A nucleic acid aptamer targeting MlaC protein and its application

Abstract

The present invention discloses a nucleic acid aptamer targeting MlaC protein and its application, wherein the nucleotide sequence of the nucleic acid aptamer is shown in any one of SEQ ID NO.1-33. The MlaC nucleic acid aptamer of the present invention is obtained by in vitro screening technology, and the aptamer can be folded into a specific three-dimensional structure to interact with the MlaC protein with high affinity. The aptamer also has the advantages of strong specificity, easy preparation, easy modification, etc. The MlaC nucleic acid aptamer of the present invention is suitable for purification and detection of MlaC protein and preparation of drugs targeting MlaC protein, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a nucleic acid aptamer targeting MlaC protein and an application thereof. Background Art

[0002] The asymmetric cell membrane is a key protective barrier for Gram-negative bacteria, which can limit the entry of small molecules such as antibiotics into the cell. In order to maintain this lipid asymmetry, the ABC (ATP-binding cassette) transport system in bacteria transports phospholipid molecules between the inner and outer membranes to prevent them from accumulating in the inner or outer membrane. Specifically, the MlaA protein is involved in the extraction of phospholipids on the outer membrane, the MlaC protein transfers phospholipids bidirectionally between the inner and outer membranes, and the MlaBDEF receives phospholipids transported to the inner membrane. Destroying any key component in the Mla pathway will increase the permeability of the outer membrane, impair bacterial function, and thus increase the sensitivity of bacteria to antibiotics. Therefore, the MlaC protein, which plays an important role in this pathway, can be used as a key target for the development of antibacterial drugs.

[0003] Nucleic acid aptamers are single-stranded DNA or RNA molecules obtained by in vitro screening, which can bind to the corresponding targets with high affinity and specificity. Compared with protein antibodies, nucleic acid aptamers have a smaller relative molecular mass, good tissue penetration ability, low immunogenicity, and are not easy to cause immune responses in the body; nucleic acid aptamers can be synthesized in large quantities at low cost through chemical methods, and there is no difference between batches; in addition, nucleic acid aptamers are easy to modify and can be connected to different groups to achieve binding with various carriers. Thanks to their excellent physical and chemical properties, nucleic acid aptamers are expected to become a substitute for traditional anti-infective drugs and have great application prospects in disease treatment.

[0004] It is of great significance to screen out nucleic acid aptamers that specifically target the MlaC protein in Gram-negative pathogens and make them potential new antibacterial drugs. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a nucleic acid aptamer having high affinity binding to MlaC protein and application thereof.

[0006] Based on the above purpose, the first aspect of the present invention provides a nucleic acid aptamer targeting MlaC protein, whose nucleotide sequence is shown in any one of SEQ ID NO.1-12. In addition, by analyzing the secondary structure of the nucleic acid aptamer, we deleted some nucleotides and obtained a shorter aptamer sequence that can bind to the MlaC protein, and these truncated nucleic acid aptamer sequences are shown in any one of SEQ ID NO.13-24. After structural analysis of some nucleic acid aptamers and MlaC protein complexes, we identified two types of key motifs that interact with the MlaC protein, and their sequences are shown in SEQ ID NO.25-26.

[0007] SEQ ID NO.1 (m520-6): TTATGGGTGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCC;

[0008] SEQ ID NO.2(m520-3):GGATATGCGCCCCCGGTGGAGGTGGCGTGGTGGCGCTGTT;

[0009] SEQ ID NO.3(m520-8):TGGCCGCGCCGCGGTGGAGGTGCGTCGTGCTCGGCTTCTG;

[0010] SEQ ID NO.4(m620-8):TCTAGCCGCGGTGGAGGTGCGTCGTGCTGGAGCCTTAGAA;

[0011] SEQ ID NO.5(m626-8):GCCCCGGTGGAGGTGGCGTGGTGACTTCTGACAGTTCACTG;

[0012] SEQ ID NO.6(m526-4):GGTCCCCGGTGGAGGTGGCGTGGTGACTTCATATCATTAAC;

[0013] SEQ ID NO.7 (m620-7): TGTCCCCGGTGGAGGTGCGTGGTGTGCCTATATGCCCTTG;

[0014] SEQ ID NO.8(m626-7):TAAAGCCGCGGTGGAGGTGCGTCGTGTCTATACGCTCTTG;

[0015] SEQ ID NO.9(m520-1):CCGTCGGTGGAGGTGCGGCTGGCATCACTCTGCTCCGGCC;

[0016] SEQ ID NO.10(m626-10):GGTCCCCCTCGGCGGTGGTAGGTCTTATGGTCCCGGGTGC;

[0017] SEQ ID NO.11(m520-9):GGTCCCCCTCGGCGGTGGTACGTGTCATGGTCCAATCGTC;

[0018] SEQ ID NO.12(m620-9):GGCGGGTTGTGGGTCCCATCGGCGGCGGCGAGCCCTCGTG;

[0019] SEQ ID NO.13(S5208-1):GCCGCGCCGCGGTGGAGGTGCGTCGTGCTCGGC;

[0020] SEQ ID NO.14(S520-3):GCGCCCCCGGTGGAGGTGCGTGGTGGCGC;

[0021] SEQ ID NO.15(S520-6):GTGGGTGTTTGTTGGGCTAGTCGTCACCCGC;

[0022] SEQ ID NO.16(S620-8):TCTAGCCGCGGTGGAGGTGCGTCGTGCTGGA;

[0023] SEQ ID NO.17(S626-8):GCCCCGGTGGAGGTGCGTGGTGAC;

[0024] SEQ ID NO.18(S520-9):GGTCCCCCTCGGCGGTGGTACGTGTCATGG;

[0025] SEQ ID NO.19(S626-10):CCCCTCGGCGGTGGTAGGTCTTATGGTCC;

[0026] SEQ ID NO.20(S526-4):GTCCCCGGTGGAGGTGCGTGGTGAC;

[0027] SEQ ID NO.21 (SS526-4): CCCCGGTGGAGGTGCGTGGTGA;

[0028] SEQ ID NO.22(S5206-1):GGGGTTTGTTGGGCTAGTCGTCCCC;

[0029] SEQ ID NO.23(S5206-4):GGGTGTTTGTTGGGCTAGTCGTCACCC;

[0030] SEQ ID NO.24(S6267): CCGCGGTGGAGGTGCGTCGTGT;

[0031] SEQ ID NO.25(motif1):TTTGTTGGGCTAGTCG;

[0032] SEQ ID NO.26 (motif2): CGGTGGAGGTGCG;

[0033] The above sequence can be directly obtained by chemical solid phase synthesis, or by PCR amplification of DNA templates by spacer-18 modified primers, and then separated by urea denatured polyacrylamide electrophoresis to obtain long and short chains. In addition, we also cyclized two nucleic acid aptamers in series to obtain circular DNA aptamers that can resist nuclease degradation, the sequences are shown in SEQ ID NO.27-33, and their stability is further improved. The circular DNA aptamers (SEQ ID NO.27-33) can be obtained by successively treating with T4 polynucleotide kinase and T4 DNA ligase to covalently connect the 5'-phosphate and 3'-hydroxyl of the single-stranded molecule to form a phosphodiester bond.

[0034] SEQ ID NO.27(3a):

[0035] GCGCCCCCGGTGGAGGTGCGTGGTGGCGCGCCCCCGGTGGAGGTGCGTGGTGGCGC;

[0036] SEQ ID NO.28(3b):

[0037] GGCGCCCCCGGTGGAGGTGCGTGGTGGCGCCGCGCCCCCGGTGGAGGTGCGTGGTGGCGC;

[0038] SEQ ID NO.29(3c):

[0039] GGCGCCCCCGGTGGAGGTGCGTGGTGGCGCCGGCGCCCCCGGTGGAGGTGCGTGGTGGCGCC;

[0040] SEQ ID NO.30(6b):

[0041] GGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCCGTGGGTGTTTGTTGGGCTAGTCGTCACCCGC;

[0042] SEQ ID NO.31(6c):

[0043] GGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCCGGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCC;

[0044] SEQ ID NO.32(3f):

[0045] GCCCCCGGTGGAGGTGCGTGGTGGCGCCCCCGGTGGAGGTGCGTGGTGGC;

[0046] SEQ ID NO.33(6f):

[0047] GGGTGTTTGTTGGGCTAGTCGTCACCCGGGTGTTTGTTGGGCTAGTCGTCACCC;

[0048] Furthermore, nucleic acid aptamer nucleotide sequences that still contain key nucleic acid motifs and retain the ability to bind to MlaC protein after nucleotide truncation, extension, mutation, concatenation or cyclization of any sequence shown in SEQ ID NO.1-33 also fall within the scope of protection of the present invention.

[0049] Preferably, the nucleotide sequence of the nucleic acid aptamer contains a label or the base is chemically modified.

[0050] The labels include, but are not limited to, isotope labels, fluorescent labels, biotin labels, enzyme labels and chemiluminescent labels.

[0051] The chemical modifications include, but are not limited to, methylation, amination, sulfhydrylation, phosphorylation, thiolation, carboxylation and isotope modification.

[0052] On the other hand, the present invention also provides the use of the above-mentioned nucleic acid aptamer in the preparation of a product for detecting or purifying MlaC protein.

[0053] Preferably, the products include but are not limited to kits, biosensors, and detection chips.

[0054] On the other hand, the present invention also provides the use of the above-mentioned nucleic acid aptamer in the preparation of a drug targeting the MlaC protein.

[0055] Preferably, the drug targeting the MlaC protein is an antibacterial drug, more preferably, a drug against Gram-negative bacteria.

[0056] On the other hand, the present invention also provides a product for detecting or purifying MlaC protein, wherein the product comprises the above-mentioned nucleic acid aptamer.

[0057] On the other hand, the present invention also provides a drug targeting MlaC protein, which comprises the above-mentioned nucleic acid aptamer.

[0058] The present invention has the following beneficial effects:

[0059] (1) The MlaC nucleic acid aptamer of the present invention is obtained by in vitro screening technology. The aptamer can be folded into a specific three-dimensional structure to interact with the MlaC protein with high affinity. The aptamer also has the advantages of strong specificity, easy preparation, and easy modification.

[0060] (2) The present invention obtains a circular MlaC aptamer having the same function as the MlaC aptamer by performing nucleotide deletion, mutation, concatenation and cyclization on the basis of the MlaC aptamer, which can become a potential nucleic acid drug for treating Gram-negative pathogenic bacteria infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 MlaC protein purification-gel filtration chromatography.

[0062] Figure 2 Separation of single-stranded DNA molecules by urea denaturing gel electrophoresis.

[0063] Figure 3 EMSA experiments were used to verify the interaction between nucleic acid aptamers and MlaC protein.

[0064] Figure 4 ITC experiments were used to verify the interaction between nucleic acid aptamers and MlaC protein.

[0065] Figure 5 This is the S5206-4-MlaC complex crystal.

[0066] Figure 6 Schematic diagram of the secondary structure and three-dimensional structural model of the nucleic acid aptamer and MlaC protein complex.

[0067] Figure 7Schematic diagram of the secondary structure of the circular DNA aptamer.

[0068] Figure 8 Identification of circular aptamers after T4 DNA ligase treatment. Linear-3a refers to the linear state of 3a, Circular-3a refers to 3a after circularization, and so on.

[0069] Fig. 9 The EMSA experiment verifies the interaction between the circular aptamer and the MlaC protein. Among them, 3a-control is the control group, that is, only 3a is added to the system, 3a-MlaC is the experimental group, that is, 3a and MlaC proteins are added to the system at the same time, and so on. DETAILED DESCRIPTION

[0070] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0071] Example 1 Screening of nucleic acid aptamers targeting MlaC protein

[0072] (1) Expression and purification of MlaC protein

[0073] According to the signal peptide prediction results, the potential signal peptide sequence of the MlaC protein was deleted, and its gene sequence was constructed into the pRSFDuet-1 protein expression vector (Novagen, 71341-3). The fusion protein with a His-sumo tag was obtained using the Escherichia coli prokaryotic expression system; high-purity MlaC protein was obtained by affinity chromatography, ion exchange chromatography, gel filtration chromatography and other methods.

[0074] MlaC protein purification - gel filtration chromatography Figure 1 shown.

[0075] (2) Design of DNA nucleic acid library

[0076] Since there have been no reports of DNA aptamers targeting MlaC protein, a 40 nt DNA library with completely random sequences was used, and primer binding sequences of 20 nt were used at both ends for subsequent PCR amplification. In order to obtain a single-stranded DNA library, Spacer18 and 20 consecutive adenylate residues were introduced at the 5' end of the reverse primer, and then the PCR amplification product was subjected to urea denaturing gel electrophoresis to obtain a high-purity single-stranded DNA library (Table 1 and Figure 2 ).

[0077] Table 1. DNA library and primer sequences used in the experiment

[0078]

[0079] (3) Carboxyl magnetic bead screening

[0080] The MlaC protein is coupled to activated carboxyl magnetic beads, and the purified single-stranded DNA library is annealed at the same time; then, the annealed single-stranded DNA library is added to the MlaC protein-carboxyl magnetic beads for incubation, and the non-specifically bound DNA in the magnetic beads is washed with a screening buffer to remove the DNA molecules that specifically bind to the target protein. The DNA molecules that are specifically bound to the target protein are then eluted with an elution buffer, and the retained DNA is enriched by PCR as the library for the next round of screening.

[0081] Table 2. Summary of screening process and retention rate

[0082] Number of rounds ssDNA amount (μg) Protein-beads amount Cleaning frequency and time ssDNA elution amount (μg) Retention Rate 1 30 1 3 times, 10s / time 0.414 1.38％ 2 5 1 4 times, 10s / time 0.540 10.49％ 3 5 1 4 times, 5 minutes each time 0.088 1.72％ 4 5 1 5 times, 10 minutes each time 0.206 4.03％ 5 5 1 / 2 5 times, 10 minutes each time 0.420 8.40％ 6 5 1 / 4 5 times, 10 minutes each time 0.736 14.72％

[0083] During the screening process, we increased the screening pressure by adjusting the amount of ssDNA and protein-magnetic column added in each round, and monitored the enrichment by calculating the DNA retention rate. As can be seen from Table 2, the retention rate basically increased in each round, indicating that DNA was enriched. After six rounds of screening, we sequenced the DNA library and obtained multiple DNA sequences.

[0084] Example 2 Detection of the interaction between nucleic acid aptamers and MlaC protein by gel shift assay (EMSA)

[0085] The DNA molecules obtained by screening (SEQ ID NO.1-12) and the truncated DNA molecules (SEQ ID NO.13-24) were synthesized and purified respectively, and then the DNA molecules were annealed in the screening buffer; then, the MlaC protein was incubated with the DNA molecules of different concentrations for 1 hour; the state of the MlaC protein and the DNA molecules was further detected by 10% polyacrylamide gel electrophoresis without urea; after the electrophoresis, the gel was transferred to ddH2O containing Dured dye and stained for 10 minutes, and then the experimental results were recorded on a gel imager.

[0086] like Figure 3 As shown in the figure, the Control group refers to the system with only nucleic acid aptamers; the MlaC-his group refers to the aptamers with the addition of MlaC-his fusion protein, which is the protein used in the screening process, specifically: the C-terminus of the MlaC protein carries a his tag; the MlaC group refers to the aptamers with the addition of MlaC protein. The results show that after the addition of MlaC protein to the system, the nucleic acid aptamers will have an upward band on the gel, indicating that these screened nucleic acid aptamers are bound to the MlaC protein, not to the his tag of the MlaC-his fusion protein.

[0087] Example 3 Isothermal Titration Calorimetry (ITC) Detection of the Interaction between Aptamer and MlaC Protein

[0088] The MlaC protein and DNA aptamer were dialyzed in the screening buffer overnight, and the samples were taken out and diluted to the working concentration and the DNA was annealed. In the isothermal calorimetric titration experiment, the titration concentration ratio of MlaC to DNA was 1:14. After the titration, the supporting software was used for data processing and analysis. Figure 4 As shown, both S520-3 and S520-6 can bind to MlaC protein with nanomolar affinity, while the truncated forms of S520-6, S5206-1 and S5206-4, still retain the ability to bind to MlaC protein, but with a reduced affinity.

[0089] Example 4 Structural Analysis of the Complex of Nucleic Acid Aptamer and MlaC Protein

[0090] (1) Screening and optimization of crystallization conditions

[0091] The purified DNA sample was diluted to an appropriate concentration and annealed, then incubated with MlaC protein for 1 hour; the sample and the crystal growth screening buffer of different components were mixed evenly on the sitting drop plate using the LCP protein crystallization automation instrument, and then the sealed crystallization plate was placed in a constant temperature incubator and the crystal growth was regularly observed and recorded. After the initial screening of crystal growth, the crystallization conditions were repeated and optimized to obtain high-resolution complex crystals ( Figure 5 ).

[0092] (2) X-ray data collection and processing

[0093] The crystals were placed in cryoprotectant and quickly transferred to liquid nitrogen for cryopreservation, and X-ray diffraction data were collected using the Shanghai Synchrotron Radiation Source. The data were processed using the HKL3000 equipped at the Shanghai Synchrotron Radiation Source.

[0094] Table 3. Summary of crystal data of S5206-4-MlaC complex

[0095]

[0096]

[0097] (3) Structural analysis

[0098] Using the single MlaC protein structure (PDB number: 5UWA) as a model, the phase angle problem of the MlaC and DNA complex crystal structure was solved by molecular replacement method. Then, Phenix, Coot and other software were used to solve and correct the complex crystal structure, and finally the complex structures of MlaC protein with S5206-4 and S6267 were obtained.

[0099] (4) Structural analysis

[0100] Structural analysis was performed using pymol software to determine the overall structure of the MlaC protein and DNA aptamer, analyze the key sites involved in the interaction, and determine the locations of important metal ions in the structure. Figure 6 A shows the three-dimensional structure of the complex of MlaC protein and S5206-4. Figure 6 B shows the three-dimensional structure of the complex of MlaC protein and S6267. From the structure, we can see that multiple nucleotides on the key motifs (light cyan; S5206-4 corresponds to motif1; S6267 corresponds to motif2) in the two types of nucleic acid aptamers respectively form extensive hydrogen bond interactions (indicated by dotted lines) with some amino acids at the bottom of the MlaC protein (proteins are marked in pink, and the sites involved in binding are marked in purple), so that the aptamer can bind to the concave area at the bottom of the MlaC protein with high affinity and high specificity. These structural information shows that the two types of motifs play a key role in the binding of nucleic acid aptamers and MlaC proteins.

[0101] Example 5 Preparation of circular DNA aptamers and detection of their interaction with MlaC protein

[0102] (1) Preparation of circular DNA aptamers

[0103] Based on the structure of the complex, the DNA aptamer was rationally truncated and mutated. Afterwards, two MlaC nucleic acid aptamers were connected in series to form a long single-stranded molecule, the 5'-hydroxyl of the single-stranded molecule was phosphorylated using T4 polynucleotide kinase, and then the 5'-phosphate and 3'-hydroxyl of the single-stranded molecule were covalently linked to form a phosphodiester bond using T4 DNA ligase, and finally the cyclized product was separated by urea-polyacrylamide gel electrophoresis to synthesize a circular DNA nucleic acid aptamer with a sequence such as SEQ ID NO.27-33.

[0104] The secondary structure of circular DNA aptamer is shown in Figure 7 The results of circular aptamer identification after T4 DNA ligase treatment are shown in Figure 8 .

[0105] (2) Detection of the interaction between circular DNA aptamer and MlaC protein

[0106] Referring to the EMSA method of Example 2, the interaction between the circular DNA aptamer and the MlaC protein was detected. The results are shown in Fig. 9 .

[0107] like Fig. 9As shown, the designed tandem aptamers in the linear or circular state can present an upward band on the gel after adding the MlaC protein, indicating that the circularized nucleic acid aptamer has the ability to bind to the MlaC protein.

[0108] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A nucleic acid aptamer targeting MlaC protein, characterized in that: The nucleic acid aptamer includes a nucleotide sequence as shown in any one of SEQ ID NO.1, SEQ ID NO.15, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.25, SEQ ID NO.30, SEQ ID NO.31, and SEQ ID NO.

33.

2. The nucleic acid aptamer according to claim 1, characterized in that The nucleotide sequence of the nucleic acid aptamer contains a label or the base is chemically modified.

3. The nucleic acid aptamer according to claim 2, characterized in that The marker includes one or more of an isotope marker, a fluorescent marker, a biotin marker, an enzyme marker and a chemiluminescent marker; the chemical modification includes one or more of a methylation modification, an amination modification, a sulfhydryl modification, a phosphorylation modification, a thiolation modification, a carboxylation modification and an isotope modification.

4. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in preparing a product for detecting or purifying MlaC protein.

5. The use according to claim 4, characterized in that: The products include test kits, biosensors, and detection chips.

6. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in the preparation of a drug targeting MlaC protein.

7. The use according to claim 6, characterized in that: The drug targeting the MlaC protein is an antibacterial drug.

8. A product for detecting or purifying MlaC protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 3.

9. A drug targeting MlaC protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 3.

Images