Application of miR-34a-5p and / or its target gene NOTCH1 in regulating chicken skeletal muscle growth and development

Abstract

The present invention discloses an application of miR-34a-5p and / or target gene NOTCH1 in regulating the growth and development of chicken skeletal muscle, and an application of interfering with miR-34a-5p and / or overexpressing NOTCH1 gene in promoting the growth and development of chicken skeletal muscle. The nucleotide sequence of the miR-34a-5p is shown in SEQ ID NO.1. By verifying the overexpression, interference and targeting relationship of miR-34a-5p, its specific regulatory mechanism in the growth and development of skeletal muscle in the chicken embryonic stage is determined, and the regulatory theory of non-coding RNA in the growth and development of skeletal muscle in the chicken embryonic stage is improved; the NOTCH1 gene is interfered with and functional experiments are performed to determine its specific role in the growth and development of skeletal muscle in the chicken embryonic stage; the miR-34a-5p-NOTCH1 combination disclosed in the present invention can provide a basis for improving the complex regulatory network of chicken skeletal muscle growth and development.

Description

Technical Field

[0001] The present invention relates to application of miR-34a-5p and / or target gene NOTCH1 in regulating the growth and development of chicken skeletal muscle, and belongs to the field of bioengineering. Background Art

[0002] Muscles are mainly divided into skeletal muscle, smooth muscle, and cardiac muscle. Among these three, skeletal muscle accounts for the largest proportion of total body weight. The skeletal muscle content determines the yield of broiler chickens, and the number, diameter, and type of muscle fibers all affect the skeletal muscle content to varying degrees. The growth of animal organisms is affected by external conditions and genetic factors. Genetic factors involve the activation or silencing of numerous genes and their related pathways, forming an extremely complex multi-level regulatory network. These genes may affect muscle growth and development by regulating protein synthesis, muscle cell proliferation, or the ratio of muscle fiber types. As an excellent local breed in my country, Bian chicken has the advantages of good meat quality and strong stress resistance, but its growth rate is slow and its feed utilization rate is low. Various growth performance indicators need to be improved urgently.

[0003] MicroRNA (miRNA) is a non-coding sequence of approximately 22 nt in length that inhibits target gene expression by binding to the 3'UTR region of mRNA. MiRNA has been shown to play a key role in many biological processes, including cell proliferation, differentiation, apoptosis, and migration. Some muscle-specific miRNAs, such as miR-1, miR-206, and miR-133, have been shown to play an important role in the growth and regeneration of skeletal muscle. The growth and development of skeletal muscle in the embryonic stage of poultry has a significant impact on its meat production. The screening and identification of key miRNAs and genes that affect skeletal muscle growth and development during the embryonic stage is crucial. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of miR-34a-5p and / or target gene NOTCH1 in regulating the growth and development of chicken skeletal muscle.

[0005] Technical solution: To solve the above technical problems, the present invention provides the use of interfering with miR-34a-5p and / or overexpressing NOTCH1 gene in promoting the growth and development of chicken skeletal muscle. The nucleotide sequence of the miR-34a-5p is shown in SEQ ID NO.1; the NCBI accession number of the target gene NOTCH1 is NM_001397796.

[0006] The present invention also provides the use of a miR-34a-5p inhibitor in promoting the growth and development of chicken skeletal muscle. The nucleotide sequence of the miR-34a-5p inhibitor is shown in SEQ ID NO.23.

[0007] The present invention also provides the use of overexpressing miR-34a-5p and / or interfering with the NOTCH1 gene in inhibiting the growth and development of chicken skeletal muscle. The nucleotide sequence of the miR-34a-5p is shown in SEQ ID NO.1; the NCBI accession number of the target gene NOTCH1 is NM_001397796.

[0008] The present invention also provides the use of miR-34a-5p mimics in inhibiting the growth and development of chicken skeletal muscle. The nucleotide sequence of the miR-34a-5p mimics is shown in SEQ ID NOs. 19-20.

[0009] The present invention also provides the use of an interfering sequence pair of the NOTCH1 gene in inhibiting the growth and development of chicken skeletal muscle. The nucleotide sequence of the interfering sequence pair of the NOTCH1 gene is shown in any one pair of SEQ ID NOs. 27 to 28, SEQ ID NOs. 29 to 30, SEQ ID NOs. 31 to 32 or SEQ ID NOs. 33 to 34.

[0010] The present invention also provides the use of specific primers for miR-34a-5p or a fluorescent quantitative detection kit containing the specific primers for miR-34a-5p in detecting the growth and development of chicken skeletal muscle. The nucleotide sequence of the specific primers is shown in SEQ ID NO.2.

[0011] The fluorescent quantitative detection kit further includes 2×miRcute Plus miRNAPreMix, a universal reverse primer and enzyme-free double-distilled water.

[0012] The detection kit further includes a primer pair for the internal reference U6, and the nucleotide sequence of the primer pair for the internal reference U6 is shown in SEQ ID NOs. 5 to 6.

[0013] The fluorescent quantitative detection kit further comprises a primer pair for the internal reference β-actin, and the nucleotide sequence of the primer pair for the internal reference β-actin is shown in SEQ ID NOs. 7 to 8.

[0014] The present invention also provides a specific primer pair for the NOTCH1 gene or a fluorescence quantitative detection kit containing the specific primer pair for the NOTCH1 gene for use in detecting the growth and development of chicken skeletal muscle. The nucleotide sequence of the primer pair for the NOTCH1 gene is shown in SEQ ID NOs. 25-26.

[0015] The present invention uses transcriptome sequencing technology to screen miRNA related to the growth and development of chicken skeletal muscle, and screens out miR-34a-5p. This miRNA is involved in regulating the growth and development of chicken skeletal muscle and can accelerate the rapid improvement of growth performance indicators during chicken breeding. By predicting the target genes of miR-34a-5p and functionally verifying miR-34a-5p and the target genes, it is finally determined that miR-34a-5p and the target gene NOTCH1 are used to regulate the growth and development of skeletal muscle in chicken embryos.

[0016] The present invention collects primary myoblasts of chicken embryo leg muscle for in vitro culture, overexpresses and interferes with miR-34a-5p in the myoblasts, extracts total RNA from the cells and performs reverse transcription to obtain cDNA. Fluorescence quantitative PCR is performed using a kit consisting of a specific upstream primer for miR-34a-5p and a primer for internal reference U6. The PCR reaction system and amplification procedure are the same as conventional fluorescence quantitative PCR, using 2 -△△CT Methods The expression level of the miRNA was tested. The expression trends of proliferation and differentiation marker genes were detected at the same time, and the effects of miR-34a-5p on the proliferation and differentiation of chicken myoblasts were comprehensively analyzed by combining CCK-8, EdU detection, protein blotting and indirect immunofluorescence assay. The targeting relationship between miR-34a-5p and the predicted target gene NOTCH1 was verified by dual luciferase reporter assay. Fluorescence quantitative PCR was performed using a kit consisting of specific primers for the NOTCH1 gene and primers for the internal reference β-actin in the present invention. The PCR reaction system and amplification procedure were the same as conventional fluorescence quantitative PCR, using 2 -△△CT Methods The expression level of the gene was tested. The expression trends of proliferation and differentiation marker genes were also detected. CCK-8, EdU detection, Western blotting and indirect immunofluorescence assay were combined to comprehensively analyze the effects of NOTCH1 gene on the proliferation and differentiation of chicken myoblasts.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The kit provided by the present invention can be used to detect the expression level of miR-34a-5p in chicken muscle tissue and myoblasts, and the detection method is simple and quick; 2. The miR-34a-5p provided by the present invention can be used to study the molecular mechanism of skeletal muscle growth and development in chicken embryos; 3. In subsequent studies, by verifying the overexpression, interference and targeting relationship of miR-34a-5p, its specific regulatory mechanism in the growth and development of skeletal muscle in chicken embryos is determined, and the regulatory theory of non-coding RNA in the growth and development of skeletal muscle in chicken embryos is improved; 4. The NOTCH1 gene is interfered with and functional experiments are performed to determine its specific role in the growth and development of skeletal muscle in chicken embryos; 5. The miR-34a-5p-NOTCH1 combination provided by the present invention can provide a basis for improving the complex regulatory network of chicken skeletal muscle growth and development. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results were verified by fluorescent quantitative PCR;

[0019] Figure 2 miR-34a-5p overexpression (A) and interference efficiency (B);

[0020] Figure 3 Quantitative results of proliferation negative regulatory marker genes after overexpression (A) and interference (B) of miR-34a-5p;

[0021] Figure 4 Western blotting results after overexpression (A) and interference (B) of miR-34a-5p; protein levels of P21 gene after overexpression (C) and interference (D) of miR-34a-5p;

[0022] Figure 5 The CCK-8 detection results of overexpression (A) and interference (B) of miR-34a-5p;

[0023] Figure 6 Figure 3 EdU detection results after overexpression and interference of miR-34a-5p: Fluorescence detection results after overexpression (A) and interference (B) of miR-34a-5p, where the first row is the fluorescence image of cell nuclei after Hoechst staining, the second row is the image of proliferating cells stained with EdU, and the third row is the combined image of the first two rows; (C) The proportion of EdU-positive cells after overexpression of miR-34a-5p; (D) The proportion of EdU-positive cells after interference of miR-34a-5p;

[0024] Figure 7 Quantitative results of differentiation marker genes after overexpression (A) and interference (B) of miR-34a-5p;

[0025] Figure 8 Western blotting results of differentiation marker genes after overexpression (A) and interference (B) of miR-34a-5p; protein levels of P21 gene after overexpression (C) and interference (D) of miR-34a-5p; expression levels of MYHC protein after overexpression (C) and interference (D) of miR-34a-5p;

[0026] Figure 9 Results of indirect immunofluorescence assay after overexpression (A) and interference (B) of miR-34a-5p. The first row shows the fluorescence image of cell nuclei after DAPI staining, the second row shows the image of myotube differentiation labeled with dylight 488, and the third row is the composite image of the first two rows. The percentage of myotube area in myoblasts after overexpression (C) and interference (D) of miR-34a-5p was observed.

[0027] Figure 10 This is the NOTCH1 gene interference efficiency result;

[0028] Figure 11 Figure 3. The mRNA and protein expression levels of proliferation marker genes after NOTCH1 interference: (A) Relative expression levels of P21 and P53 genes after NOTCH1 interference; (B) Western blotting results of P21 gene after NOTCH1 interference; (C) Protein level of P21 gene after NOTCH1 interference;

[0029] Figure 12 For CCK-8 cell activity detection;

[0030] Figure 13 Figure 3. EdU detection results after NOTCH1 gene interference in chicken myoblasts: (A) Fluorescence detection results after NOTCH1 gene interference. The first row shows the fluorescence image of cell nuclei after Hoechst staining, the second row shows the image of proliferating cells stained with EdU, and the third row is the composite image of the first two rows. (B) The proportion of EdU-positive cells after NOTCH1 gene interference.

[0031] Figure 14 Quantification of differentiation marker genes and Western blotting results after NOTCH1 gene interference: (A) Relative expression levels of MYOD, MYOG, and MYHC genes after NOTCH1 gene interference; (B) Western blotting results of MYHC gene after NOTCH1 gene interference; (C) Protein level of MYHC gene after NOTCH1 gene interference;

[0032] Figure 15 Results of indirect immunofluorescence detection of myotubes after interference with the NOTCH1 gene (A) and the proportion of myotube area (B). DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0034] Example 1: miRNA-34a-5p, a miRNA that affects skeletal muscle development in chicken embryos, was obtained based on RNA-seq analysis.

[0035] 1. Collection of Sequencing Samples

[0036] Experimental samples were collected from the National Bian Chicken Seedling Farm of Shanxi Agricultural University (formerly the Animal Husbandry Research Institute of the Shanxi Academy of Agricultural Sciences). The fast-growing and slow-growing strains of Bian chickens were used as experimental materials. At the seventh generation, the weights of hens in the fast-growing and slow-growing strains were 1615±176g and 921±93g, respectively. At 300 days of age, 12 hens and one rooster from the seventh-generation fast-growing and slow-growing strains, respectively, whose weights were within the group mean (2250±65.50g for the fast-growing strain and 1252±24.73g for the slow-growing strain), were artificially inseminated. Breeding eggs were collected to establish half-sib families. Hens were sexed at 14 and 20 days of embryonic age by gonadal observation and CHD1 gene PCR. Left leg muscles of the hens were collected for whole-transcriptome sequencing. Four replicates were used per group, for a total of 16 samples.

[0037] 2. Screening of differentially expressed miRNAs and prediction of target genes

[0038] After quality control of the sequencing results, miRNAs with expression differences between embryos at 14 and 20 days of age (P ≤ 0.05) were defined as differentially expressed miRNAs. A total of 127 differentially expressed miRNAs were identified in the fast-growing group, including gga-miR-126-5p, gga-miR-1b-3p, and gga-miR-133a-3p. A total of 131 differentially expressed miRNAs were identified in the slow-growing group, including gga-miR-203a, gga-miR-1a-3p, and gga-miR-205c-3p. miR-34a-5p was found in both the fast-growing and slow-growing groups. Target gene prediction for differentially expressed miR-34a-5p was performed using miRanda (for predicting miRNA binding sites) and RNAhybrid (for predicting miRNA degradation targets), and a potential target gene, NOTCH1 (NCBI accession number: NM_001397796), was identified.

[0039] 3. RT-qPCR validation of miR-34a-5p primers

[0040] Based on the nucleotide sequence of miR-34a-5p (SEQ ID NO. 1) obtained by high-throughput sequencing from Beijing Novogene Biotechnology Co., Ltd., a specific upstream primer (SEQ ID NO. 2) was designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. Reference gene primer sequences were designed based on the U6 mRNA sequence from NCBI (Accession No. NM_001006337.2). A fluorescence quantitative assay kit containing specific primers was used to measure the expression level of this miRNA, following a conventional reaction system and amplification procedure.

[0041] The kit consists of a specific primer, a primer pair for the internal reference U6, 2×miRcute Plus miRNAPreMix (containing SYBR&ROX), a universal reverse primer, and enzyme-free double-distilled water. The sequence of the specific primer is shown in SEQ ID NO.2, the universal reverse primer is shown in SEQ ID NO.3, and the primer pair for the internal reference U6 is shown in SEQ ID NO.5 and SEQ ID NO.6. 2×miRcute Plus miRNAPreMix (containing SYBR&ROX) is from Nanjing Novozymes Biotechnology Co., Ltd., and the universal reverse primer is from Beijing Takara Biotechnology Co., Ltd. The stem-loop primer for miR-34a-5p was designed according to the miRNA Design V1.01 software and synthesized by Shanghai Bioengineering. The stem-loop primer sequence is shown in SEQ ID NO.4. The stem-loop primer was used for reverse transcription according to Novozymes' miRNA 1st Strand cDNA Synthesis Kit, and the reverse transcription product obtained, i.e., the template cDNA, was used for fluorescence quantitative detection.

[0042] miR-34a-5p:5'-UGGCAGUGUCUUAGCUGGUUGUU-3'(SEQ ID NO.1)

[0043] miR-34a-5p:F:5'-GCGTGGCAGTGTCTTAGCTG-3'(SEQ ID NO.2)

[0044] R:5'-AGTGCAGGGTCCGAGGTATT-3'(SEQ ID NO.3)

[0045] miR-34a-5p stem-loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

[0046] TGGATACGACAACAAC (SEQ ID NO. 4)

[0047] U6:F:5'-GGAACGATACAGAGAAGATTAGC-3'(SEQ ID NO.5)

[0048] R:5'-TGGAACGCTTCACGAATTTGCG-3'(SEQ ID NO.6)

[0049] The fluorescence quantitative reaction system (20 μl) consisted of 10.0 μl of 2× miRcute Plus miRNA Premix, 0.4 μl of specific primers, 0.4 μl of universal reverse primer, 2.0 μl of template cDNA, and 7.2 μl of ddH2O. The fluorescence quantitative reaction protocol was as follows: initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec, 60°C for 30 sec, and 95°C for 15 sec, 60°C for 60 sec, and 95°C for 15 sec.

[0050] The fluorescence quantitative reaction system and reaction procedure using the internal reference U6 were the same as above, with the only difference being that the primers in the reaction system were replaced with 0.4 μl each of the upstream and downstream primers of U6.

[0051] Use 2 -△△CT Methods The relative expression levels of miR-34a-5p in the leg muscle tissue of fast-growing and slow-growing chickens at different developmental stages were calculated. Figure 1 It can be seen that the results of fluorescence quantitative PCR are consistent with the sequencing results of RNA-seq. Figure 1 F14 vs F20 and S14 vs S20 represent comparison groups at embryonic ages 14 and 20 in the fast-growing group and the slow-growing group, respectively. The kit provided by the present invention can be used to detect the expression level of miR-34a-5p in muscle tissue and myoblasts during the embryonic stage of chickens. The detection method is simple and rapid. The miR-34a-5p provided by the present invention can serve as an important miRNA for studying the regulatory mechanism of skeletal muscle growth and development in embryonic chickens.

[0052] Example 2 Effect of miR-34a-5p on the proliferation and differentiation of chicken myoblasts

[0053] The present invention commissioned Guangzhou Ruibo Biotechnology Co., Ltd. to synthesize miR-34a-5p mimics, inhibitors and negative controls, which were named miR-34a-5p mimic (mimic), mimic-NC (mimic negative control), miR-34a-5p inhibitor (inhibitor) and inhibitor-NC (inhibitor negative control), respectively.

[0054] Primer sequences for the internal reference gene β-actin are shown in SEQ ID NOs. 7 and 8. Gene expression levels were measured using a fluorescence quantitative kit using a standard reaction system and amplification protocol. Primer sequences for the proliferation marker genes P21 and P53, and the differentiation marker genes MYOD, MYOG, and MYHC, were synthesized by Nanjing Qingke.

[0055] β-actin:F:5'-CAGCCATCTTTCTTGGGTAT-3'SEQ ID NO:7

[0056] R:5'-CTGTGATCTCCTTCTGCATCC-3'SEQ ID NO:8

[0057] P21:F:5'-CCCGTAGACCACGAGCAGAT-3'(SEQ ID NO.9)

[0058] R:5'-CGTCTCGGTCTCGAAGTTGA-3'(SEQ ID NO.10)

[0059] P53:F:5'-GAGATGCTGAAGGAGATCAATGAG-3'(SEQ ID NO.11)

[0060] R:5'-GTGGTCAGTCCGAGCCTTTT-3'(SEQ ID NO.12)

[0061] MYOD:F:5'-GCTACTACACGGAATCACCAAAT-3'(SEQ ID NO.13)

[0062] R:5'-CTGGGCTCCACTGTCACTCA-3'(SEQ ID NO.14)

[0063] MYOG:F:5'-CGGAGGCTGAAGAAGGTGAA-3'(SEQ ID NO.15)

[0064] R:5'-CGGTCCTCTGCCTGGTCAT-3'(SEQ ID NO.16)

[0065] MYHC:F:5'-CTCCTCACGCTTTGGTAA-3'(SEQ ID NO.17)

[0066] R:5'-TGATAGTCGTATGGGTTGGT-3'(SEQ ID NO.18)

[0067] The fluorescence quantitative reaction system (20 μl) consisted of 10.0 μl of 2× Taq Pro Universal SYBR qPCR Master Mix, 0.4 μl of gene forward primer, 0.4 μl of gene reverse primer, 2.0 μl of template cDNA, and 7.2 μl of DEPC water. Both 2× Taq Pro Universal SYBR qPCR Master Mix and DEPC water were purchased from Nanjing Novozymes Biotechnology Co., Ltd. The fluorescence quantitative reaction program was 40 cycles of 95°C for 30 seconds, 95°C for 10 seconds, and 60°C for 30 seconds.

[0068] Use 2 -△△CT Methods The relative expression levels of genes were calculated.

[0069] The steps for indirect immunofluorescence experiments are as follows:

[0070] Chicken myoblasts were seeded in 12-well plates and cultured with 20% FBS. When cells filled the bottom of the 12-well plates, they were washed twice with PBS and replaced with differentiation medium (DMEM 2% HS) to induce myoblast differentiation. The cells were transfected with miR-34a-5p mimic, mimic-NC, miR-34a-5p inhibitor, and inhibitor-NC, with three replicates for each treatment. After 72 hours of differentiation, the culture medium was aspirated and the plates were rinsed twice with PBS. 4% PFA tissue cell fixative preheated at 37°C was added to the 12-well plates and fixed at room temperature for 30 minutes. After fixation, the plates were washed twice with PBS for 5 minutes. Subsequently, 0.5% Triton X-100 solution was added to each well to increase cell permeability and the cells were allowed to stand for 15 minutes. The plates were then washed twice with PBS. The plates were then blocked with 5% BSA blocking solution and incubated at 37°C for 30 minutes to prevent nonspecific staining. After blocking, the primary antibody incubation was performed. 500 μl of anti-MYH1 antibody (Group Proteintech, USA) was diluted (anti-MYH1 antibody: 5% BSA blocking buffer = 1:500) and added to each well. The cells were then incubated overnight at 4°C in the dark. After incubation, the cells were washed three times with 1× PBST. Subsequently, the secondary antibody incubation was performed. 500 μl of Goat anti-Rabbit IgG-dylight 488 (Boster, USA) was diluted (Goat anti-Rabbit IgG-dylight 488: 5% BSA blocking buffer = 1:500) was added to each well and incubated at 37°C for 1 hour. After incubation, the cells were washed three times with 1× PBST. The nuclei were then stained with DAPI staining solution for 3-5 minutes. After staining, the cells were washed again three times with 1× PBST. Finally, a small amount of PBS was added to keep the cells moist, and the treated cells were immediately observed under an inverted fluorescence microscope.

[0071] The sequences of the mimics, inhibitors, and negative controls are as follows:

[0072] miR-34a-5p mimic: sense strand: UGGCAGUGUCUUAGCUGGUUGUU SEQ ID NO: 19; antisense strand: CAACCAGCUAAGACACUGCCAUU SEQ ID NO: 20;

[0073] mimic-NC: sense strand: UUUGUACUACACAAAAGUACUG SEQ ID NO: 21; antisense strand: CAGUACUUUUGUGUAGUACAAA SEQ ID NO: 22;

[0074] miR-34a-5p inhibitor: AACAACCAGCUAAGACACUGCCASEQ ID NO: 23;

[0075] inhibitor-NC:CAGUACUUUUGUGUAGUACAAA SEQ ID NO:24;

[0076] Chicken myoblasts were plated in 12-well cell culture plates and transfected with miR-34a-5p mimic, mimic-NC, miR-34a-5p inhibitor, or inhibitor-NC when the cell density reached 60%. Twenty-four hours after transfection, miR-34a-5p expression levels were measured using the aforementioned method. Overexpression of miR-34a-5p increased its relative expression by 1326-fold (** indicates P < 0.01). Figure 2 A), after interfering with miR-34a-5p, its relative expression level was only 1 / 2 of that in the control group (* represents P < 0.05, Figure 2 B), indicating that miR-34a-5p mimics and inhibitors have good effects. Quantitative experimental results showed that the relative expression levels of proliferation negative regulatory marker genes P21 and P53 were significantly increased after overexpression of miR-34a-5p (** represents P < 0.01, Figure 3 A), while the results were opposite after interfering with miR-34a-5p (** represents P < 0.01, Figure 3 B). Western blot results showed that overexpression of miR-34a-5p significantly increased the protein level of P21 gene (* represents P < 0.05, Figure 4 A, C), while interference with miR-34a-5p significantly reduced the protein level of P21 gene (* represents P < 0.05, Figure 4 B, D) The results of CCK-8 assay showed that overexpression of miR-34a-5p significantly or extremely significantly inhibited the proliferation of myoblasts (* represents P < 0.05, ** represents P < 0.01, Figure 5 A), while when miR-34a-5p was interfered with, the proliferation of myoblasts was significantly or extremely significantly promoted (* represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, Figure 5B). Hoechst staining and EdU assay results showed that after overexpression of miR-34a-5p, the number of myoblasts in the proliferative phase was significantly less than that in the control group (** represents P < 0.01, Figure 6 A, C); however, the results were opposite after interfering with miR-34a-5p (** represents P < 0.01, Figure 6 B, D). The above results indicate that miR-34a-5p has an inhibitory effect on the proliferation of chicken myoblasts.

[0077] During the myoblast differentiation stage, quantitative experimental results showed that the relative expression levels of differentiation marker genes MYOD, MYOG, and MYHC were significantly decreased after overexpression of miR-34a-5p (** represents P < 0.01, Figure 7 A), while interference with miR-34a-5p had the opposite effect (** represents P < 0.01, Figure 7 B). Western Blot results showed that overexpression of miR-34a-5p significantly reduced the expression level of MYHC protein (** represents P < 0.01, Figure 8 A, C), while interference with miR-34a-5p significantly increased the relative expression level of MYHC protein (* represents P < 0.05, Figure 8 B, D). The results of indirect immunofluorescence experiments showed that after overexpression of miR-34a-5p, the myotube area of ​​myoblasts was significantly decreased compared with the control group (*** represents P < 0.001, Figure 9 A, C), while interference with miR-34a-5p showed completely opposite results (** represents P < 0.01, Figure 9 B, D). The above results indicate that miR-34a-5p has an inhibitory effect on the differentiation of chicken myoblasts.

[0078] Example 3 Effect of NOTCH1 gene on the proliferation and differentiation of chicken myoblasts

[0079] The present invention designed fluorescent quantitative primers based on the NOTCH1 gene (NCBI accession number NM_001397796), with the sequences being SEQ ID NO: 25 and SEQ ID NO: 26. Shanghai Genema Gene Co., Ltd. was commissioned to construct four NOTCH1 gene interference sequences and negative controls, named siR-1603, siR-2170, siR-2224, siR-4010, and siR-NC, respectively.

[0080] NOTCH1 gene fluorescence quantitative primer sequences are as follows:

[0081] NOTCH1:F:5'-CGGATCTATGCGGCTGTGAG-3'SEQ ID NO:25

[0082] R:5'-CACACCTCCGTCCATTGAG-3'SEQ ID NO:26

[0083] Four interference sequences (siR-1603, siR-2170, siR-2224, siR-4010) and negative control (siR-NC)

[0084] The sequence is as follows:

[0085] siR-1603: sense strand: GCGUCUACUGUGAAAUCAATT SEQ ID NO: 27; antisense strand: UUGAUUUCACAGUAGACGCTT SEQ ID NO: 28;

[0086] siR-2170: sense strand: GCAUGUGCAACAUCAACAUTT SEQ ID NO: 29; antisense strand: AUGUUGAUGUUGCACAUGCTT SEQ ID NO: 30;

[0087] siR-2224: sense strand: GCACAUGCAAGGAUGGCAUTT SEQ ID NO: 31; antisense strand: AUGCCACAUCUUGCAUGUGCTT SEQ ID NO: 32;

[0088] siR-4010: sense strand: GCGGGUCAAUGACUACAAATT SEQ ID NO: 33; antisense strand: UUUGUAGUCAUUGACCCGCTT SEQ ID NO: 34;

[0089] siR-NC: sense strand: UUCUCCGAACGUGUCACGUTT SEQ ID NO: 35; antisense strand: ACGUGACACGUUCGGAGAATT SEQ ID NO: 36;

[0090] Chicken myoblasts were evenly plated in 12-well culture plates. When the cell density reached 50%, they were transfected with four interference sequences and a control sequence, with three replicates per group. After 24 hours, all samples were collected for fluorescence quantitative analysis. Reverse transcription was performed using stem-loop primers using the Novozymes miRNA 1st Strand cDNA Synthesis Kit. The resulting reverse transcription product served as the template cDNA for fluorescence quantitative analysis. The fluorescence quantitative reaction system consisted of 20 μl of the following: 10.0 μl of 2× Taq Pro Universal SYBR qPCR Master Mix; 0.4 μl of NOTCH1 forward primer; 0.4 μl of NOTCH1 reverse primer; 2.0 μl of template cDNA; and 7.2 μl of DEPC water. Both the 2× Taq Pro Universal SYBR qPCR Master Mix and the DEPC water were purchased from Nanjing Novozymes Biotechnology Co., Ltd. The fluorescence quantitative reaction protocol was 40 cycles of 95°C for 30 seconds, 95°C for 10 seconds, and 60°C for 30 seconds. Fluorescence quantitative results showed that the interference effects of the four interference sequences of NOTCH1 gene reached significant or extremely significant levels (* represents P < 0.05, ** represents P < 0.01, Figure 10 ), among which siR-1603 had the best interference effect. Subsequent transfection experiments were performed using the interference sequence siR-1603. Quantitative results showed that after interfering with the NOTCH1 gene, the relative expression levels of the P21 gene and the P53 gene were significantly increased (** represents P < 0.01, Figure 11 A). Western blot results showed that interference with NOTCH1 gene significantly increased the protein level of P21 gene (** represents P < 0.01, Figure 11 B, C) CCK-8 results showed that after the NOTCH1 gene was interfered with, the activity of myoblasts was significantly or extremely significantly lower than that of the control group (* represents P < 0.05, ** represents P < 0.01, Figure 12 EdU experiments showed that the proportion of EdU-positive cells in myoblasts after NOTCH1 gene interference was significantly lower than that in the control group (* represents P < 0.05, Figure 13 A, B). The above results indicate that NOTCH1 gene can significantly promote the proliferation of chicken myoblasts.

[0091] During the myoblast differentiation stage, real-time fluorescence quantitative results showed that interference with the NOTCH1 gene significantly reduced the relative expression levels of the MYOD, MYOG, and MYHC genes (** represents P < 0.01, Figure 14 A); Western blot results showed that the protein expression level of MYHC gene was significantly downregulated after interference with NOTCH1 gene (*** represents P < 0.001, Figure 14 B, C). The results of indirect immunofluorescence experiments showed that the myotube surface area was significantly decreased after NOTCH1 gene interference (*** represents P < 0.001, Figure 15 A, B). The above results indicate that NOTCH1 gene has the function of promoting the differentiation of chicken myoblasts.

[0092] As previously mentioned, miR-34a-5p can inhibit the proliferation and differentiation of chicken myoblasts, while NOTCH1 gene can promote the proliferation and differentiation of chicken myoblasts. The miR-34a-5p and NOTCH1 provided by the present invention can be used as important miRNAs and genes for studying the regulation of chicken skeletal muscle growth and development.

Claims

1. Application of an interference sequence of the NOTCH1 gene in inhibiting the growth and development of chicken skeletal muscle, characterized in that: The nucleotide sequence of the sense strand of the interference sequence of the NOTCH1 gene is shown in SEQ ID NO.27, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.28.

Images