant of acetaldehyde dehydrogenase described in the present invention is used in the biocatalytic synthesis of acetaldehyde from acetic acid. The catalytic process is as follows:
[0031]
[0032] Preferably, the application method is: using acetaldehyde as a substrate to catalyze the synthesis of acetic acid under the conditions of a pH range of 7 to 10 and a temperature range of 15 to 55°C.
[0033] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The present invention utilizes protein engineering technology to modify acetaldehyde dehydrogenase through site-directed mutagenesis, thereby improving its catalytic efficiency and enzyme activity; (2) The reaction system is optimized, the activity of the enzyme is increased, the rapid conversion of acetaldehyde to acetic acid is achieved, and the product inhibition effect is relieved. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 This is the result of single mutation evolution of acetaldehyde dehydrogenase Ec1ALDH;
[0035] Figure 2 This is the result of double mutation evolution of acetaldehyde dehydrogenase Ec1ALDH;
[0036] Figure 3 This is the result of the three-mutation evolution of acetaldehyde dehydrogenase Ec1ALDH;
[0037] Figure 4 This is the three-round evolution diagram of acetaldehyde dehydrogenase Ec1ALDH;
[0038] Figure 5 This is a graph showing the relationship between the absorbance of acetaldehyde dehydrogenase Ec1ALDH and time. DETAILED DESCRIPTION
[0039] The technical solution of the present invention will be further described below in conjunction with embodiments.
[0040] After extensive screening and research, the present invention provides, for the first time, an acetaldehyde dehydrogenase, its preparation method, and application. Specifically, by amplifying the acetaldehyde dehydrogenase Ec1ALDH gene from Escherichia coli (strain K12) and using semi-rational design to engineer it through directed evolution, a mutant acetaldehyde dehydrogenase with significantly improved catalytic efficiency was obtained.
[0041] The amino acid sequence of the wild-type acetaldehyde dehydrogenase is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.20.
[0042] Example 1
[0043] 1. Design, synthesis and expression vector construction of wild-type acetaldehyde dehydrogenase gene sequence
[0044] Based on the coding sequence of acetaldehyde dehydrogenase Ec1ALDH from Escherichia coli (strain K12) in the Uni Prot database (ID: P23883), Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the gene fragment and construct it on the pET22b vector, named pET22b-Ec1ALDH gene (as shown in SEQ ID NO.9), and its corresponding amino acid sequence is shown in SEQ ID NO.1.
[0045] The vector was then transformed into E. coli Top10 and screened using ampicillin-resistant LB plates to obtain clones. One clone was selected and inoculated into a 20 mL tube of ampicillin-resistant LB medium and cultured at 37°C with shaking at 220 rpm for 12 hours. After the culture, the cells were centrifuged at 12,000 rpm for 1 minute and harvested. A high-purity plasmid miniprep kit was used to extract the plasmid from E. coli Top10 / pET22b-Ec1ALDH, which served as a template for iterative mutagenesis. Mutants of the pET22b-Ec1ALDH plasmid were constructed and sequenced by Suzhou Jinweizhi Biotechnology Co., Ltd. A clone with the correct insertion and no mutations was selected to obtain the aldehyde dehydrogenase gene expression vector, named pET22b-Ec1ALDH.
[0046] 2. Expression and preparation of wild-type acetaldehyde dehydrogenase Ec1ALDH
[0047] The expression vector pET22b-Ec1ALDH obtained in Example 1 was transformed into Escherichia coli BL21 (DE3) to obtain the genetically engineered Escherichia coli pET22b-Ec1ALDH / BL21 (DE3) capable of expressing isoeugenol dioxygenase.
[0048] The engineered bacteria pET22b-Ec1ALDH / BL21 (DE3) were inoculated into the culture medium at a 1% inoculum size and cultured in a shake flask with a liquid volume of 100 mL / 250 ml (containing 100 mg / L ampicillin). When the OD600 of the bacterial liquid reached 0.6-0.8, isopropylthiogalactoside (IPTG) was added to induce the culture at a final concentration of 1 mM. The culture was cooled to 18°C and cultured for about 20 hours. The cells were centrifuged at 4000 rpm for 10 minutes, and the cells were collected and resuspended in 100 mM Tris-HCl buffer at pH 9 to obtain cells containing acetaldehyde dehydrogenase Ec1ALDH for subsequent catalytic studies and enzyme activity determination.
[0049] 3. Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant
[0050] The gene mutation was performed by whole-plasmid PCR with the wild-type acetaldehyde dehydrogenase Ec1ALDH as a template to obtain the target mutant gene, wherein the aspartic acid Asp (gat) at the 119th amino acid was mutated to histidine His (cat); the glycine Gly (ggc) at the 123rd amino acid was mutated to asparagine Asn (aac) or serine Ser (tct); the alanine Ala (gcg) at the 268th amino acid was mutated to leucine Leu (ctg) or cysteine Cys (tgc); the alanine Ala (gcg) at the 292th amino acid was mutated to tyrosine Tyr (tat); and the leucine Leu (ctg) at the 425th amino acid was mutated to valine Val (gtt) or tyrosine Tyr (tat); the amino acid sequences of the mutants are shown in SEQ ID Nos. 2 to 9, and the gene sequences are shown in SEQ ID Nos. 21 to 28, respectively.
[0051] The method for constructing D119H, G123N, G123S, A268L, A268C, A292Y, L425V, and L425Y mutants is as follows:
[0052] The target mutant gene was obtained by whole plasmid PCR. The primers are shown in Table 1 below.
[0053] Table 1
[0054]
[0055]
[0056] Note: The underlined markers in the primers indicate the mutation sites, "F" represents the upstream primer, and "R" represents the downstream primer. The PCR system is shown in Table 2.
[0057] Table 2 PCR reaction system
[0058]
[0059] PCR reaction conditions are shown in Table 3.
[0060] Table 3 PCR reaction conditions
[0061]
[0062] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.
[0063] After PCR, pipette 10 μL of the gene fragment, mix it, and add 1 μL of DpnI to digest and remove the template. Recombinase is then used to reconstitute the fragment. Transform the recombinant product into E. coli DH5α competent cells, spread it onto the surface of LB solid medium supplemented with 100 μg / mL ampicillin, and incubate at 37°C for 12 hours. Pick a single colony and transfer it to LB liquid culture. Verify the correctness of the mutation site by sequencing. Once verified, add sterile glycerol to a final concentration of 25% to a portion of the cells, number them, and store them at -80°C until needed. Use a plasmid extraction kit to extract the plasmid from a portion of the cells, and store the recombinant plasmids at -20°C.
[0064] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-Ec1ALDH. After overnight culture, single colonies were picked into a 96-well plate containing sterile LB medium (ampicillin: 100 μg / mL) using a sterile pipette tip. The wild type was used as a control and cultured overnight at 37°C for 16 h. Sterile glycerol was added to a final concentration of 25%, pipetted evenly, and stored at -80°C until use.
[0065] Example 2
[0066] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / A268L:
[0067] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the specific design of D119H / A268L are shown in Table 4 below. The mutant D119H constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0068] Table 4
[0069]
[0070] The amino acid sequence of D119H / A268L is shown in SEQ ID NO.10, and the nucleotide sequence is shown in SEQ ID NO.29.
[0071] Example 3
[0072] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant G123N / A268C:
[0073] The target mutant gene was obtained by whole-plasmid PCR. The specific primers required for the design of G123N / A268C are shown in Table 5 below. The mutant G123N constructed in Example 1 was used as a template, and the remaining operations were consistent with Example 1.
[0074] Table 5
[0075]
[0076] The amino acid sequence of G123N / A268C is shown in SEQ ID NO.11, and the nucleotide sequence is shown in SEQ ID NO.30.
[0077] Example 4
[0078] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant A268L / A292Y:
[0079] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the specific design of A268L / A292Y are shown in Table 6 below. The mutant A268L constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0080] Table 6
[0081]
[0082] The amino acid sequence of A268L / A292Y is shown in SEQ ID NO.12, and the nucleotide sequence is shown in SEQ ID NO.31.
[0083] Example 5
[0084] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant G123S / A268C:
[0085] The target mutant gene was obtained by whole-plasmid PCR. The specific primers required for the design of G123S / A268C are shown in Table 7 below. The mutant A268C constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0086] Table 7
[0087]
[0088] The amino acid sequence of G123S / A268C is shown in SEQ ID NO.13, and the nucleotide sequence is shown in SEQ ID NO.32.
[0089] Example 6
[0090] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant A268C / A292Y:
[0091] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the specific design of A268C / A292Y are shown in Table 8 below. The mutant A268C constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0092] Table 8
[0093]
[0094] The amino acid sequence of A268C / A292Y is shown in SEQ ID NO.14, and the nucleotide sequence is shown in SEQ ID NO.33.
[0095] Example 7
[0096] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / A268C:
[0097] The target mutant gene was obtained by whole plasmid PCR. The primers required for the specific design of D119H / A268C are shown in Table 9 below. The mutant A268C constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0098] Table 9
[0099]
[0100] The amino acid sequence of D119H / A268C is shown in SEQ ID NO.15, and the nucleotide sequence is shown in SEQ ID NO.34.
[0101] Example 8
[0102] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / G123N:
[0103] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the specific design of D119H / G123N are shown in Table 10 below. The mutant G123N constructed in Example 1 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0104] Table 10
[0105]
[0106] The amino acid sequence of D119H / G123N is shown in SEQ ID NO.16, and the nucleotide sequence is shown in SEQ ID NO.35.
[0107] Example 9
[0108] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / G123N / L475V:
[0109] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the design of D119H / G123N / L475V are shown in Table 11. The mutant constructed in Example 8 was used as a template. The remaining operations were consistent with those in Example 1.
[0110] Table 11
[0111]
[0112] The amino acid sequence of D119H / G123N / L475V is shown in SEQ ID NO.17, and the nucleotide sequence is shown in SEQ ID NO.36.
[0113] Example 10
[0114] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / G123N / A268L:
[0115] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the specific design of D119H / G123N / A268L are shown in Table 12 below. The mutant constructed in Example 8 was used as a template, and the rest of the operations were consistent with those in Example 1.
[0116] Table 12
[0117]
[0118] The amino acid sequence of D119H / G123N / A268L is shown in SEQ ID NO.18, and the nucleotide sequence is shown in SEQ ID NO.37.
[0119] Example 11
[0120] Construction of recombinant E. coli BL21(DE3) / pET22b-Ec1ALDH mutant D119H / G123N / A292Y:
[0121] The target mutant gene was obtained by whole-plasmid PCR. The primers required for the design of D119H / G123N / A292Y are shown in Table 13. The mutant constructed in Example 8 was used as a template. The remaining operations were consistent with those in Example 1.
[0122] Table 13
[0123]
[0124] The amino acid sequence of D119H / G123N / A292Y is shown in SEQ ID NO.19, and the nucleotide sequence is shown in SEQ ID NO.38.
[0125] Performance Testing
[0126] Activity verification of acetaldehyde dehydrogenase Ec1ALDH mutant:
[0127] The bacteria and mutants constructed in Examples 1 to 5 were inoculated with 1% of the inoculum into 2 mL of LB medium containing resistance and grown at OD 600 When the concentration reaches about 0.6, IPTG is added to a final concentration of 0.5 mM and induced at 18°C for about 20 hours. After induction, the deep-well plate is centrifuged and resuspended in an appropriate buffer to obtain cells containing the aldehyde dehydrogenase Ec1ALDH mutant.
[0128] The reaction system is as follows: dilute the bacterial solution 50 times in a 96-well plate and add it to the ELISA plate. Add 40mM acetaldehyde and 20mM NAD into each well of the ELISA plate. + , immediately detect with a microplate reader, record the change of absorbance at 340nm from 0 to 4min, and record once every minute.
[0129] The enzyme activity was calculated based on the changes in sample absorbance detected, and the best mutant was D119H / G123N / L475V. The strains were screened for several rounds. Figures 1 to 4 .
[0130] Depend on Figure 1 The results showed that the relative activities of several aldehyde dehydrogenase single mutants were all higher than those of the wild-type enzyme. Among them, the relative activity of the A292Y mutant was 90% higher than that of the wild-type, the relative activity of the L425V mutant was 3-fold higher than that of the wild-type, the relative activity of the L425Y mutant was 2-fold higher than that of the wild-type, the relative activity of the D119H mutant was 30% higher than that of the wild-type, the relative activity of the G123N mutant was 1.7-fold higher than that of the wild-type, the relative activity of the G123S mutant was 1.6-fold higher than that of the wild-type, the relative activity of the A268C mutant was 1.8-fold higher than that of the wild-type, and the relative activity of the A268L mutant was 2-fold higher than that of the wild-type.
[0131] Depend on Figure 2 The results showed that the relative activities of several aldehyde dehydrogenase double mutants were all higher than those of the wild-type enzyme. Among them, the relative activity of the D119H / A268L mutant was 30% higher than that of the wild-type, the relative activity of the G123N / A268C mutant was 3-fold higher than that of the wild-type, the relative activity of the A268L / A292Y mutant was 2-fold higher than that of the wild-type, the relative activity of the G123S / A268C mutant was 2.5-fold higher than that of the wild-type, the relative activity of the A268C / A292Y mutant was 3-fold higher than that of the wild-type, and the relative activity of the D119H / A268C mutant was 1.2-fold higher than that of the wild-type.
[0132] Depend on Figure 3 The results showed that the relative activities of several triple mutants of aldehyde dehydrogenase were all higher than those of the wild-type enzyme. Among them, the relative activity of the D119H / G123N / L475V mutant was 5-fold higher than that of the wild-type, the relative activity of the D119H / G123N / A268L mutant was 4-fold higher than that of the wild-type, and the relative activity of the D119H / G123N / A292Y mutant was 4-fold higher than that of the wild-type.
[0133] Depend on Figure 4 It was found that after three rounds of evolution, the relative activity of the D119H / G123N / L475V mutant was significantly improved, which was 5 times the catalytic activity of the wild type.
[0134] Depend on Figure 5 Available, add acetaldehyde and NAD + After that, the absorbance of the reaction solution showed a linear relationship with time, and the linearity was good, from which the increase in relative enzyme activity could be calculated.
Claims
1. A mutant of acetaldehyde dehydrogenase, characterized in that The mutant is mutated based on the amino acid sequence shown in SEQ ID No. 1, and the mutant is selected from G123N, G123S, G123N / A268C, G123S / A268C, D119H / G123N / L425V, D119H / G123N / A268L or D119H / G123N / A292Y.
2. A gene encoding the mutant protein of acetaldehyde dehydrogenase according to claim 1.
3. The gene encoding the mutant protein of acetaldehyde dehydrogenase according to claim 2, characterized in that The nucleotide sequence of the gene is any one of the sequences shown in SEQ ID No.22, SEQ ID No.23, SEQ ID No.30, SEQ ID No.32, and SEQ ID Nos.36 to 38.
4. A recombinant expression vector containing the gene according to claim 3.
5. A host bacterium containing the recombinant vector according to claim 4.
6. The method for preparing a mutant of acetaldehyde dehydrogenase according to claim 1, characterized in that: The steps include: (1) Designing point mutation primers, using the plasmid carrying the wild-type aldehyde dehydrogenase nucleotide sequence gene SEQ ID NO. 20 as a template, using the point mutation primers to perform PCR reactions, and obtaining the recombinant expression vector after purification; (2) Transforming the recombinant expression vector into a host bacterium to construct a recombinant engineered bacterium and inducing expression; (3) Collect the host bacteria expressing the acetaldehyde dehydrogenase mutant, resuspend the bacteria in buffer, break the cells, and centrifuge to obtain the supernatant to obtain the crude enzyme solution containing the acetaldehyde dehydrogenase mutant.
7. The method for preparing a mutant of acetaldehyde dehydrogenase according to claim 6, characterized in that: The point mutation primers are: G123N_F GGCGCCGCGCCGGAATATCAT G GCGCAGGCTATG; G123N_R CCGCATACCAGCGAATCGCGCGCGCGGC AGA CGG; G123S_F CATAGCCTGCGCGATGATATTCCG TCT GCCGCGC; G123S_R CCGCATACCAGCGAATCGCGCGCGCGGC AGA CGG; A268C_F GAAACGCGTGTGGCTGGAA TGC GGCGGCAAAAG; A268C_R GTTCGCGCTTTTGCCGCC GCA TTCCAGC; D119H_F CATAGCCTGCGC C ATGATATTCCGGGCGCCGCGC; D119H_R GGCGCCGCGCCGGAATATCAT G GCGCAGGCTATG; A268L_F CATGAAACGCGTGTGGCTGGAA CT GGGC; A268L_R GTTCGCGCTTTTGCCGCCC AG TTCCAGC; A292Y_F AAGCGGCGAGCGCGACCGCG TAT GGCAT; A292Y_R CCGCG ATA GGCATTTTTTATAACCAAGGCCAAG; L425V_F GTCAGTATGGC G T T GGCGCGGCGGTGTGG; L425V_R CCACACCGCCGCGCC A A C GCCATACTGAC。 8. The method for preparing a mutant of acetaldehyde dehydrogenase according to claim 6, characterized in that: The PCR reaction system was as follows: 10× Buffer for KOD-Plus-2.5 μL, 10× Buffer for KOD-Plus-2.5 μL, 25 mM MgSO4 1.5 μL, DMSO 1 μL, 10 pmol / μL Forward Primer 0.75 μL, 10 pmol / μL Reverse Primer 0.75 μL, DNA template <100 ng, KOD-Plus-1 μL, and ddH2O up to 25 μL.
Citation Information
Patent Citations
Enzyme with function of catalyzing glycollic aldehyde to synthesize glycollic acid and application of enzyme
CN114540318A
Acetaldehyde dehydrogenase with improved thermal stability as well as gene and application of acetaldehyde dehydrogenase
CN117384871A