Application of a single base / amino acid mutation of bovine DDX58 gene in anti-tuberculosis

Abstract

The invention discloses an application of a single base / amino acid mutation of a bovine DDX58 gene in anti-tuberculosis, belongs to the technical field of bovine tuberculosis prevention and treatment, an application of a single base mutation of a bovine DDX58 gene in anti-tuberculosis, the CDS sequence of the bovine DDX58 gene is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, and the single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the ARS-UCD1.2 version reference sequence of the bovine genome. The single base mutation of the bovine DDX58 gene provided by the present invention has a significant effect on the production amount of type I interferon and the clearance effect of macrophages on Mycobacterium tuberculosis, and is highly linked to the anti-tuberculosis trait of the bovine; the single base / amino acid mutation of the bovine DDX58 gene provided can be used as a bovine tuberculosis resistance linkage site, used for genotype selection in bovine tuberculosis resistance breeding, thereby simplifying the selection method and shortening the selection time.

Description

Technical Field

[0001] The invention relates to the technical field of bovine tuberculosis prevention and treatment, in particular to an application of a single base / amino acid mutation of a bovine DDX58 gene in anti-tuberculosis. Background Art

[0002] Bovine tuberculosis (BTB) is a chronic, consumptive zoonosis caused primarily by Mycobacterium bovis (M. bovis). In addition to cattle, many other domestic and wild animals as well as humans can be infected with M. bovis. The prevalence of bovine tuberculosis has not only caused serious economic losses to my country's animal husbandry, but also seriously threatened human public health. Discovering anti-tuberculosis gene editing sites in cattle and breeding gene-edited anti-tuberculosis cattle are becoming the main research directions for the prevention and control of bovine anti-tuberculosis in the future.

[0003] After invading the body, Mycobacterium tuberculosis is phagocytosed by macrophages and releases its own mRNA into the cytoplasm through its own ESX1 secretion system, which is recognized by the DDX58 receptor. After DDX58 recognizes the cytoplasmic pathogen RNA, it can activate the downstream signaling cascade reaction, leading to the production of type I interferon (IFNB1) and proinflammatory cytokines. Summary of the invention

[0004] The purpose of the present invention is to provide an application of a single base / amino acid mutation of the bovine DDX58 gene in anti-tuberculosis, so as to provide a single base and amino acid site closely related to bovine anti-tuberculosis, and contribute to the effective prevention and control of bovine tuberculosis and the breeding of anti-tuberculosis cattle.

[0005] To achieve the above object, the present invention provides an application of a single base mutation of a bovine DDX58 gene in anti-tuberculosis, wherein the CDS sequence of the bovine DDX58 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2, and the single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the bovine genome ARS-UCD1.2 version reference sequence.

[0006] Preferably, the single base mutation is a missense mutation, from G to A.

[0007] Preferably, the single base mutation results in a mutation in the 858th amino acid of the bovine DDX58 protein.

[0008] Preferably, the single base mutation causes a mutation in amino acid position 858 of the bovine DDX58 protein from serine to asparagine.

[0009] Preferably, the application is to influence the production of downstream type I interferon and promote the clearance of Mycobacterium tuberculosis by macrophages.

[0010] The invention discloses an application of a single amino acid change of a bovine DDX58 gene in anti-tuberculosis treatment, wherein the single amino acid change is a mutation of the 858th amino acid of the bovine DDX58 protein from serine to asparagine.

[0011] The application of single base mutation and single amino acid mutation in the preparation of anti-tuberculosis preparations as mentioned above.

[0012] As mentioned above, single base mutation and single amino acid mutation are used in the breeding of tuberculosis-resistant cattle varieties.

[0013] The use of single base mutations and single amino acid mutations as described above in the preparation of preparations that promote the clearance of Mycobacterium tuberculosis by macrophages.

[0014] A vector and a host bacterium comprising the above-mentioned single base mutation or single amino acid mutation.

[0015] The present invention provides a single nucleotide missense mutation of the bovine DDX58 gene that is highly correlated with the ability to resist bovine tuberculosis. This site corresponds to the 11603839th nucleotide from the 5′ end on chromosome 8 of the reference sequence of the bovine genome ARS-UCD1.2 version, which is G for ordinary cattle and A for zebu cattle. This mutation is a missense mutation, and the corresponding encoded amino acid is located at the 858th position of the DDX58 protein; serine for ordinary cattle and asparagine for zebu cattle. The single base mutation of the bovine DDX58 gene provided by the present invention can affect the activity of the DDX58 protein through phosphorylation regulation, thereby affecting the activation of the downstream innate immune pathway of DDX58, causing differences in the expression of type I interferon, and thus affecting the anti-tuberculosis ability of the cattle.

[0016] Therefore, the application of a single base / amino acid mutation of the bovine DDX58 gene provided by the present invention in anti-tuberculosis has the following specific technical effects:

[0017] (1) The single base mutation of the bovine DDX58 gene provided by the present invention has a significant effect on the production of type I interferon and the clearance effect of macrophages on Mycobacterium tuberculosis, and is highly linked to the anti-tuberculosis trait of cattle;

[0018] (2) The single / base / amino acid mutation of the bovine DDX58 gene provided by the present invention can be used as a bovine tuberculosis resistance linkage site for genotype selection in bovine tuberculosis resistance breeding, thereby simplifying the breeding method and shortening the breeding time.

[0019] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0021] Figure 1 is the mutation information of the missense mutation protected by the present invention in the Bovine Genome Variation Database (BGVD);

[0022] Figure 2 This is the analysis chart of the differentiation index among all SNP sites of the DDX58 gene of common cattle and zebu cattle;

[0023] Figure 3 This is the peak graph of the 2572nd base mutation of the bovine DDX58 gene in Example 3 of the present invention. As can be seen from the position marked by the red box in the figure, the codon AGT is successfully mutated to AAT, and the corresponding amino acid is mutated from S to N;

[0024] Figure 4 The ELISA results in Example 5 of the present invention, wherein A is the result of transfection of RAW264.7 cells, and B is the result of transfection of EBL cell line;

[0025] Figure 5 This is the CFU test result in Example 6 of the present invention. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0027] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0028] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0029] Embodiment 1

[0030] At present, the mining of anti-tuberculosis functional genes in dairy cows in my country is very limited. It is known that the anti-tuberculosis ability of zebu cattle is significantly stronger than that of ordinary cattle. The present invention mines and discovers a potential key missense mutation in the bovine DDX58 gene (the gene sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2) with a high correlation with the ability to resist bovine tuberculosis in the bovine genome variation database (BGVD) (the mutation information obtained in the database is shown in Figure 1 ), this mutation corresponds to the 11603839th nucleotide from the 5′ end of chromosome 8 of the ARS-UCD1.2 reference sequence of the cattle genome, which is G in common cattle and A in zebu cattle. This mutation is a missense mutation, and the corresponding encoded amino acid is located at position 858 of the DDX58 protein: serine in common cattle and asparagine in zebu cattle. The allele frequencies of all SNP sites of the DDX58 gene of common cattle and zebu cattle were obtained in BGVD, and the differentiation index between populations was calculated (such as Figure 2 ), the colored dots in the figure are SNP sites of missense mutations. It can be seen that S858N is the only highly selected missense mutation of the DDX58 gene in common cattle and zebu populations.

[0031] SEQ ID NO.1

[0032]

[0033] SEQ ID NO.2

[0034] MTAEQRRNLHAFRDYVRKILDPTYILSYMTPWFRDDVVQHIQAKKNNKGPMEAASLFLQVLLELQEEGWFRGFLDALQQAGYSGLYEAIESWDFQKLEKLEEYRLLLKRLQPEFKTTINPEDILPEISGCLLNQECEEIIQISSNKGLMAGAEKMVECLLRSDKENWPKTLKLALEKEESKFSELWMVEKGAENVQMKDLEDDEMKTLDVHIVYKEEPESQNLSQNSCSSEVPPTYSPLKPRNYQLELALPAQKGKNTIICAPTGCGKTFVSLLICEHHLKKFPQGRKGKVVVFAVQVPLYEQQKSVFSEYFERFGYKVSGISGETADNISVEQIVENNDIIILTPQILVNSLKDGTIPSLSIFTLMIFDECHNTNKHHPYNMIMFHYLDQKLGGSSDSLPQVIGLTASVGVGDAKNTAEATEYICKLCASLDTAVVTTVRDNLEELEEVVYKPQKFFRKVESRTTDRFKRIISQLMAETEALAKSIFEELGTVTLENLSRIQNRNFGTQKYEQWIIAVQKACMVFQMPDKEEESRICKALFLYTSHLRKYNDALIINEDARMKDALNYLKNFFKNVRAAGFDAIEQDLTQRFEEKLLELEGISMDPSNENAKLKDLCFILQEEYHLNPETRTILFVKTRALVDALKNWIEENPKLSFLKPGILTGRGRTNQTMGMTLPAQKCALDAFRTNRDSKILIATSVADEGIDIAQCNLVILYEYVGNVIKMIQTRGRGRARGSKCFLLTSNADVIEKEKLNICQEKMMNESISRLQGWNEAVFKEKIRQIQIQEKLIRDSQGKVKPVVDKKNKKLLCGKCKTFACYTADIRVVEECHFTVVRDAFRECFVTKLHPRPKKFGSFDKKAKIFCARKDCLHDWGIHMKYKTFEIPVIKIESFVVEDVATGAQTLYAKWKDFNFEKIPFDAAEMSPWAQDLNLQGVDGLE

[0035] Example 2

[0036] Construct the bovine bDDX58-WT vector as follows:

[0037] S1.1. Extraction of RNA from bovine lung tissue

[0038] (1) Place fresh fetal bovine lung tissue in a thermos bottle containing saline solution, send it to the laboratory within 4 hours, disinfect it with 75% alcohol for 3-5 seconds, and wash it three times with 37°C saline solution;

[0039] (2) Place in a clean bench that has been sterilized with ultraviolet light in advance, take part of the fetal bovine lung tissue and place it in a 1.5 mL EP tube, transfer it into a sterilized mortar filled with liquid nitrogen (clean the mortar, dry it, pour in anhydrous ethanol and ignite it for sterilization, seal it with sterile aluminum foil immediately after the fire is extinguished, and start the experiment after cooling to room temperature), mix the tissue and liquid nitrogen and grind it into powder, transfer it into a 1.5 mL EP tube, add 1 mL Trizol, shake and mix well, and let it stand at room temperature for 5 min;

[0040] (3) Add 200 μL of chloroform / tube, shake vigorously for 15 seconds, observe that it is fully emulsified, and let it stand on ice for 5 minutes;

[0041] (4) Centrifuge at 4°C, 12,000 rpm / min for 15 min, and transfer 400 μL of the upper aqueous phase into a new RNase-free 1.5 mL EP tube;

[0042] (5) Add 400 μL of 4°C precooled isopropanol / tube, invert 10 times, and place on ice for 10 min;

[0043] (6) Centrifuge at 4°C, 12,000 rpm / min for 10 min and discard the supernatant;

[0044] (7) Add 1 mL of 4°C precooled RNase-free 75% ethanol to each tube and gently pipette for 1 min.

[0045] (8) Centrifuge at 4°C, 7500 rpm / min for 5 min, discard the alcohol, and dry the RNA precipitate at room temperature;

[0046] (9) Add 20 μL of DEPC H2O to dissolve the RNA precipitate;

[0047] (10) Use a spectrophotometer to detect RNA concentration, and use electrophoresis to detect whether RNA is degraded; if 260 / 280 is between 1.8 and 2.0, it indicates no degradation.

[0048] S1.2. Reverse transcribe the RNA obtained in step S1.1 into cDNA

[0049] (1) Using the system shown in Table 1, maintain at 42°C for 2 min to remove genomic DNA from RNA.

[0050] Table 1

[0051] Reagents volume <![CDATA[RNase-Free H2O]]> To 16μL RNA 1 μg 4×gDNA wiper Mix 4μL

[0052] (2) Use a reverse transcription kit according to the attached instructions to reverse transcribe the RNA from which the genomic DNA has been removed into cDNA.

[0053] S1.3, using the obtained cDNA as a template for PCR amplification

[0054] The amplification template is the cDNA of bovine lung tissue obtained in step S1.2, the upstream primer is pCMV-HA-bDDX58-WT-F (sequence as shown in SEQ ID NO.3), and the downstream primer is pCMV-HA-bDDX58-WT-R (sequence as shown in SEQ ID NO.4).

[0055] SEQ ID NO.3: GTCGACCATGACGGCAGAGCAGC

[0056] SEQ ID NO.4: GGTACCTCATTCAAGGCCATCC

[0057] The reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0058] Table 2

[0059] Reagents Volume (unit: μL) cDNA 5μL pCMV-HA-bDDX58-WT-F (10 nM / μL) 1μL pCMV-HA-bDDX58-WT-R (10 nM / μL) 1μL dNTP Mixture 4μL <![CDATA[5X PrimeSTAR Buffer(Mg 2+ Plus)]]> 10μL PrimeSTAR HS DNA Polymerase(2.5U / μL) 0.5μL <![CDATA[ddH2O]]> to50μL

[0060] Table 3

[0061]

[0062] S1.4. Recover and identify the amplified product obtained in step S1.3

[0063] (1) Use the PCR amplification product gel recovery kit to perform gel excision and recovery. Under UV irradiation of the gel imaging system, cut the target band gel within 40 seconds and transfer it into a 2 mL EP tube according to the instructions attached to the kit;

[0064] (2) Detect the concentration of the recovered product and use the enzyme digestion reaction system shown in Table 4 to perform double digestion of the pCMV-HA empty vector with SalⅠ and KpnI.

[0065] Enzyme digestion reaction procedure: incubate at 37°C for 1 hour in a PCR instrument, then perform agarose electrophoresis, use a kit to cut and recover the band of 2841 bp, and detect the DNA concentration with a spectrophotometer after gel recovery.

[0066] Table 4

[0067] Reaction system Dosage pCMV-HA empty plasmid 2μg Sal1 1μL Kpn1 1μL 10× Enzyme Digestion Buffer 5μL <![CDATA[ddH2O]]> Make up to 50 μL

[0068] S1.5. Use a ligation kit to connect the target fragment obtained in step S1.4 to construct the pCMV-HA-bDDX58-WT vector. The ligation system is shown in Table 5. After ligation at 4°C overnight, transform into Escherichia coli, select monoclonal colonies after ampicillin screening, extract the plasmid and send it to the company for sequencing. After sequencing is correct, it will be retained.

[0069] Table 5

[0070] Reaction system Volume (μL) Carrier 0.6 μg Insert 1.8 μg 2×Universal Ligation Mix 5μl <![CDATA[ddH2O]]> to10μl

[0071] Embodiment 3

[0072] The mutant pCMV-HA-bDDX58-S858N vector of the bovine DDX58 gene 858 site was constructed as follows:

[0073] S2.1. Primer design

[0074] According to the CDS sequence of bovine DDX58 protein reported by NCBI and the steps of overlap extension PCR, a total of four primers are required. First, primers at both ends of the full-length CDS region of bovine DDX58 are required, which are pCMV-HA-bDDX58-WT-F (sequence as shown in SEQ ID NO.3) and pCMV-HA-bDDX58-WT-R (sequence as shown in SEQ ID NO.4). Then, two complementary primers are designed according to the location of the mutation site, and the mutation site is ensured to be between the two primers. The two primers are named pCM V-HA-bDDX58-S858N-F (sequence as shown in SEQ ID NO.5) and pCMV-HA-bDDX58-S858N-R (sequence as shown in SEQ ID NO.6).

[0075] SEQ ID NO.5: GACCGAAGAAGTTTGGGAATTTTGACAAGAAAGCTAA

[0076] SEQ ID NO.6: TTAGCTTCTTGTCAAAATTCCCAAACTTCTTCGGTC

[0077] S2.2. Extraction of plasmid and site mutation using overlap extension PCR

[0078] The pCMV-HA-bDDX58-WT vector constructed in step S1.5 of Example 2 was used as a template for PCR to amplify the bDDX58-S858N gene fragments P1 and P2. The amplification system and reaction conditions were the same as those in step S1.3.

[0079] The bDDX58-S858N gene fragment p1 was amplified by primers pCMV-HA-bDDX58-WT-F (sequence as shown in SEQ ID NO.3) and pCMV-HA-bDDX58-S858N-R (sequence as shown in SEQ ID NO.4), and the fragment p2 was amplified by primers pCMV-HA-bDDX58-S858N-F (sequence as shown in SEQ ID NO.5) and pCMV-HA-bDDX58-WT-R (sequence as shown in SEQ ID NO.6). After amplification, agarose gel electrophoresis was performed, and the p1 and p2 fragments with fragment lengths of 2598 bp and 281 bp were gel-recovered using a kit. Both p1 and p2 fragments contain mutation sites. Then, the upstream primer pCMV-HA-bDDX58-WT-F (sequence as shown in SEQ ID NO.3) and the downstream primer pCMV-HA-bDDX58-WT-R (sequence as shown in SEQ ID NO.4) were used as PCR primers, and the p1 and p2 fragments were used as templates to amplify the bDDX58-S858N fragment. During amplification, 60 ng of fragment P1 and 20 ng of fragment P2 were added, and the rest of the amplification system and reaction conditions were the same as step S1.3 of Example 2. After amplification, agarose gel electrophoresis was performed, and the bDDX58-S858N fragment with a length of 2841 bp was gel-recovered using a kit, and base A was added to the end.

[0080] S2.3. pMD-19T cloning of target gene

[0081] The purified PCR product with base A added to the end obtained in step S2.2 was connected to the T vector, and the connection system is shown in Table 6. Then it was transformed into Escherichia coli, and a single clone was selected by ampicillin screening and expanded in LB culture medium supplemented with ampicillin.

[0082] Table 6

[0083] Reaction system Volume (μL) TVector pMD 19 (Simple) 0.5μL DNA Ligation Kit 5μL <![CDATA[bDDX58-S858N Snippet ]]> 4.5μL

[0084] S2.4. Sequencing and comparison analysis of mutation sites

[0085] Take the fresh bacterial solution expanded for 7 hours in step S2.3, centrifuge it at 1000g for 5 minutes, discard the supernatant, and extract the plasmid according to the instructions of SanPrep column plasmid DNA small-scale extraction kit. The detection concentration is ≥100ng / μL, and send it to the company for sequencing. The sequencing results are analyzed by SnapGene for sequencing peaks and sequence alignment. The peaks at the mutation sites are as follows: Figure 3 As shown in the figure, the base G was successfully mutated to A, indicating that the recombinant plasmid was successfully constructed.

[0086] S2.5. Construction of eukaryotic expression vector of bovine DDX58 mutant with HA tag

[0087] At the same time, the target fragment and expression vector pCMV-HA were digested with SalⅠ and KpnI, and the digestion system and reaction conditions were the same as those in step S1.4 of Example 2. After agarose gel electrophoresis, the target fragment was recovered by cutting the gel and connected. The connection system was the same as step S1.5 of Example 2, and it was placed in a 4°C refrigerator for 16h. The ligation product was transformed into DH5α Escherichia coli, and after plating, picking single clones and shaking the bacteria, the plasmid was extracted and sent to the company for sequencing. The sequencing results were correct, and the culture was expanded and the endotoxin-free plasmid was extracted and stored at -20°C.

[0088] Embodiment 4

[0089] Culture M. tuberculosis and infect cells as follows:

[0090] S3.1 Cell culture and transfection

[0091] The cell models are mouse macrophages RAW264.7 and bovine lung epithelial cells EBL. First, the cells are revived, and the cells are quickly taken out of the liquid nitrogen tank and dissolved in a 37°C water bath. An equal volume of fresh culture medium is added and then centrifuged. The supernatant is discarded and fresh culture medium containing 10% serum is added to resuspend the cells and then plated into a cell culture dish. The cell culture conditions are 37°C and 5% CO2. The cells are plated into a 12-well plate one day before plasmid transfection, and transfection is performed when the cell confluence reaches 70%. Lipofectamine 3000 is used for transfection, and the transfection system is shown in Table 7. The transfection plasmids are the pCMV-HA-bDDX58 vector and pCMV-HA-bDDX58-S858N vector constructed above.

[0092] Table 7

[0093] Transfection system Volume (μL / well) Plasmids 1 μg Lipofectamine 3000 1.5μL <![CDATA[Opti-MEM TM Medium]]> 100μL

[0094] The system described in Table 7 was incubated at room temperature for 15 minutes, then added to the cell wells, and infected with Mycobacterium tuberculosis 24 hours after transfection.

[0095] S3.2. Mycobacterium tuberculosis culture and cell infection

[0096] The Mycobacterium tuberculosis strains H37Rv and M. bovis were from the research group of Guo Aizhen at Huazhong Agricultural University. The whole process of this bacterial attack experiment was carried out in the animal biosafety level 3 laboratory of Huazhong Agricultural University.

[0097] H37Rv and M.bovis were cultured in 7H11 medium at 37°C and 5% CO2. After the logarithmic period, they were infected at an MOI of 10 (cell number: bacterial number = 1:10). Before infection, the cells were counted. In a 12-well plate, the number of RAW264.7 cells was approximately 4×10 5 EBL cells / well, about 1×10 6 pcs / hole. Then H37Rv needs 4×10 6 pcs / well, M.bovis requires 1×10 7 Take 100 μL of H37Rv bacterial solution and measure OD in UV spectrophotometer. 600 The absorbance value is 0.5, and the concentration of Mycobacterium tuberculosis obtained from previous experiments - OD 600 The concentration of the bacterial solution was calculated from the absorbance standard curve to be 8×10 7 / mL, then 50μL H37Rv bacterial solution needs to be added to each well of RAW264.7 cells. The calculation method of M.bovis is the same as above. After calculation, 100μL M.bovis bacterial solution needs to be added to each well of EBL cells. Add the required bacterial solution into the cell wells according to the calculation, incubate at 37℃ for 4h, then wash with PBS 3 times to remove the bacteria that have not been successfully infected, add DMEM cell culture medium containing 50μg / mL gentamicin and continue to culture the cells for 24h and 36h before collecting samples.

[0098] Embodiment 5

[0099] The concentration of IFNB1 secreted by RAW264.7 and EBL cells after infection with H37Rv bacteria in Example 4 was detected by ELISA experiment

[0100] After Mycobacterium tuberculosis infects cells, it can release mRNA into the cytoplasm of macrophages through the ESX-1 secretion system, which is then recognized by DDX58 and undergoes conformational changes, activating the DDX58 / MAVS / TBK1 / IRF7 signaling pathway downstream of macrophages and inducing the production of type I interferon (IFNB1). Studies have shown that in the absence of IFNγ signal transduction, IFNB1 can regulate macrophage activation and cytokine expression, and has a positive effect on macrophage clearance of Mycobacterium tuberculosis.

[0101] The specific steps are as follows:

[0102] S4.1. Sample collection and testing

[0103] The cell transfection and Mycobacterium tuberculosis infection steps were the same as above. After 36 hours of Mycobacterium tuberculosis infection, the cell supernatant was collected and tested after being filtered through 0.22 μm. The supernatant was stored at -80°C during this period.

[0104] The supernatant of RAW264.7 cells was detected with Mouse IFN-β ELISA Kit, and the supernatant of EBL cells was detected with bovine interferon-β (IFN-β) ELISA kit. The detection steps are as follows:

[0105] (1) Preparation of cell culture supernatant standard curve

[0106] Take 230 μL of the IFN-β standard in the kit and add 230 μL of cell culture medium as the highest concentration of the standard curve (1,000 pg / mL), then dilute to the desired concentration. Add 230 μL of cell culture medium to each test tube. Make a 1:1 serial dilution of the standard. The final dilution is a concentration gradient of 500, 250, 125, 62.5, 31.25, 15.6, and 7.8 pg / mL, and they are named Standards 1-7. Make sure to mix thoroughly each time you pipette. Use cell culture medium as the zero concentration of the standard curve.

[0107] (2) Sample addition: Add 100 μL of 7.8-1000 pg / mL standard to the standard wells. Add 100 μL of cell culture medium to the blank wells and 100 μL of collected cell culture supernatant to the sample wells.

[0108] (3) Add detection antibody: Add 50 μL of detection antibody working solution to each well. Ensure continuous addition without interruption. The addition process should be completed within 15 minutes.

[0109] (4) Incubation: Seal the plate with a sealing film. Oscillate at 100-300 rpm (to ensure that the solution in each well does not spill and is fully mixed), and incubate at room temperature (25°C ± 3°C) for 2 h.

[0110] (5) Washing: Discard the liquid and add 300 μL of washing solution to each well to wash the plate six times. After each wash, pat the plate dry thoroughly on absorbent paper.

[0111] (6) Enzyme incubation: Add 100 μL of streptavidin working solution to each well.

[0112] (7) Incubation: Seal the plate with a new sealing film. Oscillate at 100-300 rpm (to ensure that the solution in each well does not spill and is fully mixed), and incubate at room temperature (25°C ± 3°C) for 45 min.

[0113] (8) Washing: Repeat step 5.

[0114] (9) Add substrate for color development: Add 100 μL of color development substrate to each well, protect from light, and incubate at room temperature (25°C ± 3°C) for 30 min.

[0115] (10) Add stop solution: Add 100 μL of stop solution to each well. The color of the sample will change from blue to yellow.

[0116] (11) Detection reading: Within 30 min, dual-wavelength detection was performed using an ELISA reader to measure the OD value at the maximum absorption wavelength of 450 nm. The results are shown in Table 8.

[0117] Table 8

[0118]

[0119]

[0120] Subtract the OD value of the zero well from the OD value of each standard and sample, and take the average value of the duplicate wells. With the concentration of the standard as the horizontal axis and the OD value as the vertical axis, the Origin software performs four-parameter fitting (4-PL). The fitting concentration is calculated from the standard curve according to the OD value of the sample, and then multiplied by the dilution factor to obtain the actual concentration of the sample. The results are shown in Figure 4 As shown, A is the result of transfection of RAW264.7 cells, and B is the result of transfection of EBL cell line. It can be seen that after the 858 site of bovine DDX58 protein mutated from S to N, the production of IFNB1 increased significantly.

[0121] Embodiment 6

[0122] The specific steps of the CFU experiment after RAW264.7 cell attack are as follows:

[0123] Colony forming units (CFU) refers to each colony formed on an agar plate after cultivation at a certain temperature and time. It is the unit for calculating the number of bacteria or molds.

[0124] S5.1, cell culture and Mycobacterium tuberculosis infection steps are the same as those in Example 4. The infection time is 24h and 36h respectively.

[0125] S5.2. After the attack, wash the cells with PBS for 3-5 times, add 1 mL of 0.25% Triton X-100 in PBS to each well to lyse the cells. Lyse for 10 min at room temperature and dilute the lysate to 10 -2 , 10 -3 , 10 -4 After doubling, take 100 μL to smear on 7H11 solid culture medium, place it in a 37°C incubator and culture for 20 days, then count the number of single colonies.

[0126] The results are as follows Figure 5 As shown, after the 858 site of the bovine DDX58 protein mutated from S to N, the number of viable bacteria in the cells was significantly reduced, indicating that the S858N mutation of the bovine DDX58 protein can significantly promote the clearance of Mycobacterium tuberculosis by macrophages.

[0127] Therefore, the single base mutation of the bovine DDX58 gene provided by the present invention has a significant effect on the production amount of IFNB1 and the clearance effect of macrophages on Mycobacterium tuberculosis, and is highly linked to the anti-tuberculosis trait of the bovine; the single / base / amino acid mutation of the bovine DDX58 gene provided can be used as a linkage site for bovine tuberculosis resistance, and used for genotype selection in bovine tuberculosis resistance breeding, thereby simplifying the breeding method and shortening the breeding time.

[0128] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Use of a bovine DDX58 protein with a single amino acid mutation in the preparation of a preparation for promoting the clearance of Mycobacterium tuberculosis by macrophages, characterized in that: The amino acid sequence of the bovine DDX58 protein is shown in SEQ ID NO.2; the single amino acid mutation is a mutation of the 858th amino acid of the bovine DDX58 protein, from serine to asparagine.

2. Use of a CDS sequence of a bovine DDX58 gene with a single base mutation in the preparation of a preparation for promoting the clearance of Mycobacterium tuberculosis by macrophages, characterized in that: The CDS sequence of the bovine DDX58 gene is shown in SEQ ID NO.1, and the single base mutation is located at the 11603839th nucleotide from the 5′ end of chromosome 8 of the bovine genome ARS-UCD1.2 version reference sequence; the single base mutation is a missense mutation, from G to A.

Images